ID: 1092183259

View in Genome Browser
Species Human (GRCh38)
Location 12:6460757-6460779
Sequence TCCTTAGCTCCTCCTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092183256_1092183259 -3 Left 1092183256 12:6460737-6460759 CCAGGGACTCACACACACAATCC 0: 1
1: 0
2: 1
3: 17
4: 272
Right 1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG 0: 1
1: 0
2: 1
3: 32
4: 338
1092183254_1092183259 10 Left 1092183254 12:6460724-6460746 CCAGGCTCCTCAACCAGGGACTC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG 0: 1
1: 0
2: 1
3: 32
4: 338
1092183251_1092183259 17 Left 1092183251 12:6460717-6460739 CCTTGTTCCAGGCTCCTCAACCA 0: 1
1: 0
2: 1
3: 14
4: 206
Right 1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG 0: 1
1: 0
2: 1
3: 32
4: 338
1092183255_1092183259 3 Left 1092183255 12:6460731-6460753 CCTCAACCAGGGACTCACACACA 0: 1
1: 0
2: 9
3: 44
4: 400
Right 1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG 0: 1
1: 0
2: 1
3: 32
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092183259 Original CRISPR TCCTTAGCTCCTCCTCCCTG GGG Intronic
900226597 1:1536076-1536098 CACTCAGCACCTCCTCCCTGAGG + Intronic
900291243 1:1924404-1924426 TCCTCAGCTCGCCCTCCCAGAGG - Exonic
900320416 1:2080788-2080810 TCCTTAGGTCCCTCTCACTGTGG + Intronic
900365272 1:2309669-2309691 CCCCCACCTCCTCCTCCCTGTGG + Exonic
900860174 1:5223327-5223349 TCCCTGACTCCTCCTCTCTGGGG - Intergenic
901125829 1:6928049-6928071 TCCTGTTCTCCTCCTGCCTGGGG + Intronic
901215359 1:7551892-7551914 TACTTAACTCTCCCTCCCTGGGG - Intronic
901234663 1:7661490-7661512 TCTTTAGCTCCCCCTCACTATGG - Intronic
901329199 1:8391568-8391590 TCCTTCCCTCCTCATCTCTGGGG + Intronic
902281566 1:15378473-15378495 TCCTTAGGTCACCCTCCCTCCGG + Intronic
902526086 1:17058437-17058459 TCCTTTCCTCCTCCTTCATGTGG + Intergenic
903135159 1:21304452-21304474 CCCTTATCTCCTCCTCACTGTGG + Intronic
903786963 1:25867788-25867810 TCCTAAGCTCCTCCTGCATTAGG + Intronic
904490886 1:30858354-30858376 TCCTTCCCACCTCCTCTCTGTGG - Intergenic
904596182 1:31647147-31647169 TCCTTGGCTTCAACTCCCTGGGG + Intergenic
904901551 1:33861761-33861783 TCTTTATCTCCTCCTGCCTAGGG - Intronic
904924691 1:34038155-34038177 ACCATAGCTCCTCCTAACTGCGG - Intronic
906153306 1:43600241-43600263 CCCCTAGCCCCTCCTCTCTGAGG + Intronic
906325614 1:44843442-44843464 CCCCTCCCTCCTCCTCCCTGGGG - Intergenic
906535899 1:46550849-46550871 TCCTTCTTTTCTCCTCCCTGTGG + Intronic
906796004 1:48696894-48696916 TCCGTGGCCCCTCCTCCCTGAGG + Intronic
907272432 1:53298769-53298791 TCCACAGCTCCGCCTCCCTTGGG + Intronic
907987991 1:59552074-59552096 TCCTTAGTCCCTCCAGCCTGGGG - Intronic
908832221 1:68190741-68190763 TTCTTAGCTCCTCATTTCTGTGG - Intronic
908845802 1:68323152-68323174 CCCTCAGTTCCTCCTCCCAGGGG + Intergenic
909288393 1:73850564-73850586 TCTTTAACCTCTCCTCCCTGTGG + Intergenic
910723651 1:90314888-90314910 TCCGCAGATTCTCCTCCCTGTGG + Intergenic
911563627 1:99436046-99436068 TGCTGTGCTCCTTCTCCCTGTGG + Intergenic
912460679 1:109828856-109828878 TCCTGGGCTCCCCCTTCCTGTGG + Intergenic
912804500 1:112744389-112744411 TCCTTCGCACCTGCTCCCGGAGG - Intergenic
913056716 1:115168772-115168794 TCCTGACCTCCACATCCCTGAGG - Intergenic
915304745 1:154970790-154970812 CCCTTAGCTCCCCGCCCCTGGGG - Intronic
915590273 1:156866641-156866663 CCCTCAGATCCCCCTCCCTGGGG + Intronic
915825887 1:159076626-159076648 TGCTTACCTCCTGATCCCTGGGG + Exonic
915917996 1:159952590-159952612 TCCTAAGCTCCTCAAACCTGGGG + Intronic
916065240 1:161131592-161131614 TCCTTTGCTCCTCCACACTTGGG + Intronic
917011773 1:170482058-170482080 TATTTAGCTCATCCTCCCTCAGG + Intergenic
917442578 1:175080253-175080275 TCCTCAGCTACTACCCCCTGGGG + Exonic
918140413 1:181714933-181714955 TCCTTAGCTTCTCTTGCCAGTGG - Intronic
918311013 1:183285305-183285327 TCCTTAGCTGCTCCTCCCACTGG + Intronic
918356636 1:183711054-183711076 TCCTGAGCTCCTGCTCCTGGAGG + Intronic
918778515 1:188667802-188667824 TACTCTGCTCCCCCTCCCTGAGG + Intergenic
920504082 1:206504495-206504517 TCTTTAGCACTTCTTCCCTGGGG + Intergenic
922797070 1:228345462-228345484 TCATTAACGCCTGCTCCCTGGGG + Intronic
924620154 1:245653325-245653347 TCATTTTCTCCTCCTCCCTGTGG - Intronic
924740063 1:246789791-246789813 TCCTCAGATCCTTCTCACTGGGG - Intergenic
1066192897 10:33072040-33072062 TCCTTATGCCCTCCTCCCTTTGG + Intergenic
1067405515 10:46019935-46019957 TCTGTCCCTCCTCCTCCCTGTGG + Intronic
1067539060 10:47138407-47138429 TCCTTAGCTCCTCTTCCAGAAGG - Intergenic
1068091009 10:52432043-52432065 CCCTTTCCTCCTCCTCCCTCTGG + Intergenic
1068492371 10:57739616-57739638 TCATTAGCTCGTTCTCTCTGAGG - Intergenic
1069988281 10:72298623-72298645 TCCTTAGCTCTCTCTTCCTGCGG - Intergenic
1070494664 10:77010585-77010607 TCCTAAGCTGCCCCACCCTGAGG + Intronic
1071775745 10:88786131-88786153 TCCATGGCGCCTCCTCTCTGTGG - Intergenic
1071836624 10:89424704-89424726 TTCTTAGGTCATTCTCCCTGAGG - Intergenic
1072553386 10:96495808-96495830 TCCCCAGCTGCTCCTGCCTGGGG + Intronic
1072635415 10:97174539-97174561 TCCCTGCCTCCTCCTCCTTGGGG - Intronic
1072682751 10:97518340-97518362 TCCCTAGCTGCCCCTCCCCGAGG + Intronic
1072789403 10:98306855-98306877 TCCAGAGCTCCTCTTCCCTCTGG - Intergenic
1073044473 10:100628685-100628707 GCCTTAGCTCATCCTCTTTGTGG - Intergenic
1076202093 10:128566980-128567002 TCCTGCGCTCCTCAGCCCTGGGG + Intergenic
1076345555 10:129776527-129776549 TCCTTTGTTCCTCCCTCCTGAGG - Intergenic
1076500934 10:130935442-130935464 TCCTTTGCTTCTTCTGCCTGTGG + Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077333760 11:1994463-1994485 TCCTCCTCACCTCCTCCCTGTGG + Intergenic
1081591192 11:44424455-44424477 CCCTTGGCTCCAGCTCCCTGAGG - Intergenic
1081783907 11:45733055-45733077 CCCTTAGCTCCTCTTCCTTGGGG + Intergenic
1083275742 11:61596014-61596036 CCATTAGCTCCTGCTCCTTGTGG - Intergenic
1083378755 11:62246976-62246998 TCCTCCTCTCCTCTTCCCTGGGG + Intergenic
1084411489 11:69008689-69008711 TCCTTAGCTTCTCTTTCCTGTGG + Intronic
1084485046 11:69443363-69443385 TCCCCTGCTCCTCCTCCCTCGGG + Intergenic
1084647135 11:70465076-70465098 ACCTCAGCGCCGCCTCCCTGTGG - Intergenic
1086615033 11:88806231-88806253 TCTTGCTCTCCTCCTCCCTGTGG - Intronic
1088300865 11:108356926-108356948 ATCTTGGCTCCTCCTCCCGGAGG - Intronic
1089010552 11:115128603-115128625 TCCTTCCCTTCTCCTCCTTGTGG - Intergenic
1089457427 11:118633762-118633784 TGATTAGGTCCTCCTCTCTGGGG + Intronic
1089468831 11:118704777-118704799 TCCTCAGCTCCTCATGCCAGGGG - Intergenic
1089511076 11:118997721-118997743 TCCTTACCTCCTCATGCCTCAGG + Intergenic
1089601411 11:119617599-119617621 GCGTGAGCTCATCCTCCCTGTGG + Intergenic
1091231003 11:133988114-133988136 TGCTTAGGGCCCCCTCCCTGGGG - Intergenic
1091335865 11:134765185-134765207 CCCTTACCTCCTGCTCCCTCCGG + Intergenic
1202816740 11_KI270721v1_random:49645-49667 TCCTCCTCACCTCCTCCCTGTGG + Intergenic
1091410757 12:237640-237662 TCCGCACTTCCTCCTCCCTGTGG - Intronic
1092181771 12:6451317-6451339 TGCTGCCCTCCTCCTCCCTGGGG - Exonic
1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG + Intronic
1094160218 12:27382251-27382273 CCCTTAGGTCTTCCTCCCTTAGG - Intronic
1096873050 12:54606656-54606678 TCCTTCCCTCCTCCTCCCGGGGG + Intergenic
1097818997 12:64108300-64108322 TCCTTATCTCGTCTTCCCTGTGG - Intronic
1097964708 12:65566436-65566458 TCCTTATCTCCTTCACGCTGAGG + Intergenic
1098570891 12:71986096-71986118 TCCTTAGGTCCTTCTGCCTGAGG - Intronic
1100564892 12:95786041-95786063 TTTTTGGCTCCTCTTCCCTGGGG - Intronic
1100899228 12:99219378-99219400 TCCTTATCTTCTCATCTCTGTGG + Intronic
1104427971 12:128693638-128693660 TCCTTCACCCCTGCTCCCTGGGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1108563964 13:51676041-51676063 CCCTCAGATCCTCCACCCTGTGG - Intronic
1109907522 13:68864903-68864925 TTTTTATCTCCTCATCCCTGAGG + Intergenic
1110632877 13:77729945-77729967 TCCTCACCTCCTCCTCCCGTTGG - Intronic
1114493294 14:23116723-23116745 TCCTTTGTCCCTCATCCCTGAGG - Intergenic
1115869909 14:37788419-37788441 ACCTTAGCTCTTCTTCCCTGTGG - Intronic
1116885277 14:50214796-50214818 TCCTCAGGCCCCCCTCCCTGAGG + Intronic
1118657797 14:67971714-67971736 TACTTAGGTCATCCTCCCTCAGG + Intronic
1118747332 14:68783896-68783918 TCATGAGCTCCTTCTCCCTGAGG + Intergenic
1119259077 14:73226769-73226791 TCCATGCCTCCTCCTCCCTCAGG + Intergenic
1119933065 14:78566650-78566672 TCCTTCCTTCCTCCTCCCTCTGG + Intronic
1121105881 14:91279423-91279445 CCCAGAGCTCCTCCTTCCTGAGG - Intronic
1122671948 14:103379415-103379437 TCCTTGGCTTTTCCTGCCTGAGG - Intergenic
1123024424 14:105418021-105418043 GCCTTTGCTCCTTCTCCCAGTGG - Intronic
1123895857 15:24829320-24829342 TCCAAAGCTCCTCCTCCTGGAGG - Intronic
1124516690 15:30372344-30372366 TCCTTCTCTCCTCCTCCCTATGG - Intronic
1124587919 15:31026242-31026264 TCTTTAGCTCCTCGTCGCTAAGG + Exonic
1124648407 15:31456882-31456904 TCCTCTGCTCCTCCTCCCTATGG + Intergenic
1124654584 15:31498068-31498090 TCCACAGCTCCTCTTCCCTTTGG - Intronic
1124726228 15:32158387-32158409 TCCTTCTCTCCTCCTCCCTATGG + Intronic
1125580569 15:40782615-40782637 TGCTTAGCTCTTCCTCCAGGAGG - Intronic
1125767824 15:42146931-42146953 TCCCTAGCTCCTAACCCCTGGGG - Intronic
1128725075 15:69982263-69982285 TGGTTAGCACCTCCTCCCTGGGG - Intergenic
1129107877 15:73321708-73321730 TCCTGGGGTCCTCTTCCCTGAGG + Exonic
1130377936 15:83346676-83346698 CCATCAGCTCCTCCTCTCTGGGG + Intergenic
1130699784 15:86166629-86166651 TCCTGAGCTCCTCCTCCTGAAGG - Intronic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132547620 16:540504-540526 TGCTCAGCTCCTGCACCCTGGGG - Intronic
1132751351 16:1459296-1459318 TGCTGAGCTCCCCTTCCCTGAGG - Intronic
1132751380 16:1459403-1459425 TGCTGAGCTCCCCTTCCCTGGGG - Intronic
1132751408 16:1459508-1459530 TGCTGAGCTCCCCTTCCCTGAGG - Intronic
1132751428 16:1459578-1459600 TGCTGAGCTCCCCTTCCCTGAGG - Intronic
1132751437 16:1459613-1459635 TGCTGAGCTCCCCTTCCCTGGGG - Intronic
1132751460 16:1459683-1459705 TGCTGAGCTCCCCTTCCCTGAGG - Intronic
1132751469 16:1459718-1459740 TGCTGAGCTCCCCTTCCCTGAGG - Intronic
1132751478 16:1459753-1459775 TGCTGAGCTCCCCTTCCCTGGGG - Intronic
1132751501 16:1459823-1459845 TGCTGAGCTCCCCTTCCCTGAGG - Intronic
1132751510 16:1459858-1459880 TGCTGAGCTCCCCTTCCCTGGGG - Intronic
1132751539 16:1459963-1459985 TGCTGAGCTCCCCTTCCCTGGGG - Intronic
1132895860 16:2229129-2229151 TCTTTACCTGCTCCTCCCAGAGG + Intronic
1133745035 16:8679873-8679895 GCTATAGCTCTTCCTCCCTGGGG + Intronic
1134092976 16:11401383-11401405 TGCTGGTCTCCTCCTCCCTGTGG - Exonic
1135952910 16:26931839-26931861 TCCTCAGCTCCCACTCACTGGGG - Intergenic
1138303937 16:55957188-55957210 TATTTACCTCCTCCTCCCTTTGG + Intergenic
1139525359 16:67512449-67512471 TCCCTTCCTTCTCCTCCCTGGGG - Intergenic
1139954482 16:70686577-70686599 TCCTTGGCTCCTTCTCCAAGTGG + Intergenic
1140484545 16:75283242-75283264 TCCTGAGCTGCTCTTCCCTTGGG + Intergenic
1141110624 16:81268116-81268138 ACCTCACCTTCTCCTCCCTGTGG - Exonic
1141218217 16:82044683-82044705 TACTTTGCTCCACCTCCCTGGGG + Intronic
1146688101 17:34855304-34855326 TCCTTAGCTCCTCCCCCGATTGG - Intergenic
1147235836 17:39056922-39056944 TCCCTCGCCCCTCCTACCTGGGG - Intergenic
1148148727 17:45383527-45383549 TCCTCAACTGCTCCTCCCTCAGG - Intergenic
1148462650 17:47847274-47847296 TCCTCAGTGCCGCCTCCCTGCGG - Exonic
1148683466 17:49487528-49487550 GCCTCTGCTCCTGCTCCCTGGGG - Intergenic
1149051661 17:52311948-52311970 TTCTTTGCTTCTCCTCCCTTAGG - Intergenic
1151216236 17:72578522-72578544 TCCTCAGCGCTTCCTCCTTGGGG - Intergenic
1151430261 17:74057586-74057608 TCCTTCCCTGCTGCTCCCTGAGG - Intergenic
1151990762 17:77572544-77572566 CCATTAGCTCCTCCACCCTATGG - Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152585620 17:81188274-81188296 TCCTCAGCTCCTCCTGGCTTGGG + Intergenic
1152701447 17:81821853-81821875 TCCCCTGCTCCTCCTCCCCGGGG + Intergenic
1152791705 17:82283625-82283647 TCCCTAGCACCTCCTCCCCAGGG + Intergenic
1155073731 18:22337784-22337806 TCCTTCCCTGCTCCTTCCTGCGG + Intergenic
1155444793 18:25899814-25899836 CCCTCAGCTCCACCTCCCAGAGG + Intergenic
1155560492 18:27071017-27071039 TTCATGGCTCCACCTCCCTGTGG + Intronic
1156170934 18:34484831-34484853 TGCTTACCTCCTCCACCCAGAGG - Intergenic
1156300712 18:35833681-35833703 TCAATAGCTCCTCCTCCTTAGGG - Intergenic
1156355662 18:36338316-36338338 TGCTCAGCTCAGCCTCCCTGGGG + Intronic
1157733519 18:50025438-50025460 TCCTTAAATCCACCTCCTTGAGG - Intronic
1158190996 18:54828534-54828556 TACTTATCTCCTCCAACCTGTGG - Exonic
1158914141 18:62103409-62103431 TCCTCAGCTGCTCCTGGCTGAGG + Intronic
1159999681 18:75004827-75004849 TCCTTAGCTACCCCTCACCGGGG + Intronic
1160767610 19:815363-815385 GCCTGAGCGCCCCCTCCCTGTGG - Intronic
1161290874 19:3492692-3492714 TCCACATCACCTCCTCCCTGAGG - Intronic
1161435872 19:4262531-4262553 ACCCTAACTCCTCCACCCTGTGG + Intronic
1161740813 19:6020044-6020066 GCCTTGGCTCCTGCTGCCTGTGG - Intronic
1162034629 19:7932379-7932401 TCCCTCACTCCTCCTGCCTGAGG - Intronic
1163034587 19:14563523-14563545 TCCACAGCTCCTCCCACCTGGGG - Intronic
1163851988 19:19669297-19669319 TCCCCAGTTCCTCCTCCCTTAGG + Intronic
1164446110 19:28318841-28318863 TTCTCAGCTCCTCTTCTCTGGGG - Intergenic
1164560806 19:29290877-29290899 TCCGTTGCTCCTGTTCCCTGAGG - Intergenic
1164733350 19:30522132-30522154 TCCTTGGCTCCTCTGCTCTGTGG + Intronic
1166781910 19:45347491-45347513 TCCTCTCCTCCTCCTCGCTGGGG - Exonic
1167294978 19:48644669-48644691 TCCCTAGCCCCTCCTCCCCTGGG - Intronic
1167596909 19:50432716-50432738 GCCCCAGCCCCTCCTCCCTGGGG + Intergenic
1167694017 19:51003446-51003468 ACCTAACCTCCTCCTCCCCGAGG + Intronic
1167738306 19:51310683-51310705 TCCCCAGCCCCTCCTCCCTCAGG - Intergenic
925117940 2:1396217-1396239 TTTTTAGCTCCTCCGTCCTGGGG - Intronic
925153438 2:1633223-1633245 ACTTGAGCTCCTCCTCCCTTGGG + Exonic
925383892 2:3448559-3448581 CCATTAGCTCCTCCTCCCGCAGG + Intronic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
927361236 2:22236700-22236722 TCATTGGCGCCCCCTCCCTGGGG + Intergenic
932624017 2:73284153-73284175 CCCTTACCTCCTCCACCCCGCGG + Exonic
933895968 2:86809614-86809636 TGCTCACCTCTTCCTCCCTGCGG - Intergenic
940794362 2:158061558-158061580 TCCTGAGCTCCTACTCCTTCAGG + Intronic
941828519 2:169927015-169927037 TCCCTTTCTCCCCCTCCCTGTGG + Intronic
941868762 2:170361821-170361843 TCCTCTGTTCCTCCTCACTGTGG + Intronic
942578504 2:177392332-177392354 ACCTGTGCTCTTCCTCCCTGCGG - Intronic
947016090 2:225621467-225621489 TCCTCATTTCCTCCTCCCTTTGG - Intronic
947118844 2:226797349-226797371 TGCTTAGCTCCTCCTCACCGCGG + Exonic
947949663 2:234136192-234136214 TCAAGAGCTCTTCCTCCCTGAGG - Intergenic
948379434 2:237542323-237542345 TCCTGCGTTCCTCCTGCCTGGGG + Intronic
1169664410 20:8019072-8019094 TCCTTCCCTTCTCCTCCCTATGG + Intronic
1169805027 20:9550420-9550442 TTCTTATCTCCTTCACCCTGAGG + Intronic
1170052307 20:12159222-12159244 TCTCTGCCTCCTCCTCCCTGTGG - Intergenic
1170139951 20:13115731-13115753 TCCTAAGCTCCTCCTCCTGAGGG + Intronic
1170496149 20:16927429-16927451 TCCTTAGCTCTTCCTCACATTGG + Intergenic
1171227152 20:23451380-23451402 TCCTCACCTCCTCCTCCCCCTGG + Intronic
1171308314 20:24124901-24124923 TCCTCTGCTCCTCCTTCCTAAGG - Intergenic
1171333016 20:24357927-24357949 TCCTCAGCTCCCCTTCCCTGAGG + Intergenic
1172101828 20:32488646-32488668 TCCTTTGCTCCTCTTCACTTGGG + Intronic
1172201878 20:33132455-33132477 GCCTTAGCACCTGCTCCCTGAGG - Intergenic
1173020662 20:39265301-39265323 TCCTGAGTCCCTCCTTCCTGTGG - Intergenic
1173565959 20:44038947-44038969 TCCGTGTCTCCTCCTTCCTGGGG + Intronic
1173991942 20:47310257-47310279 TCCTCCACACCTCCTCCCTGTGG - Intronic
1177154591 21:17488451-17488473 TCCTTAGCTACTACTCCAGGAGG - Intergenic
1178023517 21:28437066-28437088 TCCTTAAGTCCTCCGCCATGTGG - Intergenic
1180022600 21:45137864-45137886 TCCAGAGCCCCTCCTGCCTGGGG - Intronic
1181329066 22:22075094-22075116 TCCATAACTCCTCCTCTGTGAGG + Intergenic
1182881983 22:33741671-33741693 TCCTCACCTCATCCTGCCTGTGG - Intronic
1183356860 22:37364326-37364348 TCCGGAGCCCCTCATCCCTGAGG - Intergenic
1183785048 22:40024379-40024401 TGCTTAGCTGCTGCTGCCTGAGG - Intronic
1184728834 22:46362170-46362192 TCCTTTGCTCCTGCTCCCCGTGG - Exonic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1185285092 22:49996531-49996553 GCCTTGCCTCCTCCTCCCTGGGG - Exonic
1185322400 22:50207837-50207859 TCCTTTGCATCTCCTCCCCGAGG + Intronic
1185337274 22:50276280-50276302 TCCACAGCGCCCCCTCCCTGCGG - Intronic
949733030 3:7136291-7136313 TCCTTAACTCCTCTCCCCTCAGG - Intronic
950776636 3:15355933-15355955 TCCTTAACTCCTACTTCCTAGGG + Intergenic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
953027311 3:39152715-39152737 TCCTCAGTTTCTCCTCCCCGGGG - Intronic
954334973 3:49911032-49911054 CCCATTGCTCCTTCTCCCTGAGG + Intronic
954385737 3:50242913-50242935 TCATTACCTCCTCCTCCCGCCGG - Intronic
955863110 3:63353357-63353379 TCACTAGATCCCCCTCCCTGTGG - Intronic
958543783 3:95513341-95513363 TTCTTAGCTCCTCTTACCTTTGG - Intergenic
959803927 3:110528492-110528514 TCCTTACGCCCTCCTCCCTTTGG - Intergenic
959879134 3:111422484-111422506 GCCTTAGATTCTTCTCCCTGGGG - Intronic
962270301 3:133973408-133973430 ACCCAAGCTCCACCTCCCTGGGG - Intronic
963480618 3:145868544-145868566 TCTGTAGCTCCTGCTCCCTCAGG - Intergenic
963975628 3:151476937-151476959 TCCTTCACTCCTCTTCCCAGTGG - Intergenic
964232374 3:154486489-154486511 ATCTTGGCCCCTCCTCCCTGAGG - Intergenic
967906511 3:194505528-194505550 TCCCTAGGTGATCCTCCCTGGGG + Intergenic
968462525 4:732446-732468 TCCCCTTCTCCTCCTCCCTGCGG - Intronic
969221408 4:5761253-5761275 TCCTGAGATCATGCTCCCTGTGG - Intronic
969370158 4:6726930-6726952 TCCTTCTCTCCTCCTCCCCCAGG - Intergenic
969641457 4:8401576-8401598 TCTTCAGCCCATCCTCCCTGTGG + Intronic
969693309 4:8719779-8719801 TCCTTTGCTCCTCTTCTCTGGGG + Intergenic
969696658 4:8738777-8738799 TCCACAGCTGCTCCTCTCTGGGG - Intergenic
969719409 4:8885096-8885118 CCCTTGGCCCCTTCTCCCTGTGG + Intergenic
969890656 4:10256807-10256829 GCCTTAGGTCCTGCGCCCTGAGG - Intergenic
971454894 4:26834974-26834996 CCCTTAGCCCTTACTCCCTGTGG + Intergenic
971970411 4:33612453-33612475 TCATTAACCCCTCCTCCCTTTGG - Intergenic
973872765 4:55183019-55183041 TACCTACCTCCTCCTCCATGTGG + Intergenic
976820103 4:89196482-89196504 TCACAAGCTCCTCCTTCCTGAGG + Intergenic
979589110 4:122457954-122457976 TCCTTATATCCACCTCCCTTGGG - Intergenic
980619375 4:135278651-135278673 ACATTAGCTCCTCCTTCCAGGGG + Intergenic
982819323 4:159926806-159926828 TCCTCACCTCCTCCTGCCTCTGG + Intergenic
984030524 4:174598700-174598722 TCCCTCCCTCCTCCTGCCTGTGG + Intergenic
985949091 5:3209765-3209787 TCCTTGGCGCCTCCTCCGTGAGG + Intergenic
986696263 5:10358081-10358103 TCCTTTGCTCCTTCTCAGTGAGG - Intronic
987161473 5:15148706-15148728 TCCTTGCCTCTTCCTACCTGGGG - Intergenic
987359348 5:17092689-17092711 ACCTTAGCTCGTCCTTCATGAGG - Intronic
987399069 5:17456317-17456339 TCCCTATCTCCTCCTCCATTTGG + Intergenic
988586499 5:32511889-32511911 TCCTAAGCTCTTCTTGCCTGTGG + Intergenic
991215628 5:64155145-64155167 CCAATAGCTCCTCCTCCCTGGGG - Intergenic
991363268 5:65842882-65842904 CCCTTATCTCCTCCTTCCTTGGG - Intronic
991457453 5:66819751-66819773 AACTTAGCTTCTCCTCACTGTGG + Intronic
992809239 5:80370345-80370367 TCCTTTGTTCCTCCTACCTTGGG - Intergenic
993169801 5:84404054-84404076 TCCTTGGATTTTCCTCCCTGTGG + Intergenic
993224403 5:85148751-85148773 CCCTCACCTCCTACTCCCTGTGG + Intergenic
994550682 5:101231325-101231347 TCATTAGCTCCTACTCCTAGGGG - Intergenic
995243437 5:109911239-109911261 TCCTCAGCTCCTCCTTTCTGGGG + Intergenic
995640820 5:114255372-114255394 TCCTTAGCACCTCATCCGTCTGG - Intergenic
997092290 5:130871688-130871710 TCATTATCTCGTCCTCCCTCTGG - Intergenic
997102829 5:130987664-130987686 TCCACCCCTCCTCCTCCCTGGGG + Intergenic
997402152 5:133611817-133611839 TTCTCAGCACCTCCTCCCCGCGG - Intronic
998207346 5:140167517-140167539 TCCTAACCTCCTCCACCCTGTGG - Intergenic
999094880 5:148968993-148969015 TCCTTCCCTCATCCTCCCTTAGG + Intronic
1001435760 5:171698108-171698130 TCCCCAGCTCCTCCTCCTTCAGG - Intergenic
1003105510 6:3211959-3211981 TCCCTAGCTCTTCCTCCCACAGG - Intergenic
1005941586 6:30564322-30564344 TTCTTAGCTCCTCTTCCCCTAGG - Intergenic
1006300508 6:33191504-33191526 TGCCTAGCCCCTCCTCCCTCTGG - Intronic
1006579956 6:35071499-35071521 TCATTACACCCTCCTCCCTGTGG - Intronic
1006735389 6:36269465-36269487 TCCCCAGCTGCTCCTCCTTGGGG + Intronic
1006851543 6:37102405-37102427 ACATCAGCTGCTCCTCCCTGGGG - Intergenic
1007306582 6:40911410-40911432 TCCTTGACTTCTCCTCCCAGAGG + Intergenic
1007607244 6:43125876-43125898 CCCTTAGCTGCTCCTCTGTGTGG + Intronic
1007680231 6:43628850-43628872 TCCCGTGCCCCTCCTCCCTGGGG + Intronic
1007714931 6:43850423-43850445 TCCCTAGCTTCTCCTCCCCTGGG - Intergenic
1007730555 6:43942876-43942898 TCCTTGCCTCTTCTTCCCTGTGG - Intergenic
1007751162 6:44072866-44072888 TGCACAGCTCCTACTCCCTGGGG - Intergenic
1008930422 6:56933062-56933084 TCCTCAGTTCCTCCTATCTGAGG - Intronic
1011279212 6:85660231-85660253 TCTTCAGCTCCACCTCCATGGGG + Intergenic
1014252386 6:119128057-119128079 TCCTTATAACCTCCTCCCTTTGG + Intronic
1017011168 6:150064773-150064795 TCCTTAGCTCCTGCTACCCCAGG + Intronic
1017314723 6:153017311-153017333 TCCCTGTCTCCTGCTCCCTGTGG - Intronic
1018420395 6:163635931-163635953 GCCTCAGTTCCTCATCCCTGGGG - Intergenic
1018472345 6:164107975-164107997 TCCTTAGATCCCCCACCTTGGGG + Intergenic
1019013735 6:168864204-168864226 TCCTAAGCGCCTCCACCCCGAGG + Intergenic
1019014495 6:168870079-168870101 TCCTTATACCCTCCTCCCTTTGG + Intergenic
1019125555 6:169838154-169838176 TCCTTGGTTTCTGCTCCCTGGGG - Intergenic
1019298914 7:293562-293584 TTCATAGCTCATCCTCTCTGAGG + Intergenic
1019408039 7:894178-894200 TCCAGAGCTCCCCATCCCTGAGG + Intronic
1019645921 7:2128918-2128940 GGCTTTTCTCCTCCTCCCTGTGG - Intronic
1020762882 7:12289981-12290003 TCCTTCGGTCCTGCTGCCTGCGG - Intergenic
1021241056 7:18201548-18201570 TGCTCAGCTAGTCCTCCCTGAGG - Intronic
1021585852 7:22207385-22207407 TACTTAGCTACCCTTCCCTGGGG - Intronic
1022892314 7:34714144-34714166 TCCTCAGTTCCTCCTCACTTGGG + Intronic
1022900922 7:34810002-34810024 TCCTCAGAACCTCCTCCCTATGG + Intronic
1022911069 7:34899980-34900002 TGCTCTGCCCCTCCTCCCTGTGG - Intergenic
1023115351 7:36856635-36856657 TTCTTAGCTTCCCCTCCCAGAGG + Intronic
1024936877 7:54719709-54719731 TCCTTAGCCCCTCCACACTCAGG + Intergenic
1025943903 7:66092135-66092157 TCCTGAGCTCCCCCACCCTCTGG - Intronic
1026247426 7:68633670-68633692 TCATTATCCCCTCCTCCCTTTGG - Intergenic
1026850049 7:73718684-73718706 TCCTGGGCTCCTCATCCCTAAGG + Intronic
1027423273 7:78037769-78037791 CCTTTGGCTCCCCCTCCCTGGGG - Intronic
1027536172 7:79404839-79404861 TCCTTAGGTCCACCTTCCTAAGG + Intronic
1027620682 7:80481392-80481414 TCATTAGGCCCTCCTCCCTTTGG + Intronic
1028018635 7:85744459-85744481 CCAATAGCTCCTCCTCCTTGTGG + Intergenic
1029707852 7:102285136-102285158 TCCTCACTTCTTCCTCCCTGGGG + Intronic
1030606369 7:111642977-111642999 TCATTATCTCCTCCTTCCTTTGG + Intergenic
1031428212 7:121633819-121633841 TCCATATTTACTCCTCCCTGTGG + Intergenic
1032087369 7:128891149-128891171 CCCTCGGCTGCTCCTCCCTGGGG - Intronic
1034749561 7:153556140-153556162 TCTCAAGTTCCTCCTCCCTGTGG + Intergenic
1034926132 7:155123808-155123830 TCCTTAGCTCCTGGTGGCTGTGG + Intergenic
1035356407 7:158278270-158278292 ACCTTGTTTCCTCCTCCCTGGGG - Intronic
1035394577 7:158526704-158526726 TCCTCACCTCCTCCTCCATAAGG - Intronic
1037012346 8:13859224-13859246 TCCTTGGCTCAGCCTCTCTGGGG - Intergenic
1037741252 8:21610868-21610890 ATCTTAGCTGCTCTTCCCTGGGG + Intergenic
1037990359 8:23317339-23317361 ACCTTAGCTCTACTTCCCTGAGG - Intronic
1038267741 8:26049394-26049416 TCCTCTGCTCCTCCTCCCCCTGG + Intergenic
1039175863 8:34805133-34805155 TCCTAAGCTGCACCTCACTGAGG - Intergenic
1039969462 8:42308856-42308878 ACCTGAGCTGCTCCTCTCTGGGG - Intronic
1042053355 8:64735021-64735043 TCCTTAGCTCCACCTCCTCCAGG - Intronic
1042055303 8:64758016-64758038 TCCTTTGCTCCTGTTCCCTAGGG + Intronic
1042712648 8:71735259-71735281 TCCGTGGCTTCTCTTCCCTGTGG - Intergenic
1043494293 8:80783154-80783176 ACTTTTGCTCCTGCTCCCTGTGG - Intronic
1043885722 8:85597447-85597469 TCCTTTCCTCCTTCTCCCTAGGG + Intergenic
1047001110 8:120573271-120573293 TCCTAAGCACATCCTCACTGTGG + Intronic
1047717222 8:127606720-127606742 CCCCTGGCTCCTCCTCCTTGGGG + Intergenic
1048268060 8:133004966-133004988 TCCTTATCGCCTCCTCCCAGTGG - Intronic
1049287185 8:141782208-141782230 TCGTTACCCGCTCCTCCCTGTGG - Intergenic
1049433999 8:142577875-142577897 TGGTGAGCTCTTCCTCCCTGGGG + Intergenic
1050365609 9:4870782-4870804 TCCTTGGTTCCTCCTCCCCAAGG - Intronic
1051034679 9:12729477-12729499 TCCTTATTTCTTCCTCCCTCCGG - Intergenic
1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG + Intronic
1055724174 9:79209990-79210012 TCCTCAGCTTATCCTCCCTGAGG + Intergenic
1055881044 9:81003697-81003719 TCATTTCCTCCTCCTCCCAGAGG - Intergenic
1056754637 9:89374035-89374057 TCCTAAGCTGGTGCTCCCTGGGG + Intronic
1056815071 9:89795191-89795213 TCCTCCTCTCCTCCTCCCTGTGG + Intergenic
1057205103 9:93167119-93167141 TCCTCAGCTGTTCCTGCCTGGGG - Intergenic
1057582442 9:96299434-96299456 GCCTTACCTTCCCCTCCCTGTGG + Intronic
1057802331 9:98198053-98198075 CCCTGAGCGTCTCCTCCCTGAGG + Intergenic
1057949653 9:99359581-99359603 TCCGTGGCTCCTCCTCCCACCGG - Intergenic
1058919205 9:109597269-109597291 TAATGAGCTCCCCCTCCCTGAGG + Intergenic
1061102154 9:128500235-128500257 TCCCGATCTCCTCCTGCCTGAGG + Exonic
1061297034 9:129682380-129682402 TCCTCAGCCCCTCCTCTCTTAGG - Intronic
1061889048 9:133608139-133608161 TCCTGAGCTCCTGCTTACTGGGG + Intergenic
1062039506 9:134397646-134397668 TCCTGAGCTCCTCCTCGCCTGGG + Intronic
1062439724 9:136564301-136564323 ACCTGGGCTGCTCCTCCCTGCGG - Intergenic
1185447890 X:268823-268845 TCCTTAGCTCCGCCTGGGTGGGG + Intergenic
1185448168 X:269758-269780 TCCTTAGCTCCGCCTGGGTGGGG + Intergenic
1186192303 X:7077448-7077470 TCCTTCCCTCCTCCTCCCCAGGG - Exonic
1186442103 X:9595197-9595219 TCCTTCCCTCTGCCTCCCTGAGG + Intronic
1187244327 X:17540227-17540249 TCCTCAGCAACTCCTCCCTAGGG - Intronic
1187478631 X:19634632-19634654 TCCTCTCCTCCTCCTCCTTGTGG - Intronic
1192732014 X:73809872-73809894 TCATTATATCCTCCTCCCTTTGG + Intergenic
1192894802 X:75430962-75430984 TCCTTAGCTTCTCTTAGCTGTGG - Intronic
1193803068 X:85960760-85960782 TCTTTAGCCCCTCATCACTGTGG - Intronic
1195377637 X:104243420-104243442 TCCTTATCATTTCCTCCCTGGGG - Intergenic
1195705308 X:107734063-107734085 TCCTTAGCTTCTCATCCCTGGGG - Intronic
1195707560 X:107749023-107749045 TCCTTTTCTCCTCTTCCCTCTGG - Intronic
1196002796 X:110804794-110804816 TCCCAACCTCCTGCTCCCTGTGG + Intergenic
1196020235 X:110983709-110983731 TCTTAAGCTTCTCCTCACTGAGG - Intronic
1197285683 X:124592793-124592815 TCCTTTTCTCCCCCTCCCTAGGG + Intronic
1198516454 X:137413331-137413353 ATATTAGCTACTCCTCCCTGTGG + Intergenic
1199184628 X:144900826-144900848 TACTTAACTCCTCCTCACAGAGG + Intergenic