ID: 1092185518

View in Genome Browser
Species Human (GRCh38)
Location 12:6475730-6475752
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092185505_1092185518 24 Left 1092185505 12:6475683-6475705 CCTCACTTCTCAGACAGGGTGGC 0: 17
1: 445
2: 4055
3: 4443
4: 5423
Right 1092185518 12:6475730-6475752 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1092185512_1092185518 -1 Left 1092185512 12:6475708-6475730 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1092185518 12:6475730-6475752 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092185518 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intergenic
Too many off-targets to display for this crispr