ID: 1092187833

View in Genome Browser
Species Human (GRCh38)
Location 12:6493948-6493970
Sequence ATACCGAGTTCAAATCTCAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092187833_1092187838 15 Left 1092187833 12:6493948-6493970 CCGTTGAGATTTGAACTCGGTAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1092187838 12:6493986-6494008 CGCGTTGCCAGACTCAGAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 66
1092187833_1092187837 12 Left 1092187833 12:6493948-6493970 CCGTTGAGATTTGAACTCGGTAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092187833 Original CRISPR ATACCGAGTTCAAATCTCAA CGG (reversed) Exonic
907942335 1:59100748-59100770 AAAGAGATTTCAAATCTCAAGGG + Intergenic
908144198 1:61220221-61220243 ATGCAGAGTTAAAATCTCATGGG - Intronic
909406370 1:75294486-75294508 ATACTGAGTTCAAATCTTTTGGG - Intronic
912965380 1:114232281-114232303 ATAACAAATTCAAATCTTAATGG + Intergenic
917379891 1:174394124-174394146 ATACCGAATTCTTATCACAAAGG + Exonic
923656770 1:235923795-235923817 GTTCAGACTTCAAATCTCAAGGG + Intergenic
1070408738 10:76119925-76119947 TTACCTAGTTCAAGTCTGAAGGG + Intronic
1071406213 10:85335208-85335230 ATACAAAATTCAAATCTAAATGG + Intergenic
1071811129 10:89182398-89182420 AGACCAAGTTCTACTCTCAAAGG + Intergenic
1079181273 11:18195710-18195732 ATACTGAGTTCTCATATCAAAGG + Intronic
1085863828 11:80264458-80264480 TTACGGAGTTTACATCTCAATGG - Intergenic
1086620400 11:88881595-88881617 AAACCGAGTTCAAGTATAAATGG + Intronic
1088393281 11:109339677-109339699 ATACCGTGTTAAAAAATCAAAGG + Intergenic
1092187833 12:6493948-6493970 ATACCGAGTTCAAATCTCAACGG - Exonic
1099060869 12:77906619-77906641 AATCTGAGTTCAAATCTCAGTGG + Intronic
1102772054 12:115486517-115486539 ATCCTGAGTCCACATCTCAATGG - Intergenic
1105888180 13:24660543-24660565 ATACAAAGTTCAAATCTCAGTGG + Intergenic
1109362381 13:61312145-61312167 ATACAAAATTCAAATCTAAATGG - Intergenic
1114220410 14:20691316-20691338 ATACTGACTTCTAATGTCAAAGG - Intronic
1114331732 14:21643982-21644004 ATACTGAGTTCCAGTCTCAGAGG - Intergenic
1114836772 14:26211899-26211921 ATACCCAGACCTAATCTCAAAGG + Intergenic
1116589565 14:46754001-46754023 ATACCAAGTCCAAATCACAAGGG + Intergenic
1117338196 14:54772774-54772796 ATTCCGACTTCAGAACTCAAAGG + Intronic
1130681907 15:86004313-86004335 GTGCCGAGTTGAAATCTGAAGGG - Intergenic
1136691445 16:32033995-32034017 ATACCAAGTTCACCTCTGAAAGG - Intergenic
1136792033 16:32977560-32977582 ATACCAAGTTCACCTCTGAAAGG - Intergenic
1136877784 16:33876348-33876370 ATACCAAGTTCACCTCTGAAAGG + Intergenic
1137408394 16:48207810-48207832 ATGGGGGGTTCAAATCTCAAGGG + Intronic
1140532568 16:75679408-75679430 ATACAGATGTCAAATTTCAAAGG - Intronic
1203094243 16_KI270728v1_random:1239024-1239046 ATACCAAGTTCACCTCTGAAAGG - Intergenic
1146403514 17:32518845-32518867 ATAACGACTTCAACTCTCAGAGG + Intronic
1149016264 17:51912155-51912177 ACACCGACTTCAAATCACAAGGG + Intronic
1155582949 18:27332063-27332085 ATAGCAAGTTAAAATGTCAATGG - Intergenic
1157206881 18:45708195-45708217 ATACCCAGTTCAAATGTCACTGG + Intergenic
1164265209 19:23609740-23609762 AAACCTCATTCAAATCTCAAAGG - Intronic
1168261535 19:55197783-55197805 ATACAGAGATCAGATCTCGAGGG - Intronic
1168667373 19:58214680-58214702 TTACCAGGTTCTAATCTCAAGGG - Intergenic
927371916 2:22366005-22366027 ACAGTGTGTTCAAATCTCAATGG + Intergenic
929213186 2:39382108-39382130 AAAACTAGTTCAAATCTGAATGG - Intronic
931829105 2:66032241-66032263 ATACCTTTGTCAAATCTCAAAGG - Intergenic
937830865 2:126421564-126421586 ATACTGATTTCAAATCTCTAGGG + Intergenic
938896961 2:135761588-135761610 TTACCGAGTTAAAATCACCAAGG - Intronic
942749687 2:179273895-179273917 AGACTCAGTTCAAATGTCAAAGG - Intergenic
944279121 2:197874130-197874152 ATGACGGATTCAAATCTCAATGG + Intronic
945248780 2:207745468-207745490 TAACAGGGTTCAAATCTCAATGG - Intronic
948183702 2:236002611-236002633 ATGCAGAGTTCCACTCTCAAAGG - Intronic
948579555 2:238975154-238975176 ATCCCGAGTACAAACCTCAGTGG + Intergenic
1179212816 21:39340015-39340037 AAACCGACTTCAACTGTCAAAGG - Intergenic
949662930 3:6302995-6303017 ATACCAAGTTTAAAGCTTAAAGG - Intergenic
951126028 3:18984259-18984281 ATACTGTGTTTAAATCACAATGG - Intergenic
952855848 3:37770274-37770296 ATACTGAGTTCAGATATCAATGG - Intronic
955702118 3:61692246-61692268 AACCAGAGTTCAAATCTCCATGG + Intronic
955751355 3:62187944-62187966 ATACTGAGTTAAGCTCTCAAAGG - Intronic
956019779 3:64921901-64921923 AGATGGACTTCAAATCTCAAAGG + Intergenic
957231741 3:77526823-77526845 CTACTGAGTTGAAATCTCTAAGG + Intronic
957237924 3:77619296-77619318 ATACCAAGTACAAGTTTCAAGGG + Intronic
957745822 3:84340619-84340641 ATACAGATATCAAATGTCAAAGG + Intergenic
959385645 3:105702173-105702195 ACAGCGAGTTCAAATGTCAATGG - Exonic
962949276 3:140203131-140203153 AAACCAACTTCAAATCTCAGTGG - Intronic
964619701 3:158708957-158708979 TTACCCAGTTAAAATCTCAGGGG - Intronic
971174783 4:24271659-24271681 GAGCCGAGTTCAAATCTCAGTGG + Intergenic
971652743 4:29300448-29300470 CTACTGAGTTAAAATCTCAGAGG - Intergenic
974903128 4:68025419-68025441 ATACAGAATTCACATCACAATGG + Intergenic
975290083 4:72667461-72667483 ATACATAGTTCATATCTTAATGG + Intergenic
977492282 4:97730971-97730993 ATACGGAATTCAAATCTGGATGG - Intronic
978241366 4:106520812-106520834 ATACCATGATCAAATCCCAAAGG - Intergenic
980110120 4:128627567-128627589 ATAACAAGTTCAAATTTAAATGG + Intergenic
986456428 5:7925170-7925192 ATACCTAGTTGAAATATCACTGG + Intergenic
987691403 5:21271586-21271608 ATACCTAGTTGAATTGTCAATGG - Intergenic
989019169 5:36980820-36980842 ATGCCAAGTTCAAATCAAAAGGG - Intronic
991378301 5:65989459-65989481 AAATAGAGTTGAAATCTCAAAGG - Intronic
991748973 5:69778552-69778574 ATACCTAGTTGAATTGTCAATGG + Intergenic
991800554 5:70358363-70358385 ATACCTAGTTGAATTGTCAATGG + Intergenic
991828046 5:70651678-70651700 ATACCTAGTTGAATTGTCAATGG - Intergenic
991892912 5:71357803-71357825 ATACCTAGTTGAATTGTCAATGG + Intergenic
995906222 5:117127431-117127453 ATTCTAAGTTTAAATCTCAATGG - Intergenic
999902991 5:156107003-156107025 ACACAGAGATCAAATGTCAAGGG - Intronic
1003050371 6:2775335-2775357 AGACTGAGCTCAAATCTCCAGGG - Intronic
1005587973 6:27295477-27295499 AATCCGAGTTCAAATCTCGGTGG + Intronic
1016056069 6:139579079-139579101 ATACCTATTTCAAATATCAGAGG - Intergenic
1021773396 7:24027641-24027663 ATTCAGAGTTCAAATATCAGAGG - Intergenic
1022258563 7:28682890-28682912 ACTCTGAGCTCAAATCTCAAAGG + Intronic
1022509796 7:30927789-30927811 ATTCCGTGTGCAAGTCTCAAGGG - Intergenic
1023327085 7:39072014-39072036 AGACAGAGCTCAAATCTCACAGG + Intronic
1031897421 7:127367157-127367179 CTACCTAGTTGAAATCTGAATGG + Intronic
1044962556 8:97545145-97545167 AGACTGAGCTCAAATCACAAAGG + Intergenic
1051778146 9:20658685-20658707 ATACCGAGTTCATCTCACTAGGG - Exonic
1056007726 9:82290635-82290657 ATGCTAAGCTCAAATCTCAATGG + Intergenic
1188228666 X:27633593-27633615 ATACCAATTTCAAATCCCCAGGG + Intronic
1189941513 X:46128067-46128089 ATATCGAGATAAAACCTCAATGG - Intergenic
1195144640 X:102000685-102000707 ATACCAAAATCAAATCCCAAGGG + Intergenic
1197836544 X:130700152-130700174 AACCCAAGTTCAAATGTCAATGG + Intronic
1200877342 Y:8171868-8171890 TTACAGAGATCAAATCACAAGGG + Intergenic