ID: 1092187831

View in Genome Browser
Species Human (GRCh38)
Location 12:6493941-6493963
Sequence GTTCAAATCTCAACGGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092187831_1092187834 -10 Left 1092187831 12:6493941-6493963 CCTGCAGCCGTTGAGATTTGAAC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1092187834 12:6493954-6493976 AGATTTGAACTCGGTATTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 121
1092187831_1092187837 19 Left 1092187831 12:6493941-6493963 CCTGCAGCCGTTGAGATTTGAAC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 21
1092187831_1092187838 22 Left 1092187831 12:6493941-6493963 CCTGCAGCCGTTGAGATTTGAAC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1092187838 12:6493986-6494008 CGCGTTGCCAGACTCAGAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092187831 Original CRISPR GTTCAAATCTCAACGGCTGC AGG (reversed) Exonic
908701367 1:66905641-66905663 GTTCAAATCTCAACCATTGTAGG - Intronic
911742206 1:101399159-101399181 GCACAAATCACAAAGGCTGCAGG + Intergenic
919748411 1:201022607-201022629 GTTCCATTCTCAACAGCTCCGGG - Intronic
922721661 1:227903011-227903033 GCTCGAATTTCAAGGGCTGCGGG - Intergenic
1071476117 10:86026514-86026536 GTTGAAATCTCCACTGGTGCTGG + Intronic
1092187831 12:6493941-6493963 GTTCAAATCTCAACGGCTGCAGG - Exonic
1093814852 12:23533365-23533387 AGTCAAATCTCACCAGCTGCTGG + Exonic
1113066814 13:106381200-106381222 GTCCAAATCTGAAGGGCAGCCGG + Intergenic
1122874177 14:104655757-104655779 GTGCAAACCTCAACGAGTGCTGG + Intergenic
1129815282 15:78547064-78547086 GTTAAAATCTTAACAGTTGCTGG - Intronic
1130635853 15:85619253-85619275 TTTCAAACCTCCAAGGCTGCGGG + Intronic
1134359649 16:13519390-13519412 GTTCACAGCTCAACGGGTGATGG + Intergenic
1134536627 16:15031602-15031624 GTTTAAATCTCCATGGCTCCCGG + Intronic
1149464734 17:56868292-56868314 GTTCAGATCTGAAAGACTGCTGG - Exonic
1149825435 17:59823912-59823934 TTTTAAATTTCAACTGCTGCTGG - Intronic
1156576616 18:38324251-38324273 GTTCCAATCTGAAAGACTGCAGG - Intergenic
1161847966 19:6723129-6723151 GTTAAAATGACACCGGCTGCCGG - Intronic
929300700 2:40300752-40300774 ATTAATTTCTCAACGGCTGCTGG - Intronic
936679581 2:114754609-114754631 CTTCAAATCTCAAAGGGTGGAGG + Intronic
938761920 2:134433883-134433905 GTTCAAATATAAATGTCTGCAGG - Intronic
953010445 3:39020475-39020497 TTTCAAATCTCAAACACTGCTGG - Intergenic
954364028 3:50136942-50136964 GCTCAAATCTCACTGGCAGCAGG + Intergenic
955946311 3:64197909-64197931 GTTAAAATTTCAAGGGCTGATGG + Intronic
958561326 3:95751037-95751059 GTTCAAATCTCACAGTATGCAGG + Intergenic
962775501 3:138655575-138655597 GTGCAAATATCAAAGTCTGCAGG + Intronic
966426129 3:179781626-179781648 TTTCAAATCTAAACAGTTGCTGG + Intronic
977440321 4:97058083-97058105 ATACAAATCTCAACGACTGTTGG - Intergenic
987011756 5:13773579-13773601 GTTCAAATTTCAGCAGCTACTGG - Intronic
990995418 5:61728176-61728198 GTTCAAATTTCAACTCCTGGAGG + Intronic
998007758 5:138668385-138668407 GTTCAAATCTCACCTGGTCCTGG + Intronic
999276368 5:150333164-150333186 GTTCTAATCCCACCTGCTGCTGG + Intronic
1004566433 6:16802330-16802352 GTTCAACACTCAACAGTTGCTGG - Intergenic
1004667683 6:17763541-17763563 GTCCAAACTTCAACTGCTGCTGG + Intronic
1004927306 6:20428149-20428171 TTTAAAATCTCACCAGCTGCGGG + Intronic
1010756939 6:79676480-79676502 GGTCAAAACTCAATGTCTGCAGG - Intronic
1014879639 6:126707547-126707569 GTTCAAATCTCAAAAGCCACAGG - Intergenic
1015215532 6:130745848-130745870 GTTCAAATCCCAAATGCTCCTGG + Intergenic
1016917891 6:149262234-149262256 ATACAAATCTCAAATGCTGCCGG + Intronic
1023356325 7:39370795-39370817 GTTCAAAGGTCATCTGCTGCAGG - Intronic
1027652046 7:80880157-80880179 GCTCAAATCTCAACATCTCCAGG + Intronic
1029036920 7:97532248-97532270 GTTCAAATCTCAATGCCTCTGGG - Intergenic
1034747296 7:153534432-153534454 GTTCTAATCTGAAAGCCTGCAGG + Intergenic
1040699269 8:50041271-50041293 GTTCAAATGTCAATTGCTGTTGG + Intronic
1044868130 8:96592310-96592332 GTTCCAATCACAGCGACTGCTGG + Intronic
1046111665 8:109733094-109733116 ATTCAAATCTCAAAGTCTTCAGG - Intergenic
1048549701 8:135422745-135422767 ATTCACATCTCAAGGGCTACAGG - Intergenic
1192438554 X:71157656-71157678 GTTCCAATCTCAGAGGCTCCGGG + Intronic
1201888781 Y:18918759-18918781 GTTGAATTCTCTACGGGTGCAGG - Intergenic