ID: 1092187837

View in Genome Browser
Species Human (GRCh38)
Location 12:6493983-6494005
Sequence CCGCGCGTTGCCAGACTCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 21}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092187833_1092187837 12 Left 1092187833 12:6493948-6493970 CCGTTGAGATTTGAACTCGGTAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 21
1092187831_1092187837 19 Left 1092187831 12:6493941-6493963 CCTGCAGCCGTTGAGATTTGAAC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 21
1092187830_1092187837 23 Left 1092187830 12:6493937-6493959 CCGTCCTGCAGCCGTTGAGATTT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092187837 Original CRISPR CCGCGCGTTGCCAGACTCAG AGG Exonic
911611632 1:99964898-99964920 CTGCACATTGCCAGACTCAAAGG + Intergenic
923385182 1:233459324-233459346 CCGGGCTTGGCCAGGCTCAGTGG - Intergenic
1082932417 11:58622597-58622619 CCACGCCCTGCCTGACTCAGAGG - Intronic
1090037893 11:123264597-123264619 CCACGTGTTTCCAGACTCAAGGG - Intergenic
1090771925 11:129928471-129928493 CCTCGACTTCCCAGACTCAGAGG + Intronic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1109396475 13:61766101-61766123 CCACCCGCAGCCAGACTCAGAGG - Intergenic
1117097649 14:52314455-52314477 CGGAGCGTTCCGAGACTCAGAGG - Exonic
1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG + Intronic
1130353035 15:83107908-83107930 CCGCGCCTGGCCAGACTAGGGGG + Intronic
1132369055 15:101280565-101280587 CCACGCCTGGCCAAACTCAGGGG - Intergenic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1153314301 18:3706925-3706947 CCGCCCATTCCCAAACTCAGTGG - Intronic
1166084436 19:40465714-40465736 CCGCGCGTGCCGAGACTCTGAGG - Exonic
926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG + Intronic
1185401004 22:50616851-50616873 CCAGGCGTGGCCAGGCTCAGTGG + Intergenic
1185401026 22:50616995-50617017 CCAGGCGTGGCCAGGCTCAGTGG + Intergenic
1203289123 22_KI270735v1_random:17280-17302 CCGCTCTATGCAAGACTCAGCGG + Intergenic
964041808 3:152269463-152269485 CCGCGCGCCGCTCGACTCAGAGG - Intronic
993236081 5:85311870-85311892 GCGCAGGTTGCCAGACTGAGTGG + Intergenic
1020068612 7:5210326-5210348 CTCCTCGTTCCCAGACTCAGGGG + Intronic
1035466835 7:159084779-159084801 CCGCCAGTTGCCAGTCTCAGAGG + Intronic
1052896387 9:33751135-33751157 GCGCGCGTTCCCGGACTCACGGG - Intronic
1057869922 9:98709401-98709423 CCGCGCGCTGGCACACGCAGTGG + Intergenic