ID: 1092191907

View in Genome Browser
Species Human (GRCh38)
Location 12:6527369-6527391
Sequence TTCCATTGCTGGCCTGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092191900_1092191907 -1 Left 1092191900 12:6527347-6527369 CCCGCCGGCCTTTTCCATCAGCT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1092191907 12:6527369-6527391 TTCCATTGCTGGCCTGGCCCCGG 0: 1
1: 0
2: 1
3: 26
4: 227
1092191901_1092191907 -2 Left 1092191901 12:6527348-6527370 CCGCCGGCCTTTTCCATCAGCTT 0: 1
1: 0
2: 0
3: 20
4: 165
Right 1092191907 12:6527369-6527391 TTCCATTGCTGGCCTGGCCCCGG 0: 1
1: 0
2: 1
3: 26
4: 227
1092191903_1092191907 -9 Left 1092191903 12:6527355-6527377 CCTTTTCCATCAGCTTCCATTGC 0: 1
1: 0
2: 1
3: 28
4: 299
Right 1092191907 12:6527369-6527391 TTCCATTGCTGGCCTGGCCCCGG 0: 1
1: 0
2: 1
3: 26
4: 227
1092191902_1092191907 -5 Left 1092191902 12:6527351-6527373 CCGGCCTTTTCCATCAGCTTCCA 0: 1
1: 0
2: 0
3: 26
4: 360
Right 1092191907 12:6527369-6527391 TTCCATTGCTGGCCTGGCCCCGG 0: 1
1: 0
2: 1
3: 26
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092191907 Original CRISPR TTCCATTGCTGGCCTGGCCC CGG Intronic
900598893 1:3494658-3494680 TGCCGTTGCTGGCGTGGCACAGG + Exonic
900940846 1:5797701-5797723 CTCCTTTGCTGTCCTGGTCCTGG - Intergenic
901793085 1:11664554-11664576 TTCGACTGGGGGCCTGGCCCCGG + Intronic
902040004 1:13485691-13485713 CTCCATTGGTGGCCTGAGCCTGG + Intronic
902408363 1:16198786-16198808 TTCCCTTCCAGGCCTGGCCCTGG - Intronic
904116074 1:28162959-28162981 TTCCGTGGCTCCCCTGGCCCAGG + Intronic
904488149 1:30841206-30841228 TTGCAACCCTGGCCTGGCCCAGG - Intergenic
906237587 1:44221287-44221309 TCCCATTGCGGGCCTGGGCTAGG - Exonic
907239319 1:53071755-53071777 CCCCACTGCTAGCCTGGCCCGGG - Intronic
907839494 1:58142612-58142634 TTCCTTTTCTTCCCTGGCCCAGG - Intronic
911476234 1:98376497-98376519 TACCATTCCTGGGCTGGCCTTGG + Intergenic
914804633 1:150983162-150983184 CTACCTTGCTGGCCAGGCCCAGG - Exonic
916844771 1:168638487-168638509 CTCCATCCCTGGGCTGGCCCGGG - Intergenic
917489904 1:175489188-175489210 TTCCATTCCTGGCTGGGCCCCGG - Intronic
917814513 1:178693823-178693845 TTCCATTGCTTTCCTGGGACTGG - Intergenic
917853764 1:179085747-179085769 TTCCACGGCTGGTCTGGCACAGG + Exonic
917878715 1:179312170-179312192 TTTCATTGCTGGCCTGCCTAAGG + Intronic
918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG + Exonic
920518352 1:206603155-206603177 TTCCATTGCTCCACTGGCCCTGG - Exonic
920654813 1:207867587-207867609 TTCCACCCCTGGCCTGTCCCTGG - Intergenic
920662091 1:207923741-207923763 TCCCATTGCTGGGCTGGGCTGGG + Intergenic
922551588 1:226498168-226498190 TGCCAGTGTTGGCCTGGCTCGGG - Intergenic
923268741 1:232335915-232335937 TTCCAATGCTGGCTTGGCCGGGG - Intergenic
1067143532 10:43676561-43676583 GCCCAGTGCTGACCTGGCCCGGG - Intergenic
1067917662 10:50418255-50418277 TTCCCCTGCTTGCCGGGCCCTGG + Intronic
1068942957 10:62698443-62698465 TTTCTTTGCTGTCCTGGCACGGG - Intergenic
1070727575 10:78802797-78802819 GTCCCTGCCTGGCCTGGCCCAGG - Intergenic
1071011476 10:80945143-80945165 TTCCTTTGCTGCCCCAGCCCTGG - Intergenic
1075823168 10:125331302-125331324 GTCCATGCCTGGCCTGGCCTTGG - Intergenic
1076357253 10:129862079-129862101 CTCCAGGGCTGTCCTGGCCCTGG - Intronic
1076994242 11:290484-290506 GTCCATCGCCCGCCTGGCCCCGG + Exonic
1077128859 11:959199-959221 CTCCTTTGCTGTCCTGACCCAGG + Intronic
1078008657 11:7552459-7552481 ATCCATTGCTGGATTTGCCCAGG + Intronic
1078340700 11:10496356-10496378 CTACATTGCTGGCCTCTCCCTGG + Intronic
1078568912 11:12440710-12440732 TTCCCTTGCTGGCCTTGGCCAGG + Intronic
1079006299 11:16793661-16793683 AGCCAAGGCTGGCCTGGCCCTGG + Intronic
1079363725 11:19791407-19791429 TTCCTTTCCTTTCCTGGCCCAGG + Intronic
1079380818 11:19935631-19935653 TTCCTTTGCTGGCCTGGTGCTGG - Intronic
1079505498 11:21148028-21148050 TAACATAGCTGGCCTGCCCCAGG - Intronic
1080414979 11:32061186-32061208 TTCTGTAGCTGGCCTGGCCAGGG - Intronic
1081430148 11:42967824-42967846 TTCCTTTGCTGGCATGGTTCCGG - Intergenic
1083686664 11:64380587-64380609 TTCCAGTTCCCGCCTGGCCCTGG - Intergenic
1084116004 11:67043283-67043305 CTCCACTGCTTGCCTGGCCTAGG + Intronic
1084154793 11:67307495-67307517 TTCCCTTGCTGCCCTTCCCCAGG - Intronic
1084736310 11:71107922-71107944 TTCTACTGCTGGCCAGGCCAAGG + Intronic
1085413689 11:76306641-76306663 TGCCAGGCCTGGCCTGGCCCTGG + Intergenic
1085554940 11:77411571-77411593 TTCCAGTGCAGGCCTAGCCCTGG + Intronic
1087141675 11:94770133-94770155 TTCCACAGCTGCCCGGGCCCAGG - Intronic
1087166204 11:95006068-95006090 TGCCATTACTTCCCTGGCCCTGG + Intergenic
1089318194 11:117606284-117606306 TTCCATGGCTTCCATGGCCCTGG + Intronic
1089559417 11:119336319-119336341 TTTCAGTGCAGGCCTGGCACAGG - Exonic
1091021729 11:132105965-132105987 TTCCCTTGCTGAGCTGGGCCTGG - Intronic
1091283803 11:134397136-134397158 TTCCACTGCTGCCCCGGCCTAGG + Intronic
1092191907 12:6527369-6527391 TTCCATTGCTGGCCTGGCCCCGG + Intronic
1092241294 12:6837896-6837918 TCCCACTGCCGGCCTGGGCCTGG + Intronic
1096070397 12:48772225-48772247 ATACATTTCTGGCCTGGCCCAGG + Intronic
1096110838 12:49028145-49028167 TTCCATCCCTTCCCTGGCCCTGG - Intronic
1098141775 12:67457384-67457406 ATGCAGTGCTGGCCTGGCACAGG + Intergenic
1098759185 12:74402885-74402907 TTCCCTTTCTGGGCTGGCCAAGG + Intergenic
1099911732 12:88842103-88842125 TTCCATGGCTGGGCTGGGCTTGG - Intergenic
1102443251 12:112979494-112979516 TTAGCTTGCTGGCCTGGGCCAGG - Intronic
1103701072 12:122849006-122849028 TGCCTTTGAGGGCCTGGCCCAGG + Intronic
1103810710 12:123611329-123611351 TCCCATTGCTGGGATGGGCCAGG + Intronic
1104619449 12:130299880-130299902 TTGCAGTGCTGGCCTGGCAGAGG + Intergenic
1106257668 13:28036406-28036428 TTCCATTGCCAGCCTCTCCCTGG + Intronic
1109987995 13:70016262-70016284 CTCCAGAGCTGGCCTGGGCCAGG + Intronic
1110060621 13:71033953-71033975 TTGCATTGCTGGACTGTGCCAGG - Intergenic
1113305088 13:109068879-109068901 TTACATTGCTGGGCTGGGCACGG - Intronic
1113429816 13:110240381-110240403 TTCCATCCCAGTCCTGGCCCGGG + Intronic
1113485696 13:110650845-110650867 TCCCAGTGCTGGTCTGGGCCCGG - Intronic
1116062939 14:39947290-39947312 TTAAATTGCTGTCCTTGCCCAGG + Intergenic
1117373173 14:55097244-55097266 TTCCTCTGCTGCCCTGACCCTGG - Intergenic
1117648041 14:57873009-57873031 ATCCATTGCAGACATGGCCCAGG - Intronic
1118057871 14:62100602-62100624 CTCCACTGCTGTTCTGGCCCAGG - Exonic
1121133204 14:91468961-91468983 TTCCATTGATGGCCAAGTCCAGG + Intronic
1122083904 14:99286208-99286230 TGGCTCTGCTGGCCTGGCCCCGG - Intergenic
1123122876 14:105926287-105926309 TCCCATTGCCCACCTGGCCCTGG + Intronic
1123173721 14:106398765-106398787 TGCCTTCGCTGGCCTGGCGCGGG - Intergenic
1123405519 15:20017707-20017729 TCCCATTGCCCACCTGGCCCTGG + Intergenic
1123514851 15:21024355-21024377 TCCCATTGCCCACCTGGCCCTGG + Intergenic
1126099083 15:45108934-45108956 TCAGATTACTGGCCTGGCCCTGG - Exonic
1129270673 15:74417767-74417789 CTCCAATGCTGGCCTTGCCCTGG - Intronic
1130252193 15:82306932-82306954 TGCCATTGCTGGCCAGTCCCCGG + Intergenic
1130438969 15:83931726-83931748 TTCCATTCCTTTCCTAGCCCAGG - Intronic
1130775044 15:86970142-86970164 TTCCAATGCTGCCTTGGCCTGGG - Intronic
1131016250 15:89059879-89059901 TTCCACAGCTGGCCTGGGCAGGG - Intergenic
1132294851 15:100727431-100727453 TTCCAGGGCAGCCCTGGCCCTGG - Intergenic
1132304704 15:100802673-100802695 CTCCACTGCTGGCATGGGCCTGG - Intergenic
1132336789 15:101052973-101052995 TGCCACTGCCGCCCTGGCCCAGG - Exonic
1132938077 16:2492125-2492147 CCCCTTTGCTGGCCTGGACCTGG + Intronic
1137237042 16:46625097-46625119 AGCCATGCCTGGCCTGGCCCTGG + Intergenic
1137262419 16:46842645-46842667 GGCCATAGGTGGCCTGGCCCTGG + Intergenic
1139653819 16:68375698-68375720 TACCATTGCTGGCAGGGCCATGG - Intronic
1141462187 16:84184161-84184183 TCCCTTTGCTGGGCTGGCCTGGG + Intronic
1141468332 16:84221788-84221810 TTCCAGTGGTGGCATGGCCCAGG + Exonic
1142010353 16:87710826-87710848 TGCCTGTGCTGGGCTGGCCCTGG + Intronic
1142174870 16:88640511-88640533 GTCCATGGCTGGCCTGGACCAGG - Intergenic
1142725645 17:1811629-1811651 TTACATTGCTGGGCTGGGCAGGG + Intronic
1144672821 17:17142535-17142557 TCCCATGCCCGGCCTGGCCCGGG - Intronic
1147413426 17:40270582-40270604 TTACCTTGCTGCCCTGGCCTAGG + Intronic
1148906637 17:50916625-50916647 TTCCACAGCTGGTCAGGCCCAGG + Intergenic
1150206387 17:63411888-63411910 TTCAACTGCTGGCCTACCCCAGG - Intronic
1150268585 17:63847787-63847809 TTCCTTTGCTGGCCTGCTCTAGG - Intergenic
1150684165 17:67307028-67307050 TTCTTTTGCTGGTCTGGCCTGGG + Intergenic
1151872195 17:76844000-76844022 CCCCTTTGCTGGCCTGACCCTGG + Intergenic
1152225737 17:79091769-79091791 TTGCAAGGCTGGCCTGGCCTTGG + Intronic
1152449886 17:80371417-80371439 TTCCATTCCTGTGCTGGCCCTGG - Intronic
1152858510 17:82680278-82680300 ATCCAGTCCTGCCCTGGCCCTGG + Intronic
1152926256 17:83089095-83089117 GTCCATTGCTGGGGTGCCCCGGG - Intronic
1154358469 18:13640655-13640677 GTCCAGGGCTGGCTTGGCCCGGG + Intronic
1155057925 18:22201093-22201115 TTCCATAGCAGGCAAGGCCCAGG - Exonic
1155132534 18:22952680-22952702 TTCCATTGCTGACCTGGGAAAGG - Intronic
1157490031 18:48116686-48116708 GGCCACTGCTTGCCTGGCCCTGG + Intronic
1158150175 18:54358412-54358434 GTCCATTGCTGCGCTCGCCCTGG + Intronic
1159754526 18:72348097-72348119 TTCCTTTACTGTGCTGGCCCTGG + Intergenic
1160507274 18:79434212-79434234 TTCCAGAGCGGGCCTGGGCCTGG + Intronic
1160764703 19:802292-802314 CTCCACTCCTGCCCTGGCCCTGG - Intronic
1161051731 19:2167504-2167526 TTCCCTCCCTGGCCAGGCCCTGG + Intronic
1161134058 19:2609408-2609430 ATACATTGCTTGCCTGACCCTGG + Intronic
1161594051 19:5142262-5142284 ATCCAGTGCTGGCCTGGCCCAGG - Intronic
1162177025 19:8838311-8838333 TTCCACAGGTGGCCTTGCCCTGG - Intronic
1164157691 19:22606398-22606420 TGCCATTGCTGCCCCAGCCCTGG - Intergenic
1164273668 19:23697698-23697720 TTCTATTGCTGGCTTGGTACTGG + Intergenic
1165590673 19:36966833-36966855 TTGCATATCTGGCCTGGGCCTGG + Intronic
1166666480 19:44683496-44683518 CTCCCTGGCTGGCCTGGCCCAGG - Exonic
925258218 2:2507649-2507671 CTCCGTGGCTGGCCTGGCCACGG + Intergenic
925411607 2:3642968-3642990 TTCCATTGCTGGCTGGGCAAAGG - Intronic
925979277 2:9164089-9164111 TTCCAGTGCTGCCCCTGCCCCGG - Intergenic
926328170 2:11803242-11803264 TCCTTTTGCTGGCCTGGCCCTGG + Intronic
927154410 2:20213289-20213311 TGCCCTGCCTGGCCTGGCCCGGG - Intronic
927680562 2:25136396-25136418 CTCCAGTGCTCCCCTGGCCCTGG - Intronic
929553342 2:42908002-42908024 CTCCTTTGCTGTCCTGGTCCTGG + Intergenic
929863671 2:45700025-45700047 TTCCACTGGTGGGCTGGGCCTGG - Intronic
929977967 2:46653473-46653495 TTCCATAACTGGCCCAGCCCTGG - Intergenic
930468219 2:51780508-51780530 TGGCAGTGCTGGGCTGGCCCGGG + Intergenic
931401717 2:61937420-61937442 TGGCATGGCTGGCCTGCCCCTGG + Intronic
931691681 2:64839100-64839122 TTCCCATACTGGGCTGGCCCTGG - Intergenic
932265120 2:70361191-70361213 TTCCATTGCCTGCCCTGCCCAGG - Intergenic
933773592 2:85758805-85758827 GTGCACAGCTGGCCTGGCCCCGG + Intronic
935260301 2:101350016-101350038 TTCTGTTGAGGGCCTGGCCCAGG + Exonic
936573723 2:113636538-113636560 TTCCTTTTATGGCCTAGCCCTGG + Intronic
936973664 2:118198379-118198401 CACCATTGCTGGCCTGGCTCAGG + Intergenic
938597298 2:132801055-132801077 TGCCCTTTCTTGCCTGGCCCAGG + Intronic
941079159 2:161040468-161040490 TTCCATTGCTGGCCATCCTCTGG + Intergenic
941638463 2:167961688-167961710 TTCCATTGTTGGTATGGCCAGGG - Intronic
946302555 2:218832691-218832713 TTCCATCCCAGCCCTGGCCCTGG + Intergenic
946561933 2:220923856-220923878 TTCAATTACAGGACTGGCCCAGG + Intergenic
948614269 2:239188221-239188243 TCCCAAAGCTGGGCTGGCCCTGG - Intronic
948840727 2:240647594-240647616 CTGCGTTGCTGGCCTTGCCCAGG - Intergenic
1168968506 20:1914683-1914705 TTCTGTTTCTGGCCTGGCCCAGG - Intronic
1169677450 20:8169884-8169906 CTCAGTTGCTGGGCTGGCCCTGG + Intronic
1173589140 20:44210625-44210647 TTCCACTGCCGGTCTGGCCGCGG - Intronic
1174720696 20:52809103-52809125 TTCCAATTCTGGGCTGGCCTGGG - Intergenic
1175092866 20:56519299-56519321 CTCCCTTGCTGGCCTCTCCCTGG - Intronic
1175184501 20:57170891-57170913 CTCCATTGCTCGCCTTGGCCAGG - Exonic
1175394716 20:58650467-58650489 TTCCACGGTTGGCCGGGCCCAGG - Intergenic
1175930745 20:62492725-62492747 ACCCACAGCTGGCCTGGCCCAGG - Intergenic
1177367358 21:20154983-20155005 TTCCCATGCAGGCCTGGACCTGG - Intergenic
1179588293 21:42388148-42388170 CTCCGATCCTGGCCTGGCCCTGG + Intronic
1179910976 21:44448756-44448778 TGCCATTGCTGAGCTGGCCAGGG - Intergenic
1179971617 21:44838975-44838997 TTCCTTTGCTGGCTTTGCCTGGG + Intergenic
1180962413 22:19767862-19767884 TTCCCCTGCCGGCCTAGCCCAGG + Intronic
1181110783 22:20601727-20601749 TTCCTTTGCTTTCCTTGCCCAGG - Intergenic
1183545428 22:38452777-38452799 TTCCCCAGCTAGCCTGGCCCTGG + Intronic
1184262811 22:43329105-43329127 TGCCAGTGCTGTCCTGGGCCAGG + Intronic
1184502650 22:44883146-44883168 CCCCACTGCTGGCCGGGCCCTGG - Exonic
1185426454 22:50774341-50774363 TTCCTTTTATGGCCTAGCCCTGG - Intronic
949826125 3:8167881-8167903 CTCCATTGCTGGCCTCCCCCTGG + Intergenic
950137300 3:10590657-10590679 ATCCATTGCTCCCATGGCCCTGG - Intronic
950695901 3:14701065-14701087 CTCCATGTCTGGCCTGCCCCAGG - Intronic
953131797 3:40146611-40146633 TCTCATTGCTGCTCTGGCCCTGG + Intronic
953528332 3:43714077-43714099 TTCCCTTGTGGGCCTTGCCCTGG + Intronic
956072834 3:65472682-65472704 TTGCATCTCTGGCCTGGCACTGG - Intronic
956274580 3:67484210-67484232 TTCCAATGCTTGCCTGACTCTGG + Intronic
957484945 3:80848480-80848502 TGCAATTACTGGCCTGGACCTGG + Intergenic
961471302 3:127114854-127114876 TCTCATTGCTGACCAGGCCCAGG - Intergenic
962451802 3:135525284-135525306 TTACATTACCTGCCTGGCCCTGG + Intergenic
964429894 3:156594303-156594325 TTCCATTACCTGCCTGGCCGTGG + Intergenic
968684164 4:1945352-1945374 CTCCTGTGCTGCCCTGGCCCTGG + Intronic
968941042 4:3637893-3637915 GTCCTTTGCTGGCCTGGCCACGG - Intergenic
979490810 4:121325422-121325444 TTCCATTCCTGGCCAAGCACAGG - Intergenic
983501918 4:168509029-168509051 TACCATTGCTGGATTGGCTCTGG + Intronic
985201195 4:187487126-187487148 TTCCTTTTCTGGCCTGGGGCAGG - Intergenic
986178773 5:5374175-5374197 CTGCATTGCTGGCAGGGCCCAGG - Intergenic
986579967 5:9255654-9255676 CTCCAATGGTGGCATGGCCCTGG + Intronic
987655721 5:20803164-20803186 TACCATTGCTGCCATGACCCTGG + Intergenic
987810973 5:22835822-22835844 TTCCATACTTGGCATGGCCCTGG + Intronic
988581006 5:32468830-32468852 TCCCATTCCTGGTCTGGGCCAGG - Intergenic
988705942 5:33726058-33726080 TTGGATTCTTGGCCTGGCCCTGG - Intronic
988767836 5:34400745-34400767 TACCATTGCTGCCATGACCCTGG - Intergenic
990498268 5:56370013-56370035 TGCCAATCCTGGCCTTGCCCAGG - Intergenic
991458236 5:66827888-66827910 TTTCATTACTGGCATGGCACAGG - Intronic
991988115 5:72310327-72310349 TACCCTTCCTGGCCTAGCCCTGG - Intronic
992615715 5:78544079-78544101 AGCCATTGCTGTCCTGGCACTGG - Intronic
993900147 5:93579549-93579571 TTGCCTAGCTGGGCTGGCCCGGG - Intergenic
1001494347 5:172177420-172177442 TTGCAGATCTGGCCTGGCCCTGG + Intronic
1002770289 6:284688-284710 TCCCATTGCTGGGCAGGGCCAGG - Intergenic
1006056640 6:31390075-31390097 TCTCATTCTTGGCCTGGCCCAGG + Intergenic
1006069364 6:31486990-31487012 TCTCATTCTTGGCCTGGCCCAGG + Intergenic
1006370992 6:33643445-33643467 TTCCAGAGCTGGCAAGGCCCTGG + Intronic
1008406382 6:51122542-51122564 TTCCATTGCTGGTGAGGCACTGG - Intergenic
1012749409 6:103139526-103139548 TTCCATTCCTGGCTTGCCCTTGG - Intergenic
1017990417 6:159483176-159483198 TGCCAATGCTGGCCTGGGCCAGG - Intergenic
1019165142 6:170093735-170093757 TTCCCCTGTTGCCCTGGCCCTGG + Intergenic
1019424299 7:966572-966594 TACCTTCTCTGGCCTGGCCCTGG + Exonic
1020084610 7:5303661-5303683 TCCCATTGCCTTCCTGGCCCGGG + Exonic
1020440995 7:8216228-8216250 GTCAAGTGCTGGACTGGCCCTGG + Intronic
1024349943 7:48353298-48353320 TCCCACAGCTGGCCTGGCTCTGG + Intronic
1024841854 7:53596023-53596045 TTCCAATAATGGCCTGGCCTAGG + Intergenic
1025751588 7:64298544-64298566 TCCCACTGTTGGCATGGCCCAGG + Intergenic
1026018911 7:66693411-66693433 TTCCAGGGCAGGCCTGGCTCAGG + Intronic
1027564101 7:79768384-79768406 TCCCCTTTCTGGCCTGGCCAAGG - Intergenic
1027996206 7:85427803-85427825 TTCCAGTGCTGTCCTGGCTCAGG + Intergenic
1028081502 7:86583654-86583676 TTTGATTGCCTGCCTGGCCCAGG - Intergenic
1029612357 7:101633835-101633857 TGCCCTTTCTGGCCTGGCCAGGG + Intergenic
1031922410 7:127611865-127611887 TTCCATTTCTGGCCTGAGCCAGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1035333278 7:158110368-158110390 TTCCATGGCAGGCATGGCCATGG - Intronic
1036775506 8:11609112-11609134 TTACAATCCTGGCCTGGCCCTGG - Intergenic
1037763391 8:21756855-21756877 TCCCAGTCCTGGGCTGGCCCTGG + Intronic
1039901770 8:41757859-41757881 TTCCACTCCTGCCGTGGCCCAGG - Intronic
1040464221 8:47679381-47679403 CTCCAGTGCTGGCCTGTGCCAGG + Intronic
1040464238 8:47679424-47679446 CTCCAGTGCTGGCCTGTGCCAGG + Intronic
1040464265 8:47679510-47679532 TTCCAGTGCTGGCCTGTGCCAGG + Intronic
1041967883 8:63701523-63701545 GACCAGTGCTGGCCAGGCCCTGG - Intergenic
1043505619 8:80898950-80898972 TGCCCTTGCTGGTCTGGTCCTGG - Intergenic
1045111509 8:98941921-98941943 TTCCATTCCTGCCGCGGCCCCGG - Intronic
1045233460 8:100328316-100328338 TTCCACTGCTGACCTCTCCCTGG - Intronic
1045526970 8:102949212-102949234 TTCCCTGTCTGGCCTGGCACAGG + Intronic
1051696108 9:19769329-19769351 TAACAGTGGTGGCCTGGCCCAGG - Intronic
1053169358 9:35867815-35867837 TTCCATTCCCTGCCTTGCCCTGG - Intergenic
1057502415 9:95606034-95606056 TTCCATGGCGGGCCTGGGCCTGG + Intergenic
1058388570 9:104467762-104467784 TTCCATTTCTGACATGGCCATGG + Intergenic
1060186950 9:121569167-121569189 TTCCTGTGCTGCCCTGACCCAGG - Intronic
1061163902 9:128911553-128911575 TGCCATTCCTGCCCTGTCCCGGG + Intronic
1061179150 9:129013809-129013831 CTCCAATCCTGGCCTCGCCCTGG + Intronic
1061261650 9:129483553-129483575 TAACAGTGCTGGCCTTGCCCGGG + Intergenic
1061275907 9:129569234-129569256 CTCCCTCCCTGGCCTGGCCCCGG - Intergenic
1061894493 9:133640097-133640119 TGTCATAGCTGGCCAGGCCCAGG - Intronic
1061933801 9:133846553-133846575 GTCCCTGGCTGCCCTGGCCCCGG + Intronic
1062170092 9:135129897-135129919 TCCCAGAGCAGGCCTGGCCCAGG - Intergenic
1062580730 9:137228227-137228249 TTGCATTACTGGCCTTGCACGGG - Exonic
1062651344 9:137579278-137579300 TTCCATGACAGGCCTTGCCCCGG + Intergenic
1186226486 X:7404358-7404380 TTCCATTGCTTGCTTGCCCCAGG - Intergenic
1187420512 X:19129889-19129911 ATCCATTTCTGGCCTTCCCCTGG - Intergenic
1188230818 X:27660719-27660741 TTCTACTGCTGGACTGGGCCGGG + Intronic
1189362888 X:40366846-40366868 TTGCACTGCTTTCCTGGCCCTGG + Intergenic
1191743620 X:64463199-64463221 TTCATTTGCTGGCCTCTCCCAGG - Intergenic
1191847891 X:65562286-65562308 ATCCTTTCCTGGCCAGGCCCTGG - Intergenic
1192808885 X:74532634-74532656 TCTCTTTCCTGGCCTGGCCCAGG - Exonic
1194847076 X:98823014-98823036 TTCCATTGCTGGCTTGAAGCTGG + Intergenic
1196762032 X:119208894-119208916 TTCCGTTTCTGGGCTGGCCAAGG - Intergenic
1199847166 X:151699915-151699937 TTCAGTTGCTGGGCTGGGCCTGG + Intronic
1200213642 X:154357866-154357888 TCCTAGTGCTGGCCAGGCCCTGG - Intronic
1201713471 Y:17017458-17017480 TTCTATTCCTGGCCTGGTGCAGG - Intergenic