ID: 1092187673

View in Genome Browser
Species Human (GRCh38)
Location 12:6493245-6493267
Sequence CGCCCACAGCTGCCTGGGTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092187673_1092187685 28 Left 1092187673 12:6493245-6493267 CCTTACCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1092187685 12:6493296-6493318 AGCCACGAGCCCCGCCCCCCGGG 0: 1
1: 0
2: 3
3: 42
4: 400
1092187673_1092187684 27 Left 1092187673 12:6493245-6493267 CCTTACCCAGGCAGCTGTGGGCG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1092187684 12:6493295-6493317 CAGCCACGAGCCCCGCCCCCCGG 0: 1
1: 1
2: 7
3: 38
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092187673 Original CRISPR CGCCCACAGCTGCCTGGGTA AGG (reversed) Exonic
900029277 1:359204-359226 CCACCACTGCTGCCTGGGCACGG - Intergenic
900049879 1:587976-587998 CCACCACTGCTGCCTGGGCACGG - Intergenic
901080096 1:6579287-6579309 TGCCTGCAGCTACCTGGGTAAGG + Exonic
901473369 1:9472918-9472940 CTGCCACAGCTGCCTGGCCAGGG - Intergenic
901633460 1:10658955-10658977 CGGCCCCTGCTGCCTGGGGAAGG - Intronic
902415787 1:16238164-16238186 AACCCACAGCTGGCTGGGTGTGG + Intergenic
903123608 1:21233065-21233087 AGCCCACAGAGGCCTGGGGAAGG - Intronic
903282500 1:22257887-22257909 CACTCACAGCTCCCTGGGCATGG + Intergenic
904081743 1:27876712-27876734 CGCCCCCAACTTCCAGGGTAAGG + Exonic
906560578 1:46753942-46753964 AGCCCAGATCTGCCTGGGCAGGG + Intergenic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
922718641 1:227889307-227889329 CCCCCAGAGCTACCTGGGAAGGG - Intergenic
1069974634 10:72202994-72203016 CGCCCATAGCTGGCCGGGCACGG + Intronic
1073461355 10:103667618-103667640 CGCCCACAGCTGCAGCAGTAGGG + Intronic
1075234424 10:120713680-120713702 GGCACACAGCTGCCTGGGAAGGG + Intergenic
1076505613 10:130970920-130970942 AGCCCACAGGTTCCTGTGTAGGG - Intergenic
1077333600 11:1993961-1993983 GGCCCACAGCTGGATGGGGAGGG + Intergenic
1078256574 11:9663994-9664016 CGCCCACAGCCGCCAGAGTGTGG - Intergenic
1084083186 11:66842691-66842713 CGCCCACAGCTGCAGGGTTTTGG + Intronic
1084477880 11:69399066-69399088 TGCCCACAGCAGGCTGGGCACGG + Intergenic
1084536126 11:69758310-69758332 GACCCTCAGCTGCCTGGGGAAGG - Intergenic
1090266903 11:125359057-125359079 CTCCCACAGCTGCCTCAGCAGGG - Intronic
1090305768 11:125689682-125689704 CGCTCATGCCTGCCTGGGTATGG - Intergenic
1202816580 11_KI270721v1_random:49143-49165 GGCCCACAGCTGGATGGGGAGGG + Intergenic
1092187673 12:6493245-6493267 CGCCCACAGCTGCCTGGGTAAGG - Exonic
1098819035 12:75207291-75207313 CGTCCAGAGCCGCCAGGGTAAGG - Exonic
1101345135 12:103879477-103879499 CGCCCACGGCTGTTTGGATAAGG + Intergenic
1101775443 12:107789145-107789167 CTCCCTCAGATGCCTGGCTAAGG + Intergenic
1103918793 12:124389022-124389044 CGCCCACAGCGGCTTGGGGACGG - Intronic
1104209245 12:126671272-126671294 CACCTACAGCTGCATGGGTGTGG + Intergenic
1104653849 12:130558389-130558411 CACACACAGCTGCCGGGGTGGGG + Intronic
1104898005 12:132173661-132173683 CCCGCACACCTGCCTGGGTCCGG - Intergenic
1104965225 12:132505916-132505938 CTCCCAGAGCTTCCTGGGAATGG + Intronic
1104965373 12:132506690-132506712 CGTCCACAGCTGCCTGGGATGGG + Intronic
1113808302 13:113122650-113122672 CGCCCAGCTCTGCCTGGGGAAGG + Intergenic
1113898036 13:113778001-113778023 AGCCCACAGCTGCCTGTGCCAGG + Intronic
1114645783 14:24255331-24255353 GGCCCAGAGCTGGCTGGGTTGGG + Intronic
1115307106 14:31944599-31944621 CACCCACCTCTGCCTGGGTGTGG + Intergenic
1117327766 14:54684714-54684736 TGCCCACAGCTGTCTGGGGATGG + Intronic
1117910877 14:60637534-60637556 CGTCCACAGCTGCAGGGGTCCGG - Intergenic
1120033595 14:79670306-79670328 CTCCAACAGCTGCTTGGATAGGG - Intronic
1121050683 14:90817006-90817028 CGTCCACCTCTGGCTGGGTAGGG - Intergenic
1122519609 14:102334119-102334141 CCTCCACAGCTGCCTGGAGAAGG + Intronic
1122605500 14:102945064-102945086 CCCACAGAGCTGCCAGGGTACGG + Intronic
1123031850 14:105455719-105455741 AGCCCACAGCTGCCTGGAGGAGG - Intronic
1124792083 15:32737634-32737656 AACCCACAGCTGGCCGGGTATGG + Exonic
1125089058 15:35769637-35769659 AGCCCACAGCTGCATACGTAAGG - Intergenic
1127260023 15:57320609-57320631 CCCCCAGAGCAGCCTGGGGAGGG + Intergenic
1128106845 15:65051537-65051559 CCACCACAGCTGCCAGGGCAAGG - Exonic
1128382349 15:67122341-67122363 CACCCACAGCTGACAGGGTCTGG - Intronic
1131182440 15:90249750-90249772 CGCCCCTAGCCGCCTGGGGATGG - Exonic
1132046092 15:98563879-98563901 CTCCCAGAGCTGCCTGAGAATGG + Intergenic
1132702558 16:1228385-1228407 CACCACCAGCTGCCTGGGCAGGG + Exonic
1132709200 16:1258934-1258956 CACCACCAGCTGCCTGGGCAGGG - Exonic
1135031106 16:19039376-19039398 CCACCACACCTGGCTGGGTATGG + Intronic
1135918365 16:26626025-26626047 CATCCAAGGCTGCCTGGGTAGGG + Intergenic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1137031189 16:35526226-35526248 CGCTGGCAGCGGCCTGGGTATGG + Intergenic
1137773192 16:51034640-51034662 CGCTCTCAGCTGCCTGTGTGTGG - Intergenic
1139630388 16:68228310-68228332 CGCCCACAGCTTCCTTTGGAGGG + Exonic
1139701016 16:68707940-68707962 AGCCCACAGCTGACAGGGCAGGG + Intronic
1139846475 16:69924916-69924938 CGCCCAGAGCTTCCTGGCTGGGG - Intronic
1140032298 16:71348474-71348496 CACCCACAGCAGCCGGGGAATGG + Intergenic
1141170607 16:81688346-81688368 AGCCAACGCCTGCCTGGGTAAGG - Intronic
1142759893 17:2036075-2036097 CGGCCACAGTTGCCTGAGTATGG + Exonic
1142801884 17:2351467-2351489 CACACTCAGCTGGCTGGGTAAGG - Intronic
1143174762 17:4949592-4949614 CGCTCACAGCCACCTGGGGAGGG + Intronic
1143707111 17:8706199-8706221 GGCCCAGAGCTACCTGGGGAGGG + Intergenic
1144639037 17:16927518-16927540 GTCCCACAGCAGCCTGGGTCTGG - Intergenic
1144729653 17:17519162-17519184 CGCCCACACCTGCCAGTGTGAGG - Intronic
1146283447 17:31559501-31559523 CCCGCACCGCTGCCTGGGCACGG - Intergenic
1147732197 17:42610613-42610635 GGCCCACAACTCGCTGGGTAGGG + Intronic
1148019136 17:44542063-44542085 AGCCCACAGCGGGCTGGGGAAGG - Intergenic
1148149018 17:45385198-45385220 AGCCCACAGCATGCTGGGTAAGG + Intergenic
1148335912 17:46841435-46841457 CGCCCAGAGGTGCCTGGGACAGG - Intronic
1150823938 17:68457740-68457762 CGCCCACAGCTGCCACGGATTGG - Intergenic
1150974977 17:70075169-70075191 CTGCCACAGCTGACTGGCTATGG + Intronic
1152316389 17:79583105-79583127 CGCCCAGTGCTGACTTGGTACGG - Intergenic
1152950481 17:83227352-83227374 CCACCACTGCTGCCTGGGCACGG + Intergenic
1153514130 18:5889777-5889799 TGCCCACAGCTGCTTGCGAATGG - Exonic
1153823921 18:8857073-8857095 CGCTCACAGCCGCGGGGGTAGGG - Intergenic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1158649797 18:59274339-59274361 GGCCCAGAGCTGGCTGGGGAAGG + Intergenic
1160751161 19:735318-735340 GGCCCACAGGTGCCTGTGTCCGG + Intronic
1160941367 19:1621832-1621854 GGCCGACAGCCTCCTGGGTATGG - Exonic
1162156804 19:8684041-8684063 CGCCTGGACCTGCCTGGGTAGGG + Intergenic
1162439814 19:10686133-10686155 GGCCCACCGCCTCCTGGGTAGGG - Intronic
1165165264 19:33849555-33849577 GCCCCACAGCTGCCTGCCTATGG + Intergenic
1166329648 19:42070438-42070460 TGCCCAGGGCTGCCTGGGCAGGG - Exonic
1167638319 19:50667592-50667614 CGCCCACCGCTCCCGGGGTGGGG - Exonic
1167657955 19:50778625-50778647 GTCACACAGCTGGCTGGGTACGG + Intergenic
925164958 2:1710342-1710364 AGCCCCCAGCGGCCTGGGTCTGG - Intronic
930158504 2:48129396-48129418 CTCCAACAGCTGGTTGGGTAGGG - Intergenic
937268731 2:120633590-120633612 CTCCCAAAGCTGCCAGGGTTTGG + Intergenic
939267717 2:139895097-139895119 CCCCCACAGATACCAGGGTATGG + Intergenic
941573104 2:167196025-167196047 CACACACAGCAGCCTGGGAATGG - Intronic
941619356 2:167758829-167758851 GGACCACAGCTGACTGGGTCAGG - Intergenic
941922944 2:170870180-170870202 CGCTCACAGCTTACTGGGTGGGG + Intergenic
947749905 2:232526519-232526541 AGCCCCCAGCTGCCTGGGGAGGG - Exonic
948335220 2:237202118-237202140 CACCCACAGCTTCTTGGTTATGG - Intergenic
948397869 2:237661073-237661095 CTCCCACCGCTTCCTGGGTTGGG + Intronic
948600164 2:239103338-239103360 GGGCCACAGCTGCCAGGGTCTGG + Intronic
948909204 2:240994559-240994581 GGCCCTCAGGTGCCTGGGTCCGG + Intergenic
1169190667 20:3657399-3657421 CCCCCACACCTGCGTGGGAATGG - Intergenic
1170159721 20:13298938-13298960 CGCTCACAGCTGTCTGTGTCTGG - Exonic
1172245697 20:33443734-33443756 CTCCCCCAGCGGCCGGGGTAGGG - Exonic
1172966609 20:38840066-38840088 GGTCCACAGTTGCCTGGGTTTGG + Intronic
1174111679 20:48201818-48201840 AGCCCAGAGCTGCCTGGGCAGGG - Intergenic
1174169461 20:48607014-48607036 AGCCCAGAGCTGCCTGGGCAGGG + Intergenic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175928594 20:62482677-62482699 CTCCCCCAGCTGCCTGGGCCAGG - Intergenic
1175931380 20:62495472-62495494 CGCCCACAGCCTCCTGAGGACGG - Intergenic
1177211444 21:18076867-18076889 AGACCACAGCTCCCTGGGGATGG - Intronic
1179783689 21:43718425-43718447 CATCCACAGGTGCCTGGGTCTGG - Intergenic
1181335456 22:22125035-22125057 TGCCCACAGCTGGCGGGGTTTGG + Intergenic
1183364100 22:37398164-37398186 CGCCCACAGCTGCCTGGCTCTGG - Intronic
1184300097 22:43553684-43553706 CTCCCACAGCTGCCATGGCAAGG + Intronic
1185384150 22:50524111-50524133 GGCCCACAGCTGCCTGGCGCAGG + Exonic
949548899 3:5096229-5096251 CGCCCCCCGCTGCCTAGGGAAGG - Intergenic
950260992 3:11543421-11543443 AGCCCTCAGCTGCCTGTGTCTGG + Intronic
950524695 3:13517042-13517064 CGCACACAGCTGCCTGGTGTGGG + Intergenic
951841076 3:27034934-27034956 AGCCCACCCCTGCTTGGGTATGG - Intergenic
952916908 3:38253268-38253290 CCCCCACACCTGCCAGGATATGG + Exonic
953885412 3:46712184-46712206 CACCCACAGCAACCTGGGCACGG + Exonic
960281312 3:115784253-115784275 CGCCTGCAGCTGCCTGGGGAAGG + Intergenic
968037086 3:195556552-195556574 CGCCCCCAGCTGCCTGCTGATGG - Intergenic
969700074 4:8763046-8763068 TGCCCACAGCGGCCTTGGCAGGG + Intergenic
969871222 4:10106422-10106444 CACTCACAGCTGACTGGGGATGG + Intronic
975527297 4:75364572-75364594 CTCCAACAGCTGCCTGGAGAAGG - Intergenic
975848909 4:78551895-78551917 CGCCCACAGCCGCCTGCTGACGG + Intronic
976736264 4:88313269-88313291 AGCCCACAGCTGGCGGGGCAGGG + Intergenic
977584002 4:98755215-98755237 CACACACAGCAGCCTGGGGAAGG - Intergenic
977666509 4:99651229-99651251 TGCAGACAGCTGCCTGGGTTTGG + Exonic
985025291 4:185734054-185734076 CGCCCGCCACTGCCTGGGTTTGG - Intronic
985581201 5:696080-696102 CGCCCACCCCTGCCTGGGTTTGG + Intergenic
985595826 5:787412-787434 CGCCCACCCCTGCCTGGGTTTGG + Intergenic
985614431 5:910965-910987 CTACCACTGCTGCCTGGGGAAGG - Intronic
985692918 5:1323440-1323462 CGGCCTCTGCTGCCTGGGTGGGG - Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
991638055 5:68725987-68726009 CCCCCACAGCTGACTGGATATGG + Intergenic
994603987 5:101943324-101943346 CTCCAAAAGATGCCTGGGTATGG - Intergenic
995183918 5:109252533-109252555 CAGCCACAGGTGCCTGGGTGAGG - Intergenic
996748834 5:126869060-126869082 CTCCCAGCGCTGCCTGGGGAGGG - Exonic
999309794 5:150544767-150544789 CACCCACAGCAGGCTGGGGAGGG + Intronic
999315734 5:150582698-150582720 GGCACACAGCTGCCTAGGAAAGG + Intergenic
1000312146 5:160055388-160055410 GGGCTAAAGCTGCCTGGGTAGGG - Intronic
1002744713 5:181461167-181461189 CCACCACTGCTGCCTGGGCACGG + Intergenic
1002813351 6:656296-656318 CACCCACAGCCGACTGGGGAGGG + Exonic
1006618566 6:35346361-35346383 AGCCCACAGAGACCTGGGTAGGG - Intronic
1007274594 6:40663940-40663962 GGCCCACCCCTGCCTGGGTGTGG + Intergenic
1007631777 6:43276833-43276855 CTCACCCAGCTGCCTGGCTAAGG - Intronic
1015553482 6:134436663-134436685 CGTTCACAGTTGCCTGGGCAAGG - Intergenic
1015603890 6:134936454-134936476 CTCCCACAGTTTCCTGGGTAGGG + Intronic
1016316053 6:142788420-142788442 AGCACAGAGCTGGCTGGGTATGG + Intronic
1017415299 6:154213973-154213995 AGCCCACAGCTGCCGGAGTGTGG + Intronic
1018641445 6:165907788-165907810 CGCCCAGAGCAGCATGGGTGAGG + Intronic
1019249624 6:170734708-170734730 CCACCACTGCTGCCTGGGCACGG + Intergenic
1019754647 7:2760165-2760187 CGCCCGCCTCTGCCTGGGGAAGG + Intronic
1019773137 7:2896289-2896311 CACAGGCAGCTGCCTGGGTAGGG + Intergenic
1020461548 7:8434317-8434339 TTCCCACAGCTGCCTGAGGATGG - Exonic
1035233885 7:157484111-157484133 CCCTCAGAGCTGCCTGGGTGGGG - Intergenic
1035498472 8:72948-72970 CCACCACTGCTGCCTGGGCACGG - Intronic
1035649016 8:1250351-1250373 CTGCCACAGCTGCATGGGTCAGG + Intergenic
1037490560 8:19393472-19393494 CGCCTACAGCTTCCTGGGCGTGG + Exonic
1039895533 8:41714150-41714172 CGCACAGCCCTGCCTGGGTAAGG - Exonic
1043914754 8:85908761-85908783 AGCCCACAGCTTCCCAGGTAAGG - Intergenic
1048415864 8:134227103-134227125 CACCCAGAGCTGCCTGGCTTGGG - Intergenic
1048495115 8:134928732-134928754 CACCCACTGCTGGCTGGGAAAGG + Intergenic
1052986496 9:34491739-34491761 GGCCCACAGCTCACTGGATAGGG - Intronic
1054823575 9:69548219-69548241 AGCCCACAGCTGCATGGAAATGG + Intronic
1057210194 9:93196962-93196984 GGCCCACAGATGCCTGGGTGTGG - Intronic
1060219447 9:121756654-121756676 TGCAGACAGCTGCCTGGGTCAGG + Intronic
1060599437 9:124868519-124868541 CGCCCCCAACTGCCTGGCCAAGG + Exonic
1061574515 9:131497665-131497687 ACCCCAGAGCTGCCTGGGAAAGG + Exonic
1061651025 9:132050126-132050148 CGGCCACAGCTGGGTGGGTGTGG + Intronic
1062442878 9:136579001-136579023 CGCCCACCCCAGCCTGGGGAGGG + Intergenic
1062552900 9:137098245-137098267 CCCCCAGAGCTGCCTGGGACTGG - Intronic
1203610524 Un_KI270748v1:91646-91668 CCACCACTGCTGCCTGGGCACGG + Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1189317908 X:40068879-40068901 CGGCCTCAGCTGCCTGCGTGTGG - Intronic
1190172098 X:48119828-48119850 AGCCCACAGCATCCAGGGTAGGG - Intergenic
1190177749 X:48165500-48165522 AACCCACAGCATCCTGGGTAGGG - Intergenic
1190180427 X:48187107-48187129 AACCCACAGCATCCTGGGTAGGG + Intronic
1190196857 X:48327205-48327227 AACCCACAGCATCCTGGGTAGGG - Intergenic
1190199401 X:48347286-48347308 ACCCCACAGCATCCTGGGTAGGG + Intronic
1190204553 X:48392483-48392505 AACCCACAGCATCCTGGGTAGGG - Intronic
1190205983 X:48402920-48402942 AACCCACAGCATCCTGGGTAGGG + Intronic
1190210390 X:48442114-48442136 AGCCCACAGCATCCTGGGTAGGG - Intergenic
1190297125 X:49034238-49034260 TGCCCCCAGCTGCCTGTGTCAGG - Exonic
1190654952 X:52603409-52603431 AGCCCACAGCATCCTGGGTAGGG - Intergenic
1190659942 X:52644920-52644942 AACCCACAGCATCCTGGGTAGGG + Intronic
1190663594 X:52677567-52677589 AACCCACAGCATCCTGGGTAGGG - Intronic
1190666168 X:52697768-52697790 ACCCCACAGCATCCTGGGTAGGG + Intronic
1190673250 X:52760642-52760664 ACCCCACAGCATCCTGGGTAGGG - Intronic
1190675829 X:52780855-52780877 AACCCACAGCATCCTGGGTAGGG + Intronic
1196900063 X:120374109-120374131 CCCGCACAGCTGGCTGGGTGTGG - Intronic
1200062965 X:153491769-153491791 CCCCCTCAGCTGCGTGGGGAGGG - Intronic
1200077147 X:153556834-153556856 CCCCCATAGCTCCCTGGGCAGGG + Intronic