ID: 1092192123

View in Genome Browser
Species Human (GRCh38)
Location 12:6528743-6528765
Sequence AAGGACATGGTGAAGGTGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 2, 2: 5, 3: 55, 4: 575}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092192117_1092192123 -10 Left 1092192117 12:6528730-6528752 CCACCTGATCCTCAAGGACATGG 0: 2
1: 0
2: 1
3: 8
4: 178
Right 1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG 0: 1
1: 2
2: 5
3: 55
4: 575
1092192116_1092192123 -9 Left 1092192116 12:6528729-6528751 CCCACCTGATCCTCAAGGACATG 0: 1
1: 0
2: 0
3: 15
4: 180
Right 1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG 0: 1
1: 2
2: 5
3: 55
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092192123 Original CRISPR AAGGACATGGTGAAGGTGAA GGG Exonic
900484007 1:2912899-2912921 AAGGACTTGGTGATGGTGACAGG - Intergenic
900519118 1:3097142-3097164 AAGGTCATGGGCAAGGTTAAGGG + Intronic
900720883 1:4175023-4175045 GAGGCCATCGTGATGGTGAAGGG + Intergenic
900822108 1:4897675-4897697 AGGGACCTGGTGGAGGTGATTGG + Intergenic
900975316 1:6012717-6012739 GAGGTCATGGTGGAGGTGATGGG + Intronic
901200784 1:7466094-7466116 AAGGAGATGGTGAATGTCACAGG + Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901395906 1:8981409-8981431 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
901731058 1:11280064-11280086 AAGTACAAGGTGGTGGTGAAGGG + Intronic
903316979 1:22515711-22515733 AAGGACTTTGTGAATGTGACTGG - Intronic
904379824 1:30103190-30103212 AGGGACCTGGTGATGGTGATGGG + Intergenic
904402901 1:30268399-30268421 AGGGACCTGGTGGAGGTGATTGG - Intergenic
905143361 1:35867077-35867099 TAGAATATGGTGAAGGTGATGGG + Intergenic
905514515 1:38552288-38552310 AAACACATGGAGAAGGTGTATGG - Intergenic
905584198 1:39104908-39104930 AAGGACCTGGAGAAACTGAAGGG - Intronic
905638365 1:39571258-39571280 AAGGCCATCGAGAAGATGAATGG - Exonic
906068108 1:42996980-42997002 AAGGCTATTGTGAAGGTTAAAGG - Intergenic
906286639 1:44592081-44592103 AAGGACATGATAAAAATGAAAGG + Intronic
906427777 1:45727433-45727455 AAGGGCAAGGGGAAGGGGAAGGG - Intronic
906750391 1:48253450-48253472 GAGGACATTCTGAATGTGAAGGG - Intergenic
907621285 1:55983443-55983465 AAGGACAAGGCGAAGGGGAAGGG + Intergenic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
908691158 1:66781470-66781492 AAGGAGCTGGTGGAGCTGAAAGG + Intergenic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
910487408 1:87730807-87730829 AATGACCTGGTGAATGTGTATGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
913090378 1:115472747-115472769 CAGGACATGGTGACTGTGAGTGG + Intergenic
913963425 1:143355845-143355867 ACAGACATGGTGCAGGTGAAAGG + Intergenic
914057781 1:144181434-144181456 ACAGACATGGTGCAGGTGAAAGG + Intergenic
914121365 1:144784931-144784953 ACAGACATGGTGCAGGTGAAAGG - Intergenic
915147704 1:153805093-153805115 GAAGCCCTGGTGAAGGTGAAAGG - Exonic
915218160 1:154353452-154353474 AAGGTCCTGGTGAAGGACAATGG - Intergenic
916016508 1:160754546-160754568 AAAAACATGGGGAAGGGGAAAGG + Exonic
916027916 1:160851033-160851055 TAGGACAAGGTGTAGGGGAAGGG + Intronic
916217699 1:162411630-162411652 AGGGACATGGTGGTGGTGAAGGG - Intronic
917028019 1:170663195-170663217 AAGGAGATTGTGATGGAGAAAGG + Intronic
918061360 1:181064131-181064153 AAGGACATGGGGAGGATGAAGGG + Intergenic
918344618 1:183595823-183595845 TAGAACATGGCAAAGGTGAAGGG - Intronic
919013171 1:191991897-191991919 AGGGAGATGGTGATGGTTAATGG + Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016770 1:192048516-192048538 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919031552 1:192249763-192249785 AATGACTTTGAGAAGGTGAAAGG - Intergenic
919044631 1:192435364-192435386 TAGGACATGGCAAAGGTGATGGG - Intergenic
919409178 1:197222432-197222454 ACCGTCATGGTGATGGTGAAGGG + Intergenic
919878278 1:201886279-201886301 AAGCAGGTGGTGAAGCTGAAGGG + Intergenic
920286776 1:204885359-204885381 AAGGGGAGGGTGAAGGTGAAGGG - Intronic
920949734 1:210561155-210561177 GAGGCCATGATGAAGGTCAAGGG - Intronic
921364388 1:214359978-214360000 ATGGACATGGTGAAGGTGAGGGG - Intronic
921520595 1:216150831-216150853 AGGAACATCGAGAAGGTGAAAGG - Intronic
921686406 1:218094050-218094072 GAGGACATGCTGGAGCTGAAGGG - Intergenic
921687585 1:218107607-218107629 AAGGACAGTTTGAAGGTTAAAGG - Intergenic
922411625 1:225381638-225381660 AAGGGAATGGTGAAGGTAAATGG + Intronic
922860994 1:228816165-228816187 AAGGTCATGGTGAGGTTGATGGG + Intergenic
923072431 1:230577877-230577899 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
923270110 1:232347835-232347857 AAACACATGGTGCAGTTGAAGGG + Intergenic
923776983 1:236987766-236987788 AAGGACATGGACAAATTGAAGGG - Intergenic
1062931174 10:1353698-1353720 AGGAACATCGAGAAGGTGAAAGG - Intronic
1062935064 10:1379401-1379423 AGGGACATGGGCAAGATGAAGGG - Intronic
1062946756 10:1467398-1467420 AAGGAGATGGGGAGGGAGAAGGG - Intronic
1063434343 10:6018308-6018330 GAGGACAGGGTGAGGGTGGAGGG + Intronic
1063896659 10:10689382-10689404 AGGGACCTGGTGGAGGTGACTGG - Intergenic
1064067722 10:12196672-12196694 ATGGAGATTGGGAAGGTGAAAGG + Intronic
1064379464 10:14828107-14828129 AAGCACATGGGGAAAATGAAAGG + Intronic
1064427705 10:15244684-15244706 ACAGACTTGGTGAAGGTGCAGGG + Intronic
1065610804 10:27469123-27469145 AAGAACATTGAGAAGGTGAAAGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066977345 10:42381296-42381318 AAGGACAGGGTGAAGCTGTCAGG + Intergenic
1067105767 10:43365222-43365244 AAGGACCTGGTGCAGAGGAAGGG + Intergenic
1067349122 10:45459703-45459725 CACTACATTGTGAAGGTGAATGG + Intronic
1067819758 10:49518365-49518387 AAGGGCTTGGAGAAGGAGAAGGG - Intronic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1068150593 10:53125767-53125789 AAGGACAAGATGAAGGTGAATGG + Intergenic
1068272073 10:54741413-54741435 AAGGACATATAGAAAGTGAAAGG + Intronic
1068584614 10:58783097-58783119 AGGGACACTGTGAAGGTCAAAGG - Intronic
1068797357 10:61098278-61098300 AAGGATATGGGGAAAGTGCAAGG - Intergenic
1069424656 10:68278907-68278929 ATGATCATGGCGAAGGTGAAAGG - Intergenic
1070820980 10:79354132-79354154 TTGGACATGGTGATGGTGATGGG + Exonic
1073080074 10:100854112-100854134 AGGGCCATGGTGAGGGTGAGGGG - Intergenic
1073667204 10:105546871-105546893 AAGGATTAGCTGAAGGTGAATGG - Intergenic
1073709108 10:106018558-106018580 AGGAACATCGAGAAGGTGAAAGG + Intergenic
1073832456 10:107401577-107401599 AAGGAAATGGGGATGGTTAATGG - Intergenic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075417845 10:122278627-122278649 AAGGAACTGGGGAAGGTGCAAGG - Intronic
1075540806 10:123312190-123312212 AAGGACACAGCGGAGGTGAAGGG - Intergenic
1075757807 10:124828866-124828888 AAGAACATGGGTAAGTTGAAAGG + Exonic
1076252969 10:128997593-128997615 AAGGACTTGGGGAAGGCAAAGGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077187109 11:1240333-1240355 CAGGCGGTGGTGAAGGTGAATGG - Exonic
1077937458 11:6802675-6802697 AAGGACTTGTGGAAGGTGATTGG - Intergenic
1079636555 11:22749189-22749211 AAGGAGAAGGTGAAGGAGAAGGG - Exonic
1079807761 11:24955941-24955963 AATGACTTTGTGAAGGGGAAAGG + Intronic
1079936326 11:26621119-26621141 AAGGACATGGTTATTGTGAGGGG - Intronic
1080027000 11:27625698-27625720 AAGGTCATATTGAAGGAGAAAGG - Intergenic
1080120888 11:28675829-28675851 AAGGTTATGGTGAAGATGAAAGG + Intergenic
1080642913 11:34168151-34168173 CAGGGCATGGGGAAGGTGAGTGG + Intronic
1081155472 11:39684415-39684437 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1081282350 11:41225165-41225187 AAGAACATGGGGATGGTTAATGG + Intronic
1081662010 11:44894129-44894151 AAGGGGATGATGAGGGTGAAAGG - Intronic
1083381004 11:62268573-62268595 AGGGGCATGGTGAAGGTCATGGG - Intergenic
1083841180 11:65305085-65305107 ATGGAGATGATGAAGTTGAAAGG - Intronic
1083964654 11:66035975-66035997 AAGGGCATGGAGAAGAGGAAGGG - Intergenic
1083991852 11:66251103-66251125 GAGGACATTGTAAAGGTGGAAGG + Intergenic
1084188779 11:67489441-67489463 ATGGAGATGCTGAAGGTGAGGGG + Exonic
1084849882 11:71930080-71930102 AAGGAGATGTTGAGTGTGAAAGG + Intronic
1085381421 11:76122736-76122758 AAGGACTTGGGGAAAGTGAGAGG - Intronic
1085515589 11:77109965-77109987 AAGGAGGGGGTGAAGGTGATGGG + Intronic
1085879404 11:80448214-80448236 AAGGATAGGGAGAAGGGGAATGG - Intergenic
1086005400 11:82030001-82030023 ATGGACATTGAGAAGGTGAAAGG - Intergenic
1086659027 11:89391934-89391956 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088398282 11:109392959-109392981 AAGGACAGTCTGAAAGTGAAAGG + Intergenic
1088695024 11:112359325-112359347 GAGGACATGGTGTGGTTGAAAGG + Intergenic
1088745944 11:112805239-112805261 AAAGACATAGTGTATGTGAAAGG + Intergenic
1088796338 11:113269510-113269532 CAGGCCATGGGCAAGGTGAAAGG - Intronic
1089543755 11:119206598-119206620 AAGCTCATGGACAAGGTGAAAGG + Exonic
1089790058 11:120936342-120936364 AAGAACAAGATGAAGGTCAAAGG + Intronic
1089865275 11:121626276-121626298 AAGGGGAAGGTGAACGTGAAGGG - Intronic
1089969246 11:122679168-122679190 CTGGACATGTTGAGGGTGAAGGG + Intronic
1090298070 11:125608095-125608117 AAGGACAGGCTGTAGGTAAAAGG - Exonic
1091302410 11:134515859-134515881 AAGGAGGTGGTGCAGGTGAGGGG - Intergenic
1092090872 12:5802740-5802762 GAGGACATGGTGAACCTGTAAGG - Intronic
1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG + Exonic
1092334292 12:7614991-7615013 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1092580483 12:9835703-9835725 AGGAACATGGAGAAGGTGAAGGG + Intronic
1093644880 12:21573855-21573877 AAAGACATGGTGTAGGTGCAAGG - Intronic
1093951466 12:25167924-25167946 AGGAACATCGAGAAGGTGAAAGG - Intronic
1094655499 12:32416000-32416022 AAAGACATGGAGAGGCTGAATGG - Intronic
1094696907 12:32828797-32828819 AAGGAGATGGTTAAAGTAAAAGG + Intronic
1094723550 12:33089639-33089661 AGGAACATCGAGAAGGTGAAAGG + Intergenic
1095781652 12:46066954-46066976 AGTGGCATGGTGAAGGTGAAAGG - Intergenic
1095806135 12:46323035-46323057 AGGAACATCGAGAAGGTGAAAGG + Intergenic
1096849471 12:54426506-54426528 AAGGGATTGGTGAAGGAGAAGGG + Intergenic
1097032558 12:56100136-56100158 AAGGAAAAGGTTAAGATGAAGGG - Intronic
1099148507 12:79078255-79078277 AAGAACAGAGTGAAGGTGAGGGG - Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099896279 12:88651386-88651408 TAGGAGATGGTGTAGGTGATAGG + Intergenic
1100607208 12:96161665-96161687 AAGGGCACGGGGAAGGTGCAAGG + Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101032856 12:100677187-100677209 AAAGACATGAAGGAGGTGAAGGG - Intergenic
1102166744 12:110812994-110813016 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102192268 12:110997707-110997729 AAGGGCAGCCTGAAGGTGAAAGG - Intergenic
1102828780 12:115975323-115975345 AAAGAAATGGGGAAGGGGAAGGG + Intronic
1103371572 12:120423323-120423345 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1103537288 12:121641684-121641706 CAGGACAAGGTCAAGGGGAAGGG - Exonic
1103986258 12:124769543-124769565 AAGGGCATGGGGAAGGGGCATGG - Intergenic
1104045384 12:125158987-125159009 AAGGAGATGGTGGATGTGAGTGG - Intergenic
1104091471 12:125521314-125521336 AAGGAAAAGGAGAAGGGGAAGGG - Intronic
1104097040 12:125567402-125567424 AAGGAGATGAGGAAGGAGAAAGG - Intronic
1104577007 12:129975716-129975738 AAGGACATGAAGAACATGAAGGG + Intergenic
1105032633 12:132894731-132894753 AGGAACATCGAGAAGGTGAAAGG - Intronic
1106687821 13:32080358-32080380 AAGGTCATTGTGAAGATTAAAGG - Intronic
1106733899 13:32570142-32570164 ACAATCATGGTGAAGGTGAAGGG + Intergenic
1106771511 13:32965278-32965300 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107344053 13:39440219-39440241 AAGGACTGGGTGAAGGTGGTGGG + Intronic
1107795451 13:44046897-44046919 AAGGAGAAGGGGAAGGGGAAAGG - Intergenic
1107795460 13:44046921-44046943 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108770846 13:53699042-53699064 AATATCATGGTGAAGATGAAGGG - Intergenic
1108955137 13:56144321-56144343 AAGGACATGATGAAAATGAAAGG + Intergenic
1109257761 13:60104222-60104244 AAGGACATAGTAAAGCTGATAGG - Intronic
1109821490 13:67662645-67662667 ACGGACACGGTGATTGTGAAGGG + Intergenic
1110130569 13:72003751-72003773 TAGGATATAGTGAAAGTGAATGG + Intergenic
1110780367 13:79458786-79458808 AAGGTCATGGAGAAGATGAGAGG - Intergenic
1111888253 13:94050020-94050042 ACAATCATGGTGAAGGTGAAAGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112143077 13:96667997-96668019 AAGGACTTGGTGAATGTTAGAGG - Intronic
1112952963 13:105024223-105024245 AAGCACATGTTGAAATTGAAAGG - Intergenic
1113430773 13:110248490-110248512 CAGGACGTGATGAAGGTCAATGG - Intronic
1113797122 13:113065071-113065093 AAGGACAAGGCGAAGGTACATGG + Exonic
1115296407 14:31832235-31832257 AAAAACATGGTGTAGGTGATAGG + Intronic
1115529359 14:34312796-34312818 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115557394 14:34554300-34554322 AAGGACTTGAAGCAGGTGAAGGG + Intergenic
1116031196 14:39574738-39574760 AAAGACATGGAAAAGCTGAACGG - Intergenic
1116057660 14:39884166-39884188 AAGGACATTGTGAAAGGGAAAGG - Intergenic
1116874828 14:50100545-50100567 AAAGACATGGTGAAGATGTCTGG + Intergenic
1118386371 14:65258758-65258780 AAGGAGATTGTGAAGGACAAGGG - Intergenic
1118608142 14:67518108-67518130 AAGTACAGGGTGAAGGTGAAGGG + Intronic
1119574457 14:75706115-75706137 AAGCACATGGTGGAGAAGAAAGG - Intronic
1119648139 14:76363450-76363472 TATGACATGGAGAAGATGAAGGG - Intronic
1120281453 14:82443663-82443685 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120741223 14:88110866-88110888 AATGAAATGGTGATGGTGATTGG - Intergenic
1120899099 14:89560236-89560258 AGGGACCTGGTGGAGGTGACTGG - Intronic
1121593272 14:95137186-95137208 AAGGAAAAGGGGAAGGGGAAAGG + Intronic
1121593330 14:95137382-95137404 AAGGAAAAGGTAAAGGGGAAAGG + Intronic
1121593383 14:95137549-95137571 AAGGGAATGGAGAAGGGGAAGGG + Intronic
1121845427 14:97168371-97168393 TGGGACATGGTGAAGGACAAGGG - Intergenic
1123919169 15:25058445-25058467 GAGGACATGGTGCAGGTACATGG + Intergenic
1124099712 15:26682215-26682237 GAGGACGTTGTGAATGTGAAGGG - Intronic
1125884222 15:43216330-43216352 AAGTACAGGATGATGGTGAAGGG + Exonic
1125890125 15:43259580-43259602 AAGAAAATGTTAAAGGTGAATGG + Intronic
1127948995 15:63785786-63785808 AAGGAAAAGGGGAAGGGGAAGGG + Intronic
1128413350 15:67421260-67421282 AAAAACATGGAGTAGGTGAAAGG - Intronic
1129038561 15:72665487-72665509 GAGGCCATGGTGAAGCTGAAAGG + Intronic
1129211329 15:74071743-74071765 GAGGCCATGGTGAAGCTGAAAGG - Intronic
1129362094 15:75030364-75030386 AAGGACATGAACAAGGGGAAAGG - Intronic
1129399073 15:75269344-75269366 GAGGCCATGGTGAAGCTGAAAGG + Intronic
1129402680 15:75293620-75293642 GAGGCCATGGTGAAGCTGAAAGG + Intronic
1129949044 15:79570091-79570113 AGGGAGATGGTGTAGGAGAAAGG + Intergenic
1130005278 15:80090460-80090482 AGGGATATTGTGAAGATGAAAGG + Intronic
1130090528 15:80817086-80817108 AAAGCCATGGTGAAGGAGGAAGG + Intronic
1130829409 15:87584184-87584206 AGGGAGATGGTGGTGGTGAATGG + Intergenic
1130847688 15:87762505-87762527 CATGACTTGGTGAAGATGAAAGG + Intergenic
1131012067 15:89026499-89026521 TAGGATATGGTGATGGTGATGGG - Intergenic
1132359948 15:101203837-101203859 AAAGACAAGGTCAAGGTTAAAGG + Intronic
1133430620 16:5733920-5733942 AAGGAAATGGAGAAAATGAAGGG - Intergenic
1133464370 16:6016196-6016218 AATGACAGGGTAAAGGTAAATGG + Intergenic
1133485421 16:6214732-6214754 AAGGAGAGGGAGAAGGAGAAGGG + Intronic
1133511605 16:6463660-6463682 AATGACATGGTGAACGAGACCGG - Intronic
1133813203 16:9177273-9177295 AAGGAAATGGGAAAGGGGAAGGG - Intergenic
1133816313 16:9200010-9200032 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1134100672 16:11449453-11449475 AAGACCATGGTGATGGTGCAGGG - Intronic
1134853159 16:17498484-17498506 AAAGACAGGGACAAGGTGAAGGG + Intergenic
1135758084 16:25114696-25114718 AAGGTCAGGGTGAAGGCAAAGGG - Intronic
1136044340 16:27603405-27603427 AAGGGCATTTTGGAGGTGAAAGG + Intronic
1136110361 16:28060803-28060825 CAGGACCTGGTGAACGTTAAAGG + Intronic
1136650295 16:31663369-31663391 AAGGAAATGGAGAATGTTAACGG + Intergenic
1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG + Intronic
1138610001 16:58115366-58115388 ATGGGCATGGTGCAGATGAAGGG + Exonic
1139048110 16:63088065-63088087 AAGGTCATGCTAAAAGTGAATGG + Intergenic
1139179744 16:64732467-64732489 ATGAAGATGGAGAAGGTGAAGGG - Intergenic
1139593687 16:67946596-67946618 ATGGAAATTGAGAAGGTGAAGGG - Exonic
1141335462 16:83150848-83150870 ATGGAAATGGTTAAGGGGAAGGG - Intronic
1142806350 17:2373067-2373089 AAGGAGATGGAGCAGGTGAGGGG + Exonic
1143525065 17:7467042-7467064 CAGGTCATGGTGAAGGTCAAGGG + Intronic
1143847013 17:9779905-9779927 AATGCCAGTGTGAAGGTGAAGGG - Exonic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144438102 17:15259243-15259265 AAGGAAAAGGGGAAGGAGAAAGG + Intronic
1144806316 17:17970560-17970582 AAGGACATGGGGAAGAAGTAAGG + Intronic
1144897683 17:18554048-18554070 TAGAACGTGGTGAAGGTGAACGG - Intergenic
1145134688 17:20391671-20391693 TAGAACGTGGTGAAGCTGAATGG + Intergenic
1146672909 17:34754250-34754272 AAGGGCATGGTGACAGTGAAGGG + Intergenic
1146848407 17:36200517-36200539 AAGGCCATGGTGAGTGGGAACGG + Intronic
1147544002 17:41385236-41385258 AAAGACATGGAGTAGCTGAATGG - Intronic
1147722650 17:42548359-42548381 GAGGAGGTGGTGAAGGTGAGCGG + Intergenic
1148966165 17:51437862-51437884 AGGGAGATGGAGAAGGGGAAAGG + Intergenic
1149373800 17:56023172-56023194 AGGAAGATGGTGCAGGTGAAGGG + Intergenic
1149484121 17:57028659-57028681 ACAGTCATGGTGAAGGTGAAGGG - Intergenic
1149906692 17:60533030-60533052 AAGGAGATGGGGATGGTTAAAGG + Intergenic
1150204280 17:63389974-63389996 AAGGACAGGATGAAGGTGTCTGG - Intronic
1150633696 17:66898172-66898194 AAGGTCATGGGGGAGGTGAGAGG + Intergenic
1150638362 17:66932403-66932425 AAGGACATGGAGGTGGGGAATGG + Intergenic
1151237314 17:72730428-72730450 TATGACATGGTAAAGTTGAAAGG - Intronic
1151350650 17:73530007-73530029 ATGGACATGGGCAAGGTGGAAGG + Intronic
1151432826 17:74076129-74076151 ATGGCCATGATGATGGTGAATGG + Intergenic
1151471736 17:74322606-74322628 AAGCAAGTGGTGAAGGTGAGTGG + Intergenic
1151503517 17:74509996-74510018 AAAGACATGGAGCAGCTGAATGG - Intergenic
1152107231 17:78337756-78337778 AAGGAGAAGGGGAAGGTGACTGG - Intergenic
1153025331 18:667259-667281 ATGGAGATGGTGATGGTGATGGG + Intronic
1153205700 18:2697952-2697974 AAGGAGATGGTGTAGTGGAAGGG + Exonic
1153514610 18:5891933-5891955 AACGACGTGGTGGTGGTGAAAGG - Exonic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1155543846 18:26893956-26893978 ATGGACAGGGTTAAGGAGAAGGG + Intergenic
1156060600 18:33070510-33070532 ATGGAAAGGGTGAAGGTGTAGGG + Intronic
1156237778 18:35220746-35220768 AGGAACATTGAGAAGGTGAAAGG - Intergenic
1156510337 18:37631158-37631180 AAGGCCATGTTGATGGTGGAAGG + Intergenic
1156924832 18:42563645-42563667 GAGTACATGGTGAAGGGGAGTGG + Intergenic
1157676739 18:49574120-49574142 AAGGACCTGGAGAAAGTTAAGGG - Intronic
1158433981 18:57420372-57420394 ATGGCTGTGGTGAAGGTGAAGGG - Intergenic
1158499011 18:57983306-57983328 AGGTCCATGGTGAAGGTAAAAGG + Intergenic
1158884791 18:61816481-61816503 AAGGGCAAGGCCAAGGTGAAGGG + Exonic
1159720772 18:71887641-71887663 AAAGACCTTTTGAAGGTGAATGG + Intergenic
1160081470 18:75731309-75731331 AAGGACAGCGTGCAGGAGAAGGG - Intergenic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1162859413 19:13494857-13494879 AGGGACCTGGTGAAGGTGACTGG - Intronic
1164397207 19:27876710-27876732 CAGGACCTGGTGAAGGGGAAGGG + Intergenic
1164727418 19:30475686-30475708 AAGGACATGGAGAAGGGGCTGGG - Intronic
1165352266 19:35282265-35282287 AATGACATCGTGATGGGGAAAGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166396998 19:42448746-42448768 AGGAACACGGAGAAGGTGAAAGG + Intergenic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674944 19:44734651-44734673 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1166696630 19:44855462-44855484 AGGGACTTGGAGGAGGTGAAGGG + Intronic
1166793284 19:45410602-45410624 AGGGAGATGGGGAAGGTTAATGG - Exonic
1167702104 19:51054950-51054972 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168677177 19:58286997-58287019 AATGAAATGGAGAAGATGAAGGG - Intronic
1202697264 1_KI270712v1_random:134102-134124 ACAGACATGGTGCAGGTGAAAGG + Intergenic
927145933 2:20166555-20166577 AAGGACATCGTGAGGGAGCAGGG + Intergenic
927287480 2:21371607-21371629 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
927302410 2:21530724-21530746 AAGGAGAAGGAGAAGGCGAAGGG - Intergenic
927478568 2:23432924-23432946 AAGGGCATGGTGAGGGAGACAGG + Intronic
927866174 2:26589147-26589169 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
928134625 2:28679010-28679032 AAGAGCATGGGGAATGTGAATGG - Intergenic
928203742 2:29269295-29269317 AGGGACCTGGTGACGGTGACAGG - Intronic
928440257 2:31286191-31286213 AAGGCCAGGGTGAAGGGGCATGG + Intergenic
928778683 2:34794481-34794503 AGGAACATCGAGAAGGTGAAAGG - Intergenic
931154869 2:59616398-59616420 AGGGACCTGGTGGAGGTGACTGG - Intergenic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
932319497 2:70811268-70811290 AAGGCCAAGATGAAGGTGTATGG - Intronic
932616836 2:73237375-73237397 AAGAACCTGTTGAAGGTGATAGG + Intronic
934035484 2:88085440-88085462 AAGGAGATGGAGATGGTGACTGG + Intronic
934278433 2:91591127-91591149 ACAGACATGGTGCAGGTGAAAGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
937130902 2:119512328-119512350 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937549035 2:123063785-123063807 GAGGAGGTGGAGAAGGTGAAAGG + Intergenic
938043410 2:128095377-128095399 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
938973752 2:136456305-136456327 AAGGGGAAGGTGAAGGAGAAGGG - Intergenic
939457596 2:142458036-142458058 AAGAAAATGATGAAGATGAATGG - Intergenic
939944832 2:148396877-148396899 AAGGACATGGGCAAGGTTTAAGG - Intronic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
941234027 2:162946635-162946657 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
941318978 2:164031103-164031125 ACTGACAGGGTGAAGGTTAAGGG + Intergenic
941693301 2:168524385-168524407 AAAGACGTGGTGATTGTGAAAGG + Intronic
941810368 2:169749190-169749212 AAGGACAAGCTGAAGGATAATGG + Intronic
941884359 2:170513123-170513145 AAGGACAAGATCAAGCTGAACGG - Intronic
943788532 2:191905958-191905980 AAGAACATGAGGCAGGTGAATGG + Intergenic
943921535 2:193713263-193713285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
944526731 2:200627213-200627235 AGGGTCATGGTGAAAGTGCACGG + Intronic
944677901 2:202049415-202049437 AAGGGAAAGGTGAAGGGGAAGGG + Intergenic
946160487 2:217832787-217832809 AAGGACAGAGTGAGGGTGAAGGG - Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946669691 2:222089491-222089513 AAGGAAATGGAGAAAGTGATAGG - Intergenic
947272088 2:228347857-228347879 AAGGAAAAGGGGAAGGGGAAGGG - Intergenic
947987654 2:234462774-234462796 AATGACCTGGAGAAGATGAAAGG + Intergenic
948152368 2:235754568-235754590 AAGGACATTGTAAAAATGAATGG + Intronic
948387995 2:237593599-237593621 TATTACATGGTAAAGGTGAAGGG - Intronic
948429922 2:237912620-237912642 GAGGACAAGCTGAAGGTGATGGG - Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558565 2:238835263-238835285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558591 2:238835344-238835366 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948566728 2:238892004-238892026 AAGCACATGCTGAAGAGGAAGGG - Intronic
1168739684 20:177021-177043 AGGAACATCGAGAAGGTGAAAGG - Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1170579241 20:17685250-17685272 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172657879 20:36548085-36548107 AGGAACATGGTGAAGTTGATGGG - Exonic
1172762813 20:37333897-37333919 AAGGCCAAGGGGAAGGGGAAGGG + Intergenic
1172766325 20:37352967-37352989 AGGGACAAGGTGAAGTTCAATGG - Intronic
1173856447 20:46253336-46253358 AAGGTGAGGGTGACGGTGAAGGG + Intronic
1173891284 20:46513217-46513239 AGGCGCTTGGTGAAGGTGAAAGG - Intronic
1174936198 20:54872591-54872613 AAGGCCATCTTGAAGCTGAAGGG - Intergenic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175218288 20:57402919-57402941 AACCACATGGGGAAGGGGAAGGG - Intronic
1175252351 20:57617088-57617110 TAGGAGATGGTGAAGAGGAAGGG - Intronic
1175619431 20:60430988-60431010 AAGGACATGGTGAAGGTCGACGG - Intergenic
1175686073 20:61029749-61029771 AAGGAGATTATGAAGGTGAGAGG - Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1177114869 21:17073355-17073377 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1177207582 21:18028233-18028255 AAGGAAAAGGGGAAGGGGAAGGG - Intronic
1177646106 21:23901387-23901409 TAGGACATGGCAAAGGTGACAGG + Intergenic
1178282449 21:31295078-31295100 AAGCATATGGTGACAGTGAATGG - Intronic
1179043187 21:37823034-37823056 AAGGACATGTTGAAGAGGGAGGG + Intronic
1180859461 22:19069024-19069046 AAGGCCATGGTGCAGGGGAGAGG + Intronic
1182408347 22:30158566-30158588 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1182570661 22:31235261-31235283 AAGGATGTGGGGAAGGGGAAGGG - Intronic
1182572813 22:31251427-31251449 AAGGACTTGGATCAGGTGAATGG + Intronic
1182623685 22:31631024-31631046 AAGGCCAGGGAGAAGGGGAAGGG + Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1182973595 22:34600954-34600976 AAGGACATGGTGAAGCTGAAAGG - Intergenic
1183346792 22:37312501-37312523 AAGGACCTGGTGGAGGTGGAGGG + Intronic
1183590346 22:38776182-38776204 GAGGACGGGCTGAAGGTGAAAGG - Intronic
1184013544 22:41767895-41767917 GAGGAGATGGAGGAGGTGAAGGG + Intronic
1185331886 22:50255658-50255680 AAGGAGATCATGAAGGTGACGGG - Exonic
949097380 3:101404-101426 TAGGACAGGGTGAAGGTGAATGG - Intergenic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949872881 3:8604267-8604289 AAAGATATGCTGCAGGTGAATGG - Intergenic
950131571 3:10550804-10550826 GAGGTCATGGTGAAGGCGAAGGG + Intronic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
951397078 3:22181715-22181737 AAGAATATGGTAAAGGTGATGGG + Intronic
952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG + Intergenic
952981888 3:38742768-38742790 AAGGACATGATATAGGTGATGGG - Intronic
953465459 3:43115572-43115594 AGGTATATGGTGAAGGAGAAGGG + Intergenic
953580195 3:44146635-44146657 AATGACCAGGTGAAGGTGACAGG - Intergenic
953581037 3:44156870-44156892 AAGCGCATGGTGGAGGCGAAAGG + Intergenic
953611442 3:44450670-44450692 ATGGACCTGGCAAAGGTGAAAGG + Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954447181 3:50553102-50553124 AAAGAGAAGGTGAAGATGAAGGG + Intergenic
955401384 3:58594075-58594097 AAGAGCATAGAGAAGGTGAAAGG - Intronic
956033151 3:65061282-65061304 AAGAAATAGGTGAAGGTGAAAGG + Intergenic
956055182 3:65291082-65291104 AAGGCCATGGTGAAGGAGGGGGG - Intergenic
956089168 3:65646179-65646201 ATAGGCATGGTGAAAGTGAAAGG + Intronic
956447409 3:69339117-69339139 CAGGTCATGGTGAAGGTCCATGG + Intronic
956630487 3:71312113-71312135 AAGGGCTTGCTAAAGGTGAAGGG + Intronic
957181054 3:76877898-76877920 AAGGGCAAGGTGGAGGAGAAGGG + Intronic
957640763 3:82850316-82850338 AAGGAAAAGGGGAAGGTGAAGGG - Intergenic
957778840 3:84792326-84792348 AAGGACATAGAGTAGCTGAATGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958783119 3:98566489-98566511 AAAGACAAGGTGGAGGTTAAAGG + Intronic
959096254 3:101959217-101959239 AAGGACATGGGGAAGGTCGGGGG + Intergenic
959240909 3:103792500-103792522 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
959434524 3:106298080-106298102 ATGGACCTGGTGGAGGTGATTGG + Intergenic
959469385 3:106731097-106731119 AATGAGATGATGAGGGTGAAAGG + Intergenic
960009599 3:112819171-112819193 AGGGACTTGGTGTAGGTGATTGG - Intronic
961285938 3:125803227-125803249 ATGGACGTGGTGAAAGAGAACGG + Intergenic
961679992 3:128593467-128593489 ACAGAAATGGTGAAGGTAAAAGG + Intergenic
961708544 3:128808763-128808785 AAGCACATGGTGGCTGTGAAGGG + Intronic
962082584 3:132156286-132156308 CAGAACATGGTGAATATGAAGGG - Intronic
962563479 3:136633077-136633099 CAGGGCATGGGGGAGGTGAAAGG + Intronic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963320409 3:143804102-143804124 AGGAACATCGAGAAGGTGAAAGG - Intronic
964552938 3:157904963-157904985 AAGGAAAGGTTGAAGGTCAAAGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965018136 3:163187304-163187326 AAGGACATGGTTGAACTGAATGG + Intergenic
965141747 3:164846305-164846327 AAGAGCATGGTGAGGGTGAATGG - Intergenic
965447738 3:168796634-168796656 AAACACATGATGAAGCTGAAAGG - Intergenic
965625862 3:170683609-170683631 AGGAACATCGAGAAGGTGAAAGG + Intronic
966067468 3:175834393-175834415 AGGAACATCGAGAAGGTGAAAGG - Intergenic
966847553 3:184142357-184142379 AAGGACAAAGTGAAGATGAAAGG + Exonic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967148225 3:186624843-186624865 AACGACAAGGTGAAGGTGGAGGG + Intergenic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967709934 3:192695266-192695288 AAAGTCATGGGCAAGGTGAAAGG - Intronic
968135629 3:196217639-196217661 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
968473577 4:792578-792600 AAGGACATGGGGAAGATGCTGGG - Exonic
968769320 4:2493802-2493824 AAGGACATTGTCAAAGAGAATGG + Intronic
968874543 4:3258528-3258550 AAGGACATGCTGCTGATGAAAGG - Intronic
969032321 4:4225241-4225263 ACAGACATGGTGCAGGTGAAAGG - Intronic
969208814 4:5670660-5670682 ATGGCCATGGTGAAGGTGATTGG - Intronic
970670408 4:18390314-18390336 ATGGACATGGTGATAGTGACTGG + Intergenic
971026485 4:22593819-22593841 ACGGACAGGGTTAAGGAGAAGGG + Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
971305120 4:25473301-25473323 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
971723827 4:30282551-30282573 AGAGACATGATGAAGATGAAGGG - Intergenic
972153741 4:36129926-36129948 AAGAACATGGTGGGGGTGGAAGG - Intronic
973715470 4:53671333-53671355 AAGGAGCTGGAAAAGGTGAAAGG - Intronic
973953095 4:56037362-56037384 AGGGACCTGGTGGAGGTGATTGG - Intergenic
974214953 4:58832991-58833013 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
974608626 4:64185475-64185497 AGGGGCATGGTGGAGGTGATTGG - Intergenic
974689697 4:65280869-65280891 AAGGCAAGGGTGAAGGTGAGTGG + Intergenic
975362362 4:73485704-73485726 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
975930187 4:79512121-79512143 AAGGACACAGTGAAAGAGAAAGG + Intergenic
976164418 4:82238963-82238985 AAGAACAAGTTGGAGGTGAAGGG + Intergenic
976239662 4:82941691-82941713 AGAGACCTGGTGTAGGTGAAAGG + Intronic
978333499 4:107641349-107641371 AAGGACAGGGTGGAGGTAAGTGG - Intronic
978549516 4:109910370-109910392 AAGGACATAGAGAAGGAGAAGGG - Intergenic
979336398 4:119468174-119468196 AAAGACTTGGTGAAGGAGATGGG - Intergenic
982296614 4:153835587-153835609 AATGACATGGTCCAGGGGAAGGG - Intergenic
983225532 4:165082595-165082617 AAGGATCTGGGGAGGGTGAAGGG + Intronic
983239305 4:165213516-165213538 AAAGACTTGGTGAAGGAGATGGG - Intronic
983332102 4:166343582-166343604 AAGGACAATTTGAAGGTTAAAGG - Intergenic
984070309 4:175103264-175103286 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
984164968 4:176295797-176295819 AGGAACATCGAGAAGGTGAAAGG + Intergenic
984625443 4:182002382-182002404 GAGGAAATGGGGAAGGTGCAAGG - Intergenic
984725159 4:183013444-183013466 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
987168707 5:15229355-15229377 AAGCATATGTTGAAAGTGAAAGG - Intergenic
988002736 5:25369271-25369293 AAAGACATGGAGTAGATGAAGGG + Intergenic
988070201 5:26277952-26277974 AGGGACCTGGTGGAGGTGATTGG + Intergenic
988131828 5:27116384-27116406 AAGGACAGGGTGAAGTTCAGTGG + Intronic
988410208 5:30877069-30877091 AAGGGCATGATGAAGGAGATGGG - Intergenic
989479056 5:41907077-41907099 CAGGAGATGGTGAAGGCGGAGGG + Intronic
989815039 5:45725592-45725614 AAGCACATTGTGAAGATGATAGG + Intergenic
990771012 5:59245230-59245252 AAGGACATGTTGGAAGTGACAGG + Intronic
992167311 5:74067466-74067488 AAGGACAGGGTGACAGGGAAGGG - Intergenic
993810777 5:92473222-92473244 AAGTTTATGGTGAAAGTGAAAGG - Intergenic
993958918 5:94272209-94272231 AGGGACATGGGGATGGTTAATGG + Intronic
994121366 5:96117381-96117403 ACGGACATGGTTAACGTGACAGG - Intergenic
994165218 5:96601097-96601119 AAGGAGATGTTGAAGGAGAGAGG - Intronic
994737626 5:103575131-103575153 AAGGCAAAGGTGAAGGTGAAGGG - Intergenic
995000368 5:107120579-107120601 AAGGACAGGGCAAAAGTGAATGG + Intergenic
995294178 5:110499576-110499598 AAAGACATAGATAAGGTGAAAGG + Intronic
996277378 5:121683359-121683381 AAGGACACTATGAATGTGAAGGG - Intergenic
996980588 5:129488745-129488767 AATGACATGGTGGAAGTGAAAGG + Intronic
997465699 5:134086695-134086717 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
997549190 5:134737640-134737662 AAAAACAAGGTGAAGGGGAATGG + Intergenic
998639640 5:143995195-143995217 AAGGACATGCTGCTGGTGAGTGG + Intergenic
999272518 5:150304955-150304977 AAGCACTTGGTGAATGTGAATGG + Intronic
999970312 5:156853842-156853864 AAAGACATGGAGTAGCTGAATGG + Intergenic
1000522711 5:162318006-162318028 ACAATCATGGTGAAGGTGAAAGG - Intergenic
1001071606 5:168590130-168590152 AAGCCCATGGTGATGGAGAATGG + Intergenic
1001719475 5:173844988-173845010 AGGGGCATGGTGGACGTGAATGG - Intergenic
1001791061 5:174458504-174458526 AAGGAGATGGGGAAGGAGATGGG - Intergenic
1001960705 5:175878916-175878938 AAGGACATGGGGAAGATGCTGGG + Exonic
1003114912 6:3277279-3277301 AAGGCCAGGGTGGAGGAGAAGGG - Intronic
1003565340 6:7217350-7217372 AAGGAAATGGTCAAGCTGAGTGG + Intronic
1003852155 6:10236241-10236263 AAGGACTTGGTGAAACTGTACGG + Intergenic
1004579464 6:16934912-16934934 AAGGACAGGTTTAAGCTGAAAGG + Intergenic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005437499 6:25830730-25830752 AAGCACATAATGGAGGTGAATGG - Intronic
1005519264 6:26584341-26584363 ATTGACATGGTGAAGGTCAGGGG + Intergenic
1005682161 6:28218140-28218162 GAGTCCATGGTGAAGGTGATGGG + Intergenic
1006175173 6:32117126-32117148 AAGGACTTGGAGAGGGTGAAGGG + Intronic
1006184750 6:32175521-32175543 AAGGAATTGGGGAAGGTGTAGGG + Intronic
1006210485 6:32389461-32389483 ATGGACATGGTGGATGAGAAGGG + Intergenic
1006567766 6:34974211-34974233 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1006618447 6:35345581-35345603 AAGGCCATGGTGAAGAGGCAAGG - Intronic
1007236256 6:40392957-40392979 AAGGACAGGGTGATGGGGAGTGG + Intronic
1007296008 6:40821048-40821070 AAGGACATCATGAAGCTGGAAGG + Intergenic
1007300323 6:40863166-40863188 AGGAACATTGAGAAGGTGAAAGG + Intergenic
1007381862 6:41495301-41495323 AAGGTCATGGGGAAGTTCAAGGG - Intergenic
1007610957 6:43148485-43148507 AAGGACAGGATGTAGTTGAATGG + Intronic
1007679866 6:43626559-43626581 AAGGATATGGTTCAGGTTAAGGG - Intronic
1008111245 6:47497356-47497378 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1008150304 6:47942089-47942111 AAGCACATGAACAAGGTGAATGG - Intronic
1008280519 6:49590396-49590418 TAGAAAATGGTGAAGGTTAAAGG - Intergenic
1008656620 6:53620342-53620364 AAGGAGATTGAGAAAGTGAATGG + Intergenic
1008768378 6:54948074-54948096 AAGAGCATGGAGCAGGTGAAAGG + Intergenic
1009323630 6:62322312-62322334 AAGGAAATGGTAAAGTTTAAAGG - Intergenic
1009373301 6:62936128-62936150 AAGGACATAGGGTAGCTGAATGG - Intergenic
1009562929 6:65272335-65272357 AGGGACAAGGTCAAGGTCAAGGG - Intronic
1011404271 6:87001354-87001376 AAAGACATAGAGTAGGTGAACGG + Intronic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1015678611 6:135779520-135779542 AAAGAGATGATGAAGTTGAAAGG - Intergenic
1015997885 6:139013621-139013643 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1016169081 6:140986523-140986545 AAGGTGATGGAAAAGGTGAAGGG - Intergenic
1016709760 6:147156307-147156329 AAAGCCATGGTGAAAGAGAAAGG - Intergenic
1017339565 6:153305195-153305217 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1018041148 6:159923126-159923148 ACAATCATGGTGAAGGTGAAAGG - Intergenic
1018552042 6:165008647-165008669 AAGGCCAGGGTGAAGGGGAGAGG + Intergenic
1019403417 7:869065-869087 AAAGAAAAGGTGAAGGTCAATGG - Intronic
1020766826 7:12332307-12332329 AAGGCCATGGGGAAGGAAAAGGG - Intronic
1021322149 7:19225705-19225727 ATGCACATGGTGAAGGGGATTGG + Intergenic
1021919800 7:25473435-25473457 AAGGACTTGGGGGAGGTGCAAGG + Intergenic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022274426 7:28841823-28841845 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022357055 7:29625792-29625814 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022608574 7:31843445-31843467 AAGGATATTGTGAAAGAGAAAGG - Intronic
1022896006 7:34751071-34751093 AAGGACATGGTGAAGGTAAAGGG - Intronic
1023547645 7:41335689-41335711 TAGGACATGGCAAAGGTGATTGG - Intergenic
1023908914 7:44540431-44540453 AAGGACATGGAGCAGGGGCAGGG + Intronic
1023982482 7:45078103-45078125 GAGGACATGGAGCAGATGAAGGG + Intergenic
1024134694 7:46394307-46394329 AAGGAGAAGGTGAAGGCCAACGG + Intergenic
1024257613 7:47550167-47550189 AAGGGCAGGGTGAGGGTGCAGGG - Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1025107406 7:56183433-56183455 AAGGAAATGGACGAGGTGAAGGG + Intergenic
1025207150 7:57000456-57000478 AAGGACATGAAGAATGGGAAAGG - Intergenic
1025664786 7:63576434-63576456 AAGGACATGAAGAATGGGAAAGG + Intergenic
1026156167 7:67827576-67827598 AAGGTCAAGGTCAAGTTGAAGGG + Intergenic
1026241727 7:68581429-68581451 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1026979757 7:74519437-74519459 AAGGCCCTGGTGGAGCTGAACGG + Exonic
1027297828 7:76796266-76796288 AAGGACTTGGAGGAGGAGAATGG - Intergenic
1027462358 7:78470537-78470559 AAGGAAATGGTGAACGAAAAAGG - Intronic
1027626712 7:80553806-80553828 AGGGACCTGGTGGAGGTGATTGG + Intronic
1028112531 7:86959362-86959384 ATAGAAGTGGTGAAGGTGAACGG + Intronic
1028985056 7:97003027-97003049 AAGCACAGGGTGAGGGTGTAGGG + Intergenic
1029451959 7:100646463-100646485 AAGGACATGGGAAGGATGAAGGG + Intronic
1029521576 7:101066208-101066230 AAGGACAGGGTGAATGTAACAGG - Intergenic
1029686340 7:102150704-102150726 AAGGACATGGTCAAGGTCGATGG - Intronic
1030379577 7:108797109-108797131 AAGGACATTTTGTTGGTGAATGG + Intergenic
1031098493 7:117448957-117448979 AAGCAGATGGGGAAGGTAAAGGG + Intergenic
1031650615 7:124285075-124285097 ACAATCATGGTGAAGGTGAAAGG - Intergenic
1031865992 7:127039630-127039652 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1031866087 7:127039898-127039920 AAGGTGAGGGGGAAGGTGAAGGG + Intronic
1032256025 7:130297705-130297727 AAGGACCTGTTGAGAGTGAATGG - Intronic
1032513697 7:132491833-132491855 AAGGAGATGGGGAAGGAGACAGG + Intronic
1033215122 7:139487739-139487761 AAGGTGAAGGTGAAGGTGAAGGG + Intergenic
1033804324 7:144937416-144937438 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1035302452 7:157906429-157906451 AACGACATGGGGAAAGAGAATGG - Intronic
1036599182 8:10243338-10243360 AAGGACAAGCTGTAGGTGAGTGG - Intronic
1036718041 8:11144894-11144916 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1036793976 8:11742403-11742425 AAGGACATTGTGAAAGGGAAAGG - Intronic
1037838788 8:22229893-22229915 AAGTACAGGGTGAAGGCTAAAGG + Intronic
1038129051 8:24708537-24708559 AGGGACCTGGTGGAGGTGATTGG - Intergenic
1038349402 8:26762608-26762630 AAGGAGATGGGAAAGATGAAAGG + Intronic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041288352 8:56283699-56283721 AAGCAAATTGTGAAGGTCAAAGG - Intergenic
1042273629 8:66980710-66980732 AAGGACATAGTGAAGGGGCTAGG - Intronic
1042892938 8:73633461-73633483 AAGGACAAGTTCAAAGTGAAAGG + Intronic
1044138978 8:88624471-88624493 AAGGAAATGGTAAAGGAGTAGGG - Intergenic
1044728540 8:95212461-95212483 AAGGAGAAGGAGAAGGTGATGGG + Intergenic
1044878217 8:96694312-96694334 AAGGACATGGAGTAACTGAATGG + Intronic
1045242290 8:100413168-100413190 AAAGACATGGGGAAGTTGTACGG - Intergenic
1046839002 8:118837056-118837078 AAGTATATGGTGGAGGTGAAAGG + Intergenic
1047523724 8:125615286-125615308 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1048430311 8:134364434-134364456 AAGCAGATGGTGTATGTGAAGGG + Intergenic
1049667947 8:143856315-143856337 AAAGACAAGGTAAAGGTAAAAGG + Intergenic
1050358550 9:4805396-4805418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1050447844 9:5745266-5745288 AAGAAAATGGTGAAGGGGCAGGG - Intronic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1051886572 9:21899396-21899418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1052394505 9:27922521-27922543 TAGGACAAGGTGATGGTAAATGG + Intergenic
1052976789 9:34417051-34417073 AAGGAGAAGGGGAAGGGGAAAGG - Intronic
1053302237 9:36960454-36960476 AGGGACATGGGGACGGTGAAGGG + Intronic
1054749136 9:68886737-68886759 AAGGACAAGGGGAAGATGTAGGG - Intronic
1055347337 9:75352716-75352738 AGGGACATTGAGAAGGTGAAAGG + Intergenic
1057448162 9:95133599-95133621 AAGGACATGGAGAAGGTTCAGGG + Intronic
1057719907 9:97523674-97523696 AATGAGATGGTGTAGGTGAGGGG + Intronic
1058395668 9:104551129-104551151 AAGGAAATGCTGAATTTGAATGG + Intergenic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1059042065 9:110825889-110825911 AAGGACTTGGATAAAGTGAAGGG - Intergenic
1059234155 9:112748178-112748200 CAGGAAATGGTGAATATGAATGG + Intergenic
1059632469 9:116139375-116139397 CAGGACTTGGTGACGGTGGAGGG - Intergenic
1060844356 9:126823881-126823903 AATGACAACATGAAGGTGAAGGG - Intronic
1061009410 9:127946259-127946281 AGGGACATGGTGAGGGCGAGCGG + Intronic
1061063684 9:128264172-128264194 AAGGACTTGGTAAGGGTGGAAGG + Intronic
1061099894 9:128484616-128484638 AAGCAGAGGGTGAAGGAGAAAGG - Intronic
1061731418 9:132617303-132617325 AAGGAGATGGGGGAGGTGAAGGG - Intronic
1185456683 X:314273-314295 GAGGTCGAGGTGAAGGTGAAGGG + Intronic
1185584182 X:1232968-1232990 AGGGGCATGGTGAATGAGAAGGG + Intergenic
1186111607 X:6263352-6263374 AAAAACATGGCAAAGGTGAAGGG - Intergenic
1186171111 X:6877901-6877923 AATGCCATGGGGGAGGTGAAGGG + Intergenic
1186439720 X:9575255-9575277 AGGGACCTGGTGGAGGTGATTGG - Intronic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1188200295 X:27288029-27288051 AGGAACATTGAGAAGGTGAAAGG + Intergenic
1188438787 X:30193816-30193838 AAGAAGTTGGTGAAGGTGAGTGG - Intergenic
1189009680 X:37034777-37034799 AAGGAAATGGGGCAGGGGAAGGG - Intergenic
1189142348 X:38620036-38620058 AGGGACATGGCGAGGGTGGATGG + Intronic
1189392835 X:40591288-40591310 ACCGTCATGGTGATGGTGAAGGG + Exonic
1189436595 X:40998303-40998325 AAGTACTTGGTGAAGGTCAGTGG - Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1189684401 X:43548820-43548842 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1189822556 X:44884356-44884378 AAGGATATGGTGTAAGGGAAAGG + Intronic
1190561953 X:51694986-51695008 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1192448953 X:71230885-71230907 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1192796798 X:74430334-74430356 TAAGACATAGTGAAGGTGTAGGG + Intronic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196226832 X:113177720-113177742 AGGAACATCGAGAAGGTGAAAGG + Intergenic
1196525090 X:116721885-116721907 AGGAACATTGAGAAGGTGAAAGG + Intergenic
1196755892 X:119156706-119156728 AGGGACATGGTGGTGGTGAAGGG - Intergenic
1197457142 X:126691115-126691137 AAGAACATGAAGAAGGAGAAGGG + Intergenic
1197918605 X:131563405-131563427 AAGGGCAGGGGCAAGGTGAAGGG - Intergenic
1198191037 X:134306157-134306179 AAGGAGATGGGGATGGTTAATGG + Intergenic
1199040332 X:143107615-143107637 AAGGAGATGGGGATGGTTAATGG + Intergenic
1199463619 X:148111501-148111523 AAGGAAATGTTGAAGGTGGTTGG - Intergenic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200386476 X:155896008-155896030 AAGGACTGGGGGAGGGTGAATGG - Intronic
1200835206 Y:7725829-7725851 CATGCGATGGTGAAGGTGAAAGG - Intergenic