ID: 1092184520

View in Genome Browser
Species Human (GRCh38)
Location 12:6469066-6469088
Sequence ATAACTCCTCAGAGAGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092184518_1092184520 18 Left 1092184518 12:6469025-6469047 CCTTGATTAAGTGAATTTCTTTT 0: 1
1: 0
2: 5
3: 54
4: 616
Right 1092184520 12:6469066-6469088 ATAACTCCTCAGAGAGGCTATGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092184520 Original CRISPR ATAACTCCTCAGAGAGGCTA TGG Intronic
901199293 1:7457663-7457685 AACATTCCTCAGAGAGGCTGGGG + Intronic
911825858 1:102484540-102484562 ACAACTCCACTGAGAGGCAAAGG - Intergenic
912112110 1:106356150-106356172 CTAACTTCTCAGCGAAGCTATGG + Intergenic
912492970 1:110072082-110072104 ATAAGTCTTCAGAGAAGTTATGG - Intronic
913086462 1:115441960-115441982 AAAACTTTTCAGAGAGGCTGTGG + Intergenic
916368047 1:164056138-164056160 ATTAAGGCTCAGAGAGGCTAAGG - Intergenic
919278959 1:195461642-195461664 AAAACTCCTCAGAAAGACTCTGG + Intergenic
920635731 1:207701362-207701384 AAAACTCATCAGAGAGCCTCAGG - Intronic
921494215 1:215817592-215817614 ATAACTGCTCAGAGATGCCACGG + Intronic
923056262 1:230427365-230427387 ATAAATCCTCAGAGATGTGAAGG + Intergenic
923075850 1:230608013-230608035 AGAAGTCATTAGAGAGGCTACGG - Intergenic
1063126334 10:3139604-3139626 AGAACTCATCAGAGTGGCAATGG + Intronic
1067694700 10:48526341-48526363 TTAACTCCTCAGAAAGACCAGGG + Intronic
1072004065 10:91225545-91225567 AGATCTCCTCAGAGATGCGATGG - Intronic
1073709022 10:106017834-106017856 AGAAGTCATTAGAGAGGCTATGG + Intergenic
1074819778 10:117169071-117169093 ATAACCCCTCAGAGAGTCGCCGG - Intergenic
1077511318 11:2965117-2965139 CTTTCTCCTCAGAGAGGCTGAGG - Intronic
1079681969 11:23308506-23308528 ATATCTCTTCAGAGAAGTTAAGG + Intergenic
1083454117 11:62766750-62766772 ATAACTCTTTAAAGAGGCTGTGG + Intergenic
1083980427 11:66163233-66163255 TTAGCTGCTCAGGGAGGCTAAGG + Intronic
1090182771 11:124715525-124715547 AAACCTCCTCAGAGAGGTTTAGG - Intergenic
1090974693 11:131671284-131671306 ATAGCGCCCCAGGGAGGCTAGGG - Intronic
1092184520 12:6469066-6469088 ATAACTCCTCAGAGAGGCTATGG + Intronic
1093951531 12:25168468-25168490 AGAAGTCATTAGAGAGGCTATGG - Intronic
1095806048 12:46322309-46322331 AGAAGTCATTAGAGAGGCTACGG + Intergenic
1097251936 12:57639318-57639340 CCAGCTACTCAGAGAGGCTAAGG + Intergenic
1100226228 12:92558924-92558946 AGAACTATACAGAGAGGCTAAGG + Intergenic
1101687808 12:107043271-107043293 ATGACTGCTCAGAGTGGCCAAGG - Intronic
1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG + Intergenic
1102383876 12:112490555-112490577 CTAACTACTCAGAGAGGCTGAGG - Intronic
1104539633 12:129651759-129651781 ATGACTCCTCAAAGATGCTCAGG - Intronic
1104687824 12:130800414-130800436 AAAACTCCTCTGGGAGGCTGAGG - Intronic
1106496082 13:30277103-30277125 ATAACTCTGCAGAGAGGATATGG - Intronic
1109065110 13:57677203-57677225 ATAAGTCCCAAGAGAGTCTAGGG - Intronic
1109935921 13:69284305-69284327 TTAACTCCTCAGAGAGAATATGG + Intergenic
1112691191 13:101896424-101896446 ATCACTCCTCAGCAAGCCTATGG + Intronic
1114646212 14:24257821-24257843 ATACCTCCTGAGAGAGAATAGGG + Intronic
1120293111 14:82602988-82603010 TTAACTACTGAGAGAGGATAAGG - Intergenic
1121192555 14:92043121-92043143 AGAAGTCATTAGAGAGGCTATGG + Exonic
1121389274 14:93560474-93560496 AGAAGTCATTAGAGAGGCTACGG + Intronic
1124001038 15:25760080-25760102 ATAGCTACTCAGGGAGGCTGAGG - Intronic
1126529713 15:49699523-49699545 AGAAGTCATTAGAGAGGCTATGG + Intergenic
1126985924 15:54307799-54307821 ATAGCTTCTCAAAGATGCTATGG - Intronic
1128084155 15:64874353-64874375 ATAACAGCTCAGAGCGGCCAGGG + Intronic
1129389908 15:75215289-75215311 ATGACTCCTCAGTGAGGCCTGGG + Intergenic
1133502505 16:6379235-6379257 AGAATTCATCAGAGAGGCAATGG + Intronic
1134804574 16:17113668-17113690 ATTACTGCACAGAGAGGCCAAGG + Intronic
1135768043 16:25194948-25194970 GGAGCTGCTCAGAGAGGCTAAGG - Intergenic
1136394330 16:29984807-29984829 ATACCTCCTCATAGGGGCTGTGG - Intronic
1137444555 16:48523826-48523848 AGAACTCTTCAGAGAGGCTTTGG + Intergenic
1138249541 16:55491394-55491416 TTACCTCTTCAGAGAGGCTGAGG + Intronic
1140035780 16:71370268-71370290 ACAACCCCTCACAGAGGCTGGGG + Intronic
1140477443 16:75245899-75245921 CTAGATGCTCAGAGAGGCTAAGG - Intronic
1140610654 16:76594675-76594697 CTAAGTCCTCTGACAGGCTAAGG + Intronic
1140991057 16:80211977-80211999 AAAATGCTTCAGAGAGGCTAGGG + Intergenic
1142234169 16:88913772-88913794 ATGACTCCTCAGAGAGGGCTGGG + Intronic
1146937437 17:36821016-36821038 ATAACACCCAGGAGAGGCTAGGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1152118250 17:78402020-78402042 ATGAGTCCACAGAGAGGCTCAGG + Intronic
1157365889 18:47064056-47064078 ACAGCTCCTCTGAGAAGCTAAGG + Intronic
1164543437 19:29139705-29139727 AAACCTCCTCACAGAGGCTGAGG + Intergenic
1165697804 19:37914174-37914196 ATGACTCCTCAAAGAGGCCTGGG - Intronic
926710075 2:15872219-15872241 ACTACTCCTCAGAAAGTCTATGG - Intergenic
927486860 2:23494610-23494632 AGAACTCTCCAGAGAGGCTTCGG - Intronic
928770381 2:34697489-34697511 AGAAGTCATTAGAGAGGCTACGG + Intergenic
928778749 2:34795018-34795040 AGAAATCATTAGAGAGGCTATGG - Intergenic
934509037 2:94922153-94922175 ATCACTTCTAAGAGAGACTATGG + Intergenic
934850855 2:97700222-97700244 GTAAGTCCTCAGAGGGGCTCAGG + Intergenic
936151198 2:110023290-110023312 ATATCTCCTCAGAGACCCTGAGG + Intergenic
936193477 2:110348079-110348101 ATATCTCCTCAGAGACCCTGAGG - Intergenic
939361007 2:141172815-141172837 GTAACTACTCACAGAGGATAAGG - Intronic
941157713 2:161999579-161999601 AAAGCTCCTCAGAGATGCTGTGG - Intronic
943865839 2:192923778-192923800 AGAAATCATTAGAGAGGCTACGG - Intergenic
944147258 2:196519116-196519138 ATACCTCCTCAGAGAGCTGAAGG - Intronic
945419588 2:209617823-209617845 ATAACTCTTCAGAGACACTTTGG + Intronic
947363969 2:229374983-229375005 AGAGCTCTTCAGAGAGGCAATGG + Intronic
947386302 2:229594053-229594075 ATCAGTCCTCAGAGAGGCAGAGG + Intronic
1168855686 20:1006072-1006094 ATTTCTCCTCAGAGATGCAAGGG + Intergenic
1172645367 20:36465811-36465833 ACAACTTCTCAAAGTGGCTAGGG - Intronic
1175968642 20:62672862-62672884 CTAAGTCCTCAGAGAGGCCCTGG - Intronic
1178809360 21:35867300-35867322 ATAACTCCTTAGTGAGGCAGGGG - Intronic
1180994962 22:19961008-19961030 AGAAGGCCTCAGAGAGGCCAAGG - Intronic
1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG + Intronic
1184658591 22:45954901-45954923 ATTAGAGCTCAGAGAGGCTAGGG + Intronic
951762071 3:26158704-26158726 AGAAGTCATTAGAGAGGCTACGG + Intergenic
958800226 3:98746279-98746301 ATAACTCCTTAGCTTGGCTATGG + Intronic
965298965 3:166986119-166986141 GTATCTCCTCAGGGAGGCCAAGG - Intergenic
965335836 3:167430123-167430145 AGAAGTCATTAGAGAGGCTACGG - Intergenic
967241913 3:187447853-187447875 ATCACTTTTCAGAGAGACTAGGG - Intergenic
967374053 3:188781302-188781324 ACCACTCTTCAGAGATGCTATGG + Intronic
969081749 4:4624509-4624531 AGAGCTCCTCACAGAGGCTGGGG - Intergenic
969577068 4:8042413-8042435 AGGACTCCCCAGAGAGGCCAAGG + Intronic
972089115 4:35257939-35257961 ATCACTCCTCCAAGAGTCTAAGG - Intergenic
972378656 4:38498391-38498413 ATTACCTCTCAGAGAGGTTAAGG + Intergenic
972676748 4:41267357-41267379 ACAGCTACTCTGAGAGGCTAAGG - Intronic
973283044 4:48381029-48381051 TTAACTCCTCAGTGAGACTGTGG + Intronic
973925906 4:55737058-55737080 ATGAGTCCTCAGAGTGGGTAAGG + Intergenic
976509396 4:85890773-85890795 ATTCATCCTCAGAGAGGATAAGG - Intronic
977042302 4:92030039-92030061 AGAAGTCATTAGAGAGGCTATGG - Intergenic
979688008 4:123531956-123531978 ACAAGTGCTCAGAGTGGCTATGG - Intergenic
981375048 4:144005545-144005567 ATAATTTCTCATAGCGGCTATGG - Intronic
984164905 4:176295252-176295274 AGAAGTCATTAGAGAGGCTACGG + Intergenic
984833859 4:184000714-184000736 ATAACACCTCTGGGAGGCGAGGG - Intronic
987433257 5:17862679-17862701 CTAACTCCACAGAAAGGATAGGG + Intergenic
988836364 5:35036546-35036568 ATAACTTTGCAGAAAGGCTAAGG + Intronic
991955156 5:71987104-71987126 ATAACACCTGTTAGAGGCTATGG + Intergenic
993102335 5:83556171-83556193 ATAACTTTTAAGAGAGGCAATGG + Intronic
998197048 5:140083077-140083099 ATAAATCCTCATAAATGCTAAGG + Intergenic
998474124 5:142406659-142406681 ATAACTACCCAGAGAGTGTAAGG + Intergenic
999155082 5:149452118-149452140 TTATCTCCTCTGAGAGGCTGGGG - Intergenic
1006325459 6:33350367-33350389 AGAAGTCATTAGAGAGGCTATGG - Intergenic
1007300233 6:40862447-40862469 AGAAGTCATTAGAGAGGCTACGG + Intergenic
1007502935 6:42312550-42312572 ATAACCACTCTGAGAGGCCAAGG - Intronic
1008849769 6:56011203-56011225 AGAAGTCATTAGAGAGGCTACGG + Intergenic
1011552768 6:88545020-88545042 AAAACTCCTAAGGGAGGATAAGG + Intergenic
1014576278 6:123077719-123077741 ATACACCCTCAGAGAGGCTGTGG + Intergenic
1019036429 6:169063389-169063411 ATAACTTCACAGAAAGGGTAGGG - Intergenic
1019320340 7:412318-412340 AGAACTCCTCAGAGAGTCTTTGG + Intergenic
1023022986 7:36027694-36027716 AGAACTCCTCAGACAGAGTAGGG - Intergenic
1030194255 7:106837435-106837457 AGAAGTCATTAGAGAGGCTACGG - Intergenic
1030365271 7:108638767-108638789 CTGACTCCTCAGAGAGTCTAAGG - Intergenic
1030701544 7:112646779-112646801 ATAACTCCAGCCAGAGGCTAGGG - Intergenic
1031937151 7:127747352-127747374 ATGATTCCTCAGAGAGACAAGGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1034084371 7:148310442-148310464 AGAAGTCATTAGAGAGGCTACGG + Intronic
1035143616 7:156789680-156789702 AGAGCTCACCAGAGAGGCTAGGG - Intronic
1037167931 8:15853655-15853677 TGAACTCCTCAGAGAGTCAAAGG - Intergenic
1048167373 8:132075453-132075475 AGAACTCCTGACAGAGGCTGAGG - Intronic
1049911550 9:273616-273638 ATCACTCCTAAGAGACGTTAAGG + Intronic
1050259888 9:3829758-3829780 AGGACTCTTCAGAGAGTCTAGGG - Intronic
1050735821 9:8761901-8761923 ATAGCTCACCAGAGAAGCTAGGG - Intronic
1053022008 9:34701534-34701556 CGAGCTCCTCAGAGAGGCTGCGG + Intergenic
1053424294 9:38000906-38000928 ATGAGGTCTCAGAGAGGCTAAGG - Intronic
1053436127 9:38075631-38075653 GGCACTCCTCAGGGAGGCTAGGG - Intergenic
1055965328 9:81860256-81860278 ATAGCACCTCAGAGAGCATATGG - Intergenic
1058426335 9:104878130-104878152 ATAAATCCTCAGAAACCCTAGGG - Intronic
1058847181 9:108972424-108972446 CTAACTTCTCTGAGAGGATAAGG + Intronic
1060448176 9:123711348-123711370 ACAGCTACTCAGAGAGGCTGAGG + Intronic
1062152430 9:135028482-135028504 AGAATGCCTCAGAGAGGCTTGGG + Intergenic
1062288903 9:135785894-135785916 ATAAGGGCTCAGAGAGGCGAAGG + Intronic
1188772548 X:34171442-34171464 AAAGATCCTCAGAGATGCTATGG - Intergenic
1191221445 X:57991670-57991692 ATAACTCCTCTGGGTGGCCAAGG + Intergenic
1195244997 X:102987505-102987527 AGAACTCCACTGAGTGGCTAAGG + Intergenic
1196226770 X:113177202-113177224 AGAAGTCATTAGAGAGGCTACGG + Intergenic
1197942222 X:131802468-131802490 AGGACTCCTCAAAGAAGCTATGG - Intergenic
1200007271 X:153095644-153095666 AGAAGTCATTAGAGAGGCTATGG + Intergenic
1201142736 Y:11042008-11042030 AAAACCCCTCAGAGAAGCTTGGG + Intergenic
1201233591 Y:11889468-11889490 AGAAGTCATTAGAGAGGCTATGG + Intergenic
1202347571 Y:23949472-23949494 CTAACTACTTATAGAGGCTATGG + Intergenic
1202523201 Y:25720619-25720641 CTAACTACTTATAGAGGCTATGG - Intergenic