ID: 1092187833

View in Genome Browser
Species Human (GRCh38)
Location 12:6493948-6493970
Sequence ATACCGAGTTCAAATCTCAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092187833_1092187838 15 Left 1092187833 12:6493948-6493970 CCGTTGAGATTTGAACTCGGTAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1092187838 12:6493986-6494008 CGCGTTGCCAGACTCAGAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 66
1092187833_1092187837 12 Left 1092187833 12:6493948-6493970 CCGTTGAGATTTGAACTCGGTAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092187833 Original CRISPR ATACCGAGTTCAAATCTCAA CGG (reversed) Exonic