ID: 1092193715

View in Genome Browser
Species Human (GRCh38)
Location 12:6536897-6536919
Sequence CTATGGGGGTGGGGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1442
Summary {0: 1, 1: 7, 2: 10, 3: 127, 4: 1297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092193715_1092193727 2 Left 1092193715 12:6536897-6536919 CCATCTCCCCCCCACCCCCATAG 0: 1
1: 7
2: 10
3: 127
4: 1297
Right 1092193727 12:6536922-6536944 GAGATCCCTCCAAAATCAAGTGG 0: 2
1: 6
2: 12
3: 16
4: 134
1092193715_1092193733 13 Left 1092193715 12:6536897-6536919 CCATCTCCCCCCCACCCCCATAG 0: 1
1: 7
2: 10
3: 127
4: 1297
Right 1092193733 12:6536933-6536955 AAAATCAAGTGGGGCGATGCTGG 0: 3
1: 3
2: 7
3: 18
4: 82
1092193715_1092193729 4 Left 1092193715 12:6536897-6536919 CCATCTCCCCCCCACCCCCATAG 0: 1
1: 7
2: 10
3: 127
4: 1297
Right 1092193729 12:6536924-6536946 GATCCCTCCAAAATCAAGTGGGG 0: 3
1: 9
2: 9
3: 16
4: 191
1092193715_1092193734 30 Left 1092193715 12:6536897-6536919 CCATCTCCCCCCCACCCCCATAG 0: 1
1: 7
2: 10
3: 127
4: 1297
Right 1092193734 12:6536950-6536972 TGCTGGCGCTGAGTACGTCGTGG 0: 1
1: 2
2: 4
3: 4
4: 52
1092193715_1092193728 3 Left 1092193715 12:6536897-6536919 CCATCTCCCCCCCACCCCCATAG 0: 1
1: 7
2: 10
3: 127
4: 1297
Right 1092193728 12:6536923-6536945 AGATCCCTCCAAAATCAAGTGGG 0: 3
1: 8
2: 14
3: 32
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092193715 Original CRISPR CTATGGGGGTGGGGGGGAGA TGG (reversed) Intronic
900124273 1:1062594-1062616 GGATGGGGGTCGGGGGGAGGAGG - Intergenic
900292471 1:1929338-1929360 GTATGGGGTTGGGGGTGACATGG + Intronic
900306356 1:2010799-2010821 CTTAGGGGGTGGGGGGCACAGGG - Intergenic
900313865 1:2047715-2047737 CTCTGGGGTTGGGAGGGAGAGGG - Intergenic
900318502 1:2070916-2070938 CTATGAGGGCGGGAGGCAGACGG - Intronic
900436848 1:2634991-2635013 CTATGTGGGTGTTGGGGGGATGG - Intergenic
900464250 1:2816738-2816760 TTTTGGGGGTGGGGAAGAGATGG + Intergenic
900578194 1:3394467-3394489 CGACGGGGGTGGGGTGGAGAGGG + Intronic
900659174 1:3774343-3774365 CTAAGGGGGTGTGGGGGTGGAGG - Intronic
901087922 1:6622899-6622921 TTCTGGGGCTGGGAGGGAGAGGG + Exonic
901167265 1:7229543-7229565 GGATGGGGATGGGGTGGAGAGGG + Intronic
901193402 1:7425881-7425903 CTATGGGGGCAGGGAGAAGATGG - Intronic
901311163 1:8270625-8270647 CGCTGGGGGTGGGGTCGAGAAGG + Intergenic
901442849 1:9290067-9290089 GTGTGGGGGTGGGGTGGAGTTGG + Intergenic
902029491 1:13411329-13411351 TTTTGGCGGTGGGGGGGAGGGGG - Intronic
902332077 1:15735598-15735620 CAGTGGGGGTGGGGGCGAGCAGG + Intergenic
902395533 1:16130486-16130508 CTATGGAGGTGGGCAGGGGAGGG + Intronic
902419573 1:16268117-16268139 TAATGGGGGTGGGGGGCATAGGG + Intronic
902491933 1:16789219-16789241 CTATGGGGATTGGGGGCAGGAGG - Intronic
902644849 1:17791019-17791041 CTATGAGGGTTGGGGGGAGGGGG + Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902789444 1:18756713-18756735 GTGTGGGGGTGAGGGGTAGATGG + Intergenic
902964727 1:19991655-19991677 TTTTGGGGGTTGGGGGGAAAGGG - Intergenic
903435076 1:23343755-23343777 GGATGGGGGTGGGGGGCGGAAGG - Intronic
903866058 1:26398700-26398722 GTATGGGGGTGTGGGGGGCAGGG + Intergenic
903868128 1:26412737-26412759 CTTTGGGGGAGGGGTAGAGAAGG + Intronic
904043447 1:27597139-27597161 GTATGGGGGTGGGGGGCAGGTGG + Intronic
904260031 1:29283096-29283118 CTATGGGGGTGGGCTGTAGGAGG - Intronic
904463730 1:30695624-30695646 CTCTGGGGGTGGGTGGGGGTGGG - Intergenic
904814202 1:33182808-33182830 TGTTGGGGGTGGGGTGGAGAAGG + Intergenic
904831229 1:33307729-33307751 GGGTGGGGGTGGGGGGGAGGTGG - Intronic
904922140 1:34016301-34016323 CTATTGGGGGTGGGGGGAAAGGG - Intronic
904940445 1:34162291-34162313 CTAAAGGGGTTGAGGGGAGAAGG + Intronic
905212427 1:36383930-36383952 CCTTGGGGGTGGGGTGGGGACGG - Intronic
905223699 1:36466201-36466223 CTATGGAGATTGGGAGGAGAGGG + Exonic
905292965 1:36935527-36935549 AGATGGGGGAGGGGAGGAGAAGG - Intronic
905743167 1:40389916-40389938 GTCTGGGGGTGGGCGGGGGAGGG - Intronic
905775303 1:40664349-40664371 CTATGGTGGGGTGGGGGAGATGG + Intronic
905873244 1:41416728-41416750 CCAGGGGGGCGGGGGGCAGAGGG - Intergenic
905897392 1:41557669-41557691 CTCCAGGGGTGGGGGGCAGAGGG + Intronic
905898134 1:41562339-41562361 GTCTGGGGGTGGGGCTGAGAGGG + Intronic
906257981 1:44365329-44365351 CTATGGGGATGGGGTTGAGGTGG - Intergenic
906323988 1:44832932-44832954 CTGTGTTGGTGTGGGGGAGAGGG + Intronic
906492728 1:46280594-46280616 CTATGGGAGTGAGGTAGAGATGG - Intronic
906706693 1:47900152-47900174 CTGAGGGGGTGTGGGGGAGGAGG + Intronic
907080523 1:51617383-51617405 CAATGAGGGTGAGGGAGAGAGGG + Intronic
907121596 1:52012798-52012820 CATTGGGGATGGGGGTGAGAAGG - Intergenic
907438386 1:54463730-54463752 GAATGGGGGTGGGGTGGAGGTGG + Intergenic
907679554 1:56550716-56550738 GTGTGGGGGTGGGTGGGAGGAGG - Intronic
907771773 1:57472647-57472669 CTAAGGGGGTGCGCGTGAGAGGG - Intronic
907822013 1:57979408-57979430 CTATGGGGGATGGGGGGCTAGGG + Intronic
907999372 1:59665610-59665632 TTAGGGGGGTTGGGGGTAGAGGG - Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908245058 1:62221345-62221367 CCATAAGGGTGGGGTGGAGAAGG - Intergenic
908253433 1:62283240-62283262 TTACAGGGGTGGGAGGGAGAGGG - Intronic
908558216 1:65279198-65279220 CTTTGGGGGAGGGGCGGTGATGG + Intronic
908669853 1:66533976-66533998 CGATGGGGGTGGAGGGGAATGGG + Intronic
908838763 1:68256846-68256868 CTAAGGGGGTGTGCGTGAGAGGG - Intergenic
909180710 1:72420335-72420357 CTGTGGTGGGGGGAGGGAGAGGG - Intergenic
909717362 1:78725397-78725419 TTTTGGGGGTGGGGGGGTGGGGG + Intergenic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910269421 1:85377705-85377727 GTATGGGGGTGGGGGGATGAGGG - Intronic
910429531 1:87147339-87147361 GGTTGGGGGTGGGGGGGAGGTGG + Intronic
910468190 1:87522985-87523007 CTTTGGATGTGGGGGGGAGTGGG + Intergenic
910496389 1:87833469-87833491 ATACGGGGGTGGGGGGAAAAAGG + Intergenic
910852502 1:91662600-91662622 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
910853405 1:91670437-91670459 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
911087156 1:93988600-93988622 CAATGGGTGTGGGGGGGGGGGGG + Intergenic
911433842 1:97829893-97829915 GTCTGGGGGTGGGGGGCTGAGGG - Intronic
911550176 1:99269072-99269094 CTGTGGGGGTTGGGGGGCTAGGG - Intronic
912409976 1:109474337-109474359 TTTTGGCGGTGGGCGGGAGAGGG + Intronic
912457207 1:109806186-109806208 CTTTGGGGGTAGGGGTGTGAGGG - Intergenic
912710983 1:111949650-111949672 ATATGAGGGTGGGAGGGGGAAGG - Intronic
913223868 1:116681388-116681410 ATTTGGGGGTGGGGATGAGATGG + Intergenic
913444298 1:118933445-118933467 TTTTGTGGGTGGGGGGCAGAGGG - Intronic
913975542 1:143451742-143451764 CTCTGGGGGTGGGGGGGGTGGGG - Intergenic
914069936 1:144277359-144277381 CTCTGGGGGTGGGGGGGGGTGGG - Intergenic
914109219 1:144688995-144689017 CTCTGGGGGTGGGGGGGGGTGGG + Intergenic
914200250 1:145478106-145478128 ATAGGGGGGTGGGGGGCAAAGGG - Intergenic
914479365 1:148051258-148051280 ATAGGGGGGTGGGGGGCAAAGGG - Intergenic
915040984 1:152968051-152968073 CTGTTGTGGTGGGGGGGAGGGGG + Intergenic
915337154 1:155151430-155151452 TTGGGGGGGTGGGGGAGAGAGGG - Intergenic
915460895 1:156070086-156070108 GTATGGGGGGGTTGGGGAGAAGG + Intronic
915461918 1:156075580-156075602 CTTTGGAGGAGTGGGGGAGAGGG + Exonic
915621299 1:157086556-157086578 GGATGGGGGTGGGGAGGAGTAGG - Intergenic
915660178 1:157399093-157399115 CTAAGGGGGTGTGTGTGAGAGGG + Intergenic
915725586 1:158014677-158014699 TTATGGGGGGGGGGGGGCGGGGG + Intronic
916043732 1:160982543-160982565 CTAAGGGGGTGCGTGTGAGAGGG + Intergenic
916147044 1:161749585-161749607 CTTTGGGGGTAGGGGTCAGAGGG + Intergenic
916193563 1:162202000-162202022 CTATGGGGGTGGTGGAGAAACGG + Intronic
916336219 1:163673680-163673702 TGATGGGGGTGGCAGGGAGAGGG + Intergenic
916585151 1:166143714-166143736 CTAAGGAAGTGGGGTGGAGAGGG + Intronic
916785316 1:168082883-168082905 AGAAGGGGGTGTGGGGGAGAAGG - Exonic
916884339 1:169052532-169052554 CTAAGGGGGTGCGCGTGAGAGGG - Intergenic
916896544 1:169169201-169169223 GTCAGGGGGTGGGGGGGATAGGG + Intronic
917199060 1:172496492-172496514 CTAAGGGGGTGCGTGTGAGAGGG - Intergenic
917896676 1:179496812-179496834 CTACGGGGGTATGGGGGAGGAGG - Intronic
917908854 1:179618911-179618933 CTATTGGGATGAGGGGAAGAAGG - Intronic
918077881 1:181184067-181184089 CTATAGGGGTGGGGCTGGGATGG + Intergenic
918347999 1:183623519-183623541 ACATTGGGGTGAGGGGGAGAGGG + Intronic
919780170 1:201216345-201216367 GGATGGGGGTGGGGGGGAGTCGG + Intronic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
920312797 1:205058382-205058404 CTTTGGGGGAGGGGGAGAGGGGG + Intronic
920401375 1:205678941-205678963 CTATTGGGGTGGGAGTGGGAGGG - Intronic
920432404 1:205927457-205927479 CTAGGGGAGTTGGGGGGAGGTGG - Intronic
920528229 1:206684509-206684531 TCGTGGGGGTGGGGGGGAGCTGG - Intergenic
920663199 1:207936992-207937014 CTTTGGGGGTGTGGTGGAGTAGG - Intergenic
920769030 1:208863023-208863045 CTCTGGGGGTTCGGGGAAGAAGG + Intergenic
920867815 1:209767979-209768001 CTAGGGGGTTGGTGGGGAGGAGG - Intronic
920983175 1:210857450-210857472 GCATGGGGGTGGGGGTGAGGGGG + Intronic
921074300 1:211687330-211687352 CTAAGGGGGTGCGTGTGAGAGGG - Intergenic
921498890 1:215875987-215876009 CTATGGAGGGGGCGGGGGGAAGG + Intronic
921627727 1:217396531-217396553 ATTTGGGGGTGGGGAGGAGAGGG - Intergenic
921869862 1:220128239-220128261 ATATGGGGGTGGGGGGCTGGGGG + Intronic
921875028 1:220186221-220186243 CTATGGGGGTGGGGAGAGGGAGG - Intronic
921881568 1:220260589-220260611 CTGTTGGGGTGGTGGGGGGAGGG + Intronic
921939841 1:220828116-220828138 GTATGGGGGTGGGGGGCAGCTGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
921974842 1:221191282-221191304 GTATGGGGGTGGGGGGTGGGGGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922741291 1:228015701-228015723 CGGCGGGGGTGGGGGGGAGGCGG - Intronic
922894895 1:229092273-229092295 CTTTGGGGGTGGGTAGGGGAAGG + Intergenic
922934263 1:229411445-229411467 ATGAAGGGGTGGGGGGGAGAAGG - Intergenic
923019968 1:230155571-230155593 CTTTGGGGCTGGGAGGGACAGGG + Intronic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923405394 1:233654192-233654214 CCATCGGGGTGGGGGGGAAAGGG + Intronic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
923528513 1:234793320-234793342 CTATGGGGATTGGGGGCAGGAGG + Intergenic
923762553 1:236860075-236860097 CTATGGTGGGGGGGGGGGGGGGG - Intronic
923886687 1:238165021-238165043 GTTTGGGGTTGGGGGAGAGATGG + Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924425206 1:243944259-243944281 CTAGGGGGATGGGGTGGAGGAGG - Intergenic
924560888 1:245155892-245155914 CTATGGGGGGGGTAGGGGGAGGG - Intronic
924858597 1:247898480-247898502 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
924859412 1:247905583-247905605 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
1062982893 10:1740130-1740152 CTATAGGGGTCGGGGGGAGACGG + Intergenic
1063326445 10:5108130-5108152 CTATGGGGGAGGTTAGGAGAAGG + Intronic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063671773 10:8104948-8104970 CGATGGGGGTGAGGGTGAGAGGG - Intergenic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064731253 10:18332976-18332998 CTATGGGGTTGGGGAGTAAAGGG + Intronic
1065534006 10:26700249-26700271 CAAGCGGGGTGGGGGGGAGGGGG - Intronic
1065625659 10:27626009-27626031 GCATGGGGCTGGGGAGGAGAGGG + Intergenic
1065917354 10:30364922-30364944 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1066352801 10:34652367-34652389 ATATGGGTGTGATGGGGAGAGGG + Intronic
1067105131 10:43361459-43361481 CTGGGGGGGCGGGGGGGACAGGG + Intergenic
1067711834 10:48656262-48656284 CTCTGGGGGGGGGGGGGCGGGGG + Intronic
1067741183 10:48897109-48897131 GTATGAGGGTCGGGGTGAGAAGG - Intronic
1067809797 10:49417895-49417917 CCTGGTGGGTGGGGGGGAGATGG - Intergenic
1067893732 10:50157664-50157686 GTTTTGGGGTGGGGGGAAGAGGG + Intergenic
1068072455 10:52212585-52212607 ATATGGCTGTTGGGGGGAGAGGG + Intronic
1068955083 10:62814524-62814546 CTATGTGAGCGGGGGTGAGAAGG - Intronic
1069086862 10:64150669-64150691 CTATGGGAGTGGTGTGGAGATGG + Intergenic
1069346463 10:67476424-67476446 GTCTGGGAGTGGGGTGGAGAGGG - Intronic
1069380255 10:67836192-67836214 CTGTCGGGGGGTGGGGGAGAAGG + Intronic
1069793977 10:71040772-71040794 ACATGGGGGTGTGGGGGGGAAGG + Intergenic
1069960026 10:72074005-72074027 CTCTGGGAGCTGGGGGGAGAGGG + Intronic
1070039274 10:72759235-72759257 CTAAGGGGGTGCGTGTGAGAGGG + Intronic
1070276297 10:75010710-75010732 CGATGGTGGAGGGTGGGAGAGGG - Intronic
1070482345 10:76895181-76895203 CTAAGGGGGTGCGTGTGAGAGGG - Intronic
1070601403 10:77868835-77868857 CTTTGGGGTTGGGGTGGGGATGG + Intronic
1070790870 10:79188611-79188633 CTAGGGGGGTGGGGGACAGGAGG - Intronic
1070791301 10:79191074-79191096 CTATGGGTGTGGGAGGTGGAGGG + Intronic
1070978139 10:80622125-80622147 CCATGGGGGTGGGCAGGGGAGGG - Intronic
1071053924 10:81486829-81486851 ATATGGGGGTGGGGGTGGGGTGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071732375 10:88261308-88261330 CTAGTGTGGTGGGGGGCAGAGGG - Intergenic
1071811798 10:89190132-89190154 CTCTGGAGGTGGGGGGGAAAGGG - Intergenic
1071899817 10:90108138-90108160 CTAAGGGGGTGTGCGTGAGAGGG + Intergenic
1071918647 10:90325117-90325139 ATTTGGGGGTGGGGGGCACAGGG - Intergenic
1071929377 10:90450231-90450253 GTATGGTGGTGGGGAGGAAATGG + Intergenic
1072038935 10:91589767-91589789 CTGGGGGAGTGTGGGGGAGAAGG + Intergenic
1072100013 10:92220476-92220498 GGATGGGGGTGGGGTGGGGAAGG - Intronic
1073287119 10:102395824-102395846 AAATGGGGGTGGGCGGGAGATGG - Intronic
1073365454 10:102936538-102936560 CAATGGGGGTGGGGGAGATTGGG + Intronic
1073531891 10:104239954-104239976 GTATGAGGGTGGGGTGGAGAGGG - Intronic
1073754876 10:106571018-106571040 CTAGGGGTGGGGGCGGGAGATGG - Intergenic
1073759241 10:106612390-106612412 CTGCGGGGGTGGGGGCGGGAGGG - Intronic
1073968391 10:109017785-109017807 CTATGGAGCTGGGTGGGAGAAGG + Intergenic
1074085869 10:110208735-110208757 CTTTGGGGGGGGGGGGGCGGCGG - Intronic
1074153988 10:110782643-110782665 CTGGGGAGGTGGCGGGGAGAAGG - Intronic
1074182219 10:111075758-111075780 CGGTGGGGGCGGGGGGGAGTGGG - Intergenic
1074188179 10:111114702-111114724 CTATGGGTGTGATGGGGACAGGG + Intergenic
1074200945 10:111234636-111234658 TTTTGGGGGTGGGGTGGAAATGG + Intergenic
1074284022 10:112080999-112081021 AGACGGGGGTGGGGGGGAGGTGG - Intergenic
1074400561 10:113138251-113138273 CCATGGGGGTGGGGGTGGGGTGG - Intronic
1074428442 10:113372447-113372469 AAATGGGGGTGGGGTGGAGGGGG + Intergenic
1074570273 10:114618019-114618041 CTATAGGGGTTGGGAGGAGTGGG - Intronic
1074706939 10:116141515-116141537 CGAGGGGGTTGGGGGAGAGATGG + Intronic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075167850 10:120085327-120085349 CTATGGAGGTGGAGGGGAGGAGG + Intergenic
1075463339 10:122632962-122632984 CAATGGGGCTGGGGAGGAGATGG + Intronic
1075536492 10:123276017-123276039 CTCTGGGGGTGGGGGGCGGGGGG + Intergenic
1075994989 10:126869993-126870015 CCATGGGGGTGGGAGGGATGTGG - Intergenic
1076001340 10:126915421-126915443 TTTTGGGGGCGGGGGGGGGATGG + Intronic
1076094062 10:127716069-127716091 ATCTGGGGGTGAGGGTGAGAAGG - Intergenic
1076289398 10:129332694-129332716 AATTGGGGGTGGGGGGAAGAGGG + Intergenic
1076302258 10:129437243-129437265 CTCTGGGGCTGGGTGGTAGAAGG - Intergenic
1076479147 10:130772906-130772928 CCACGGGGGTGGGTGGGAGCAGG - Intergenic
1076587740 10:131560849-131560871 CTGTGGGGGAGCGGGGGACAGGG + Intergenic
1076664502 10:132078610-132078632 CTCTGGGGGCGGGGGGGGGGGGG + Intergenic
1076815397 10:132912119-132912141 ATGTGGGGGTGGGGGGGTGGGGG - Intronic
1076902645 10:133347538-133347560 GTGTGCGGGTGGGAGGGAGAAGG + Intronic
1077137235 11:1006766-1006788 CTATGGTGCTGGGCAGGAGAAGG + Intronic
1077317327 11:1925332-1925354 CCATGTGGGGGTGGGGGAGAGGG + Intronic
1077317329 11:1925334-1925356 ATGTGGGGGTGGGGGAGAGGGGG + Intronic
1077492505 11:2868637-2868659 CTCGGGGGGTGGGCGGGAGTGGG - Intergenic
1077895103 11:6448334-6448356 TTGTGGGGTTGGGGGGGTGAGGG - Intergenic
1078282777 11:9919488-9919510 CTAAGGGGGTGTGCGTGAGAGGG + Intronic
1078338746 11:10484239-10484261 CTATAGTGGTTGGGGGCAGATGG + Intronic
1078515832 11:12021668-12021690 TTTTGGGGGGGGGGGGGGGATGG - Intergenic
1078535939 11:12174344-12174366 GGGTGGGGGTGGGGAGGAGAGGG - Intronic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1078943029 11:16030779-16030801 CTTTGTGGGTGGTGGTGAGAAGG - Intronic
1078986359 11:16603519-16603541 CTTTGGGAGTGGGGGTGGGAGGG + Intronic
1079007282 11:16800846-16800868 ATCTGGGGCTGAGGGGGAGAAGG + Intronic
1079044296 11:17086036-17086058 CTAAGGGGGTGCGTGTGAGAGGG - Intronic
1079326644 11:19498534-19498556 TTATGGGGGTGGATGGGAAAAGG - Intronic
1079463526 11:20706515-20706537 TTGTGGGGTTGGGGGGGAGGGGG + Intronic
1080231192 11:30018502-30018524 GTGTGGGAGTGGGGTGGAGATGG - Intergenic
1080268099 11:30422634-30422656 CAATGGGGGTGAGGGGGGAAAGG + Intronic
1080528835 11:33153986-33154008 ATATGGGGGTGGGGAGCAGGTGG + Intronic
1080574205 11:33583504-33583526 ATATGGAAGTGGTGGGGAGAGGG + Intronic
1080589636 11:33710564-33710586 TTATGGGGGTGGGACGGAGGAGG + Intronic
1080904357 11:36526230-36526252 CTATCGGGGGTGGGGGGAGGGGG - Intronic
1081294517 11:41369374-41369396 CTAAGAGGGTGGAGGGTAGAGGG + Intronic
1081403890 11:42673964-42673986 CTGTGGGGGTGAGAGAGAGAGGG + Intergenic
1081652809 11:44835624-44835646 CTGTGGGGGGCGGGGGGATAGGG + Intronic
1081864135 11:46350499-46350521 GTATGTGGGTGGGGTGGGGAGGG - Intronic
1082059390 11:47847639-47847661 GTGTGGGGGTGGGGGGGGGGAGG + Intronic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1082836476 11:57654464-57654486 GTTTGGAGGTGGGGTGGAGATGG + Intronic
1083087501 11:60165380-60165402 CGATGGGGAAGGGAGGGAGAGGG + Intergenic
1083176298 11:60952074-60952096 CAGTGGGGGTGAGGGGGACAGGG - Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083311459 11:61786008-61786030 CTCTGGGGGTGCGGGGCAGATGG - Intronic
1083328268 11:61884745-61884767 GTGTGGGGGTTGGGGGGACAGGG - Intronic
1083493551 11:63030919-63030941 CTGGGGGGCTGTGGGGGAGACGG + Intergenic
1083860667 11:65418386-65418408 GTTTGGGGGTGGGGGGGGAATGG + Intergenic
1084148057 11:67275461-67275483 GGAAGGGGGTGGGTGGGAGAAGG - Intronic
1084469878 11:69353377-69353399 CTGTAGGGGTGGGTGGGAGTGGG - Intronic
1084642589 11:70434682-70434704 CTGTGGAGGGGGTGGGGAGATGG - Intronic
1084786011 11:71442017-71442039 CTATGGGGCTGGGAAGGAGCTGG + Intronic
1084870857 11:72097760-72097782 CCAAGGGGGTGGGGTAGAGATGG + Exonic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1085052770 11:73388371-73388393 CTATGGGGCTGGGGTGGTCACGG - Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085385931 11:76158429-76158451 GCCTGGGGGTGGGGGCGAGAGGG - Intergenic
1085388220 11:76169206-76169228 CTCTGGGGCTGGGCTGGAGAGGG + Intergenic
1085406634 11:76266995-76267017 CACTGGAGGTGGGGGGTAGATGG + Intergenic
1085482824 11:76836947-76836969 CTTGGGGGGTGTGGGGCAGAGGG - Intergenic
1085517591 11:77120629-77120651 CCATGGTGGTGAGGGGGAGGCGG + Intronic
1085715207 11:78866589-78866611 TTATGAGGGTGGGGGAGACATGG + Intronic
1085999072 11:81956663-81956685 CTAAGGGGGTGTGCGTGAGAGGG - Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1086882610 11:92167066-92167088 CGATGGTGGTGGGGAGGGGATGG - Intergenic
1087176961 11:95104996-95105018 GCATGGAGGTGGGTGGGAGAGGG + Intronic
1087539568 11:99498565-99498587 CTGTGGAGGTGGGTGGGAGTAGG - Intronic
1087605870 11:100377013-100377035 GGATGGGGGAGAGGGGGAGAGGG + Intergenic
1088315063 11:108498600-108498622 CTATGGGGCTGCGGGGAGGAAGG - Intergenic
1088714269 11:112535055-112535077 ACATGGGGGTGGAGGGGAGAGGG + Intergenic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089161308 11:116439663-116439685 CTCTGGGGGTGGGGTGGGGTGGG + Intergenic
1089178703 11:116566258-116566280 CTTTGGGGGTGTGGGGGTGGAGG + Intergenic
1089235703 11:117023239-117023261 CTTTGGGGGTGGTGAGGGGATGG - Intronic
1089326009 11:117657596-117657618 GCATGGGGGTGAGGAGGAGATGG - Intronic
1089475367 11:118756011-118756033 TTTTGGGGGGGGGGGGGAGGGGG - Intronic
1089499175 11:118922682-118922704 CGATGGGGGGAGGGGGCAGAAGG - Intronic
1089736548 11:120553688-120553710 CTATGGGCCTGGGGAGGGGAGGG + Intronic
1089797442 11:120993307-120993329 GTATGGGGGAGTGGGGGATATGG - Intergenic
1089913415 11:122127007-122127029 GTATGGGAGTGTGGGGTAGAAGG + Intergenic
1090285447 11:125495726-125495748 GTATGGGGGCTGGGGGAAGAAGG - Intronic
1090376675 11:126294391-126294413 ATATGGGGGTGGGGTGGTGGAGG + Exonic
1090692002 11:129193305-129193327 TTATGGGGGGGGGGGGGGGGGGG + Intronic
1090716944 11:129439424-129439446 GTTTGGGGGTGGGGAGGATAGGG - Intronic
1090754581 11:129778722-129778744 CAATGGGGGTGGGGAGGGGAAGG + Intergenic
1091136870 11:133199189-133199211 CTATGCAGGAGGTGGGGAGAGGG + Intronic
1091184640 11:133636767-133636789 CGGTGGGGGTGGGGGGGGGGCGG - Intergenic
1202816776 11_KI270721v1_random:49755-49777 CCAGGGGGTTGGGGGGGAGCCGG - Intergenic
1091381424 12:64236-64258 CTAAGGGGGTGCGCGTGAGAGGG - Intergenic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091695427 12:2625089-2625111 CCATGGGGGGCGGGGGGAGCGGG - Intronic
1091847152 12:3666076-3666098 CTCTGGTGGTGGGGAGGAGGGGG + Intronic
1091883592 12:3999846-3999868 GTCTGGGGGTGGGAGGGTGAGGG - Intergenic
1092142455 12:6193388-6193410 ATATGGGGGTTGGGGGCAGGCGG - Intergenic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092261565 12:6955853-6955875 CTGTGGGGGGTGTGGGGAGATGG - Intronic
1092963826 12:13622440-13622462 CTTTGGGGGTGGGGAAGTGAGGG - Intronic
1092992261 12:13914223-13914245 CTTTAGGGGTGGGGAGGAGTGGG - Intronic
1093224340 12:16463432-16463454 CTCTGGGGGTGGGGGGAGGGAGG + Intronic
1093666361 12:21818006-21818028 CTATTGGGGGGTGGGGGTGAGGG - Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1094207178 12:27852972-27852994 TTGTGGGAGTGTGGGGGAGAAGG - Intergenic
1094208547 12:27866347-27866369 GGGTGGGGGTAGGGGGGAGATGG + Intergenic
1094269097 12:28591264-28591286 CTCTGGGGGATGGGGGGAAAAGG - Intergenic
1094365985 12:29681660-29681682 TTGTGGGGGTGGGAGGGGGAGGG - Intronic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1095587985 12:43869908-43869930 GTATGGGGGGTGGTGGGAGAAGG - Intronic
1096296268 12:50386786-50386808 GTTTGGGGGTGGGGGGGTTAGGG + Intronic
1096355572 12:50938193-50938215 GTAGGGGGGTGGGGGGGTGGAGG - Intergenic
1096558904 12:52422062-52422084 CAATGGGGTTGGGGGACAGATGG + Intergenic
1096748255 12:53742686-53742708 CTATGTGGGGGTCGGGGAGAGGG + Intergenic
1096771974 12:53940770-53940792 CTTTGGGGGTGGGGGGCCCAGGG + Intronic
1097557648 12:61159609-61159631 TGATGGGGGAGGGTGGGAGAAGG + Intergenic
1098059710 12:66548509-66548531 CAATGGGGGTAGGGTGGATATGG + Intronic
1098172930 12:67764944-67764966 TTATGGGGGAGGGGGGAAGTAGG + Intergenic
1099688908 12:85925668-85925690 CTAAGGGGGTCTGCGGGAGAGGG - Intergenic
1100199062 12:92279160-92279182 CTATGGGGGCAGTGGGGGGAGGG - Intergenic
1100560105 12:95739881-95739903 TTCTGAGGGTGAGGGGGAGATGG - Intronic
1100565254 12:95789539-95789561 GGATGGGAGTGGGAGGGAGAGGG + Intronic
1100611850 12:96196412-96196434 CTTTGGGGGTGGGGGGGGTGTGG + Intronic
1101067777 12:101040750-101040772 CTATGGGGGGTGGGGGGCTAGGG - Intronic
1101794611 12:107961357-107961379 CTATTGGGGGTGGGGGGTGAAGG - Intergenic
1101959135 12:109235082-109235104 CTAGGGCTGTGGTGGGGAGAGGG - Intronic
1102171860 12:110848365-110848387 CTATGAGGATGGGGGTGAGGGGG + Intronic
1102494471 12:113309855-113309877 CTATGTGGGGGGTGGGGAAATGG + Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102516035 12:113447391-113447413 GATTGGGGGTGGGGGGGAGGTGG + Intergenic
1102555491 12:113724004-113724026 CTCTGGGGGTTGTGGGGAGGTGG + Intergenic
1102959803 12:117085123-117085145 TTCTGGGGGTGGGGTGGACAGGG + Intronic
1103216803 12:119208010-119208032 GAATGGGGGTTGGGGGAAGAGGG - Intronic
1103248742 12:119481393-119481415 GTCTGGGGGTGGGGGAGAGCAGG + Intronic
1103443526 12:120979958-120979980 GGATGGGGGTGTGGGGGAGAAGG + Intronic
1103623932 12:122204716-122204738 CTATGCGGGGGTGGGGGACAAGG - Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1104064891 12:125298309-125298331 CTGGGTGGGTGGGAGGGAGATGG - Intronic
1104110676 12:125701092-125701114 CTGTGGGGTTGTGGGGGAGGTGG + Intergenic
1104321776 12:127758298-127758320 CTCTGGGGGTTGGGGGGTAAGGG + Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104835369 12:131786713-131786735 CACTGGGGGTGGGGGGGTGGTGG - Intronic
1105290904 13:19052876-19052898 CCATGGGGGTGTGGGGGATGGGG - Intergenic
1105407009 13:20141738-20141760 GTTTGGGGGTGGCGGGGACAAGG - Exonic
1105472510 13:20705315-20705337 CGGTGGGGGTGGGGGGGCGTAGG + Intronic
1106018094 13:25888071-25888093 CTCTGGGGGTGGGGCGGGGGGGG - Intronic
1106207425 13:27613028-27613050 GTATGGGGGTAGGGGGTTGAGGG + Intronic
1106233947 13:27845652-27845674 CTGAGGCGGTGGGGAGGAGAAGG - Intergenic
1106414362 13:29534059-29534081 CTTTGGGGGTGACAGGGAGATGG - Intronic
1106440948 13:29769536-29769558 AGATGGGGGTTGGGGAGAGAGGG + Intronic
1106447697 13:29850744-29850766 CTACGAGGGTGGGGGGGGGAGGG + Intergenic
1106506931 13:30378665-30378687 CAATGGGGGTGGGGGTGGGGTGG + Intergenic
1106640311 13:31577696-31577718 CTAAGGGGGTGTGCGTGAGAGGG - Intergenic
1107611784 13:42121665-42121687 CTATGGGTGTAGTGGTGAGAAGG - Intronic
1107634310 13:42377015-42377037 CAAAGGGGGTGGGGGGAGGAAGG - Intergenic
1107725014 13:43290596-43290618 CTATAGGGGAGAGAGGGAGAAGG + Intronic
1108020993 13:46127564-46127586 CAATGGGGCTGGGTGGGAGGCGG - Exonic
1108320979 13:49290258-49290280 TTATGTGTGTTGGGGGGAGATGG - Intronic
1108440809 13:50451006-50451028 CTTGGTGGGTGGTGGGGAGAAGG + Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108682852 13:52794253-52794275 ATATTGGAGTGGAGGGGAGATGG - Intergenic
1108747810 13:53413020-53413042 TTTTGGGGGTGGGAGGGACAGGG - Intergenic
1109973643 13:69802715-69802737 CTATGGGGGTGCACGTGAGAGGG - Intronic
1110422524 13:75329102-75329124 GTGTGGGGGTTGGGGGGAGGTGG - Intronic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110557555 13:76877617-76877639 CAATGGGGGTGGTGGGGAGTGGG - Intergenic
1111507535 13:89213633-89213655 CTGGGGTGGTGGGGAGGAGAGGG - Intergenic
1111934611 13:94546524-94546546 CTATTGGTGTGGGTGGGGGAAGG - Intergenic
1111968584 13:94886351-94886373 ACATGGGGGTAGGGGGGAGGGGG - Intergenic
1112208093 13:97345756-97345778 CTAAGGGGGTGGGGTGGGGTGGG - Intronic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1112362826 13:98732454-98732476 CTTGGGGGTTGGGGGGGACAGGG + Intronic
1112429873 13:99342125-99342147 CTATGGGGGCGGGCTGGCGAAGG + Intronic
1112628178 13:101129866-101129888 CTATCGGGGTGGGGGGCAAGGGG - Intronic
1112631343 13:101164296-101164318 CTTGGGGGGTTGGGGGGACAGGG + Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114302580 14:21391682-21391704 CTTTGGGGGAGGGAGGGAGGGGG + Intronic
1114438287 14:22726252-22726274 CCATGGGGGTTGAGGGGAGCAGG + Intergenic
1114502509 14:23181443-23181465 TGGTGGGGGTGGGGGGGGGATGG + Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1115284284 14:31700821-31700843 CCACGGTGGTGGGGGGGAGGGGG - Intronic
1115618194 14:35116256-35116278 TTCTGGGGGTGGGGAGGACAGGG + Intronic
1115636177 14:35292271-35292293 CTAAGGGGGTGGTGGAGTGAGGG - Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115675207 14:35665916-35665938 TTAAGGAGGTGGGGGGCAGACGG + Intronic
1116590852 14:46770677-46770699 ATTTGGGGGTGGGGTGGGGAAGG - Intergenic
1116885175 14:50213662-50213684 TTTTTGGGGTGGGGGGGACAGGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117494993 14:56294041-56294063 GTATGGTGGTGGGGCGGGGAAGG + Intronic
1117614604 14:57520721-57520743 CTGTTGGGGGTGGGGGGAGATGG - Intergenic
1117707084 14:58481765-58481787 GTATGGGGGTGGGTGGGGGAGGG - Intronic
1117755872 14:58973549-58973571 ATATGGGGGTGGGAGGGGGGTGG + Intergenic
1118047998 14:61993257-61993279 CTGTGGGGGTGTGGGGGGCAAGG + Intergenic
1118176195 14:63442374-63442396 CATTGGGGGTGGGTGGGTGAGGG - Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118726832 14:68634677-68634699 GTAATGGGGTGGGGGTGAGACGG + Intronic
1118925404 14:70187093-70187115 CGAAGGGGGTGGGGGGAGGAGGG - Intronic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119770518 14:77217945-77217967 ATATGAGGGTGGTGGGGAGTGGG + Intronic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1120997122 14:90425510-90425532 ATATGAGGGTGGGGAGGAGCTGG + Intergenic
1121257871 14:92544411-92544433 CTGTGGGGGGGGGGGGGGGGTGG + Intronic
1121473680 14:94174967-94174989 CTTTGGGGGGGGGGGGCGGAAGG - Intronic
1122049033 14:99042768-99042790 CTGTGGGGGGGGGGGGGCGCTGG - Intergenic
1122153076 14:99735021-99735043 CTCTGGGGGAGGGGCGGAGGTGG - Intergenic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122349277 14:101078140-101078162 CTGGGGGGGGGGGGGGGTGAGGG + Intergenic
1122415533 14:101547945-101547967 CGATGGTGGGGGGGGGGAGGAGG - Intergenic
1122606227 14:102948649-102948671 GTTTGGAGGTGGGGGGGTGAGGG + Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122805562 14:104254801-104254823 CGCTGAGGGTGGGTGGGAGAAGG + Intergenic
1122863496 14:104593229-104593251 CTATGGGTGTGGGGCGGGGGCGG - Exonic
1123035613 14:105470779-105470801 CGATGGGGGTGGGGGGCCCAGGG - Intergenic
1123448447 15:20345682-20345704 GGATGGGGGTGGGGTGGCGAGGG + Intergenic
1123586483 15:21765047-21765069 CTGTGGGGGTGGGGGGGCGGGGG - Intergenic
1123623122 15:22207612-22207634 CTGTGGGGGTGGGGGGGCGGGGG - Intergenic
1123631196 15:22260833-22260855 CCTTGGGGCTGGGGGGGAGGGGG - Intergenic
1123633736 15:22281194-22281216 TTTTGTGTGTGGGGGGGAGAGGG - Intergenic
1123796972 15:23782091-23782113 TTATGAGGGTGGGGGGTGGAGGG + Intergenic
1124209676 15:27752798-27752820 CTCTGGGGGGGGGGGGGGGGTGG - Intergenic
1124959098 15:34381927-34381949 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1124975724 15:34528148-34528170 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1125540351 15:40466440-40466462 CTAGGAGGGTGGGGGCGGGAAGG + Exonic
1125569053 15:40700917-40700939 CTTGGGGGGGCGGGGGGAGATGG - Intronic
1125621748 15:41069230-41069252 CCAGGGGGGTGAGGGGGCGAGGG - Intronic
1125892729 15:43278158-43278180 CTATTGGGGTGGGGAGGGGCAGG + Intronic
1126109538 15:45167422-45167444 CTTTGGGGGGTGGGGAGAGAAGG - Exonic
1126662110 15:51043496-51043518 CCAGGGGGGTGGGGGGCAAAGGG - Intergenic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127182207 15:56433253-56433275 GTCGGGGGGTGGGGGGGACAAGG + Intronic
1127251951 15:57247979-57248001 CTGTGGGGGTGGGGTGGTGGGGG - Intronic
1127263291 15:57341351-57341373 CTTTGGGGGTGGGGGTGGGTGGG + Intergenic
1127557732 15:60104558-60104580 CTATGGGGTTGGGGGGTTGGGGG + Intergenic
1127805054 15:62511587-62511609 CGCTGGGGGTGGGGTGGGGAGGG - Intronic
1127964863 15:63915946-63915968 CTTGGGGTGTGAGGGGGAGATGG + Intronic
1127993022 15:64134641-64134663 CTGTGGGGGTGGGGTTGAGGAGG - Intronic
1128095473 15:64950732-64950754 CTATGGGGGGGGGGGGGGGGGGG - Intronic
1128306709 15:66603705-66603727 CTCTGGGGGTGGGGTGGGGATGG + Intronic
1128585256 15:68843869-68843891 GTATGTGTGTGGGGGGTAGAGGG - Intronic
1128643693 15:69359459-69359481 CTAAGGGGGTGCGTGTGAGAGGG + Intronic
1128746333 15:70116967-70116989 GTATGGGGGAGGGGGGAAGCAGG + Intergenic
1129058384 15:72838863-72838885 CTGGGGAGGTGGGGGGGATAGGG - Intergenic
1129190029 15:73931733-73931755 CTGTGGAGGTGGGGTGGAGCAGG - Intronic
1129235502 15:74221590-74221612 CTGTGTGGGTGGGGAGGTGATGG + Intergenic
1129465359 15:75721693-75721715 CCCTGGGGGTGGGGGAGAGGGGG + Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129779708 15:78262574-78262596 TTTTGGGGGTGGGGGGGTGCGGG - Intergenic
1129831962 15:78676502-78676524 CCATTGGGGTGGGAGGGAGTTGG - Intronic
1129848314 15:78778108-78778130 CTGTCGGGGTGTGGGGGAAACGG - Intronic
1129936172 15:79451758-79451780 ACATGGGGGTGGGGGTGACAGGG + Intronic
1130303543 15:82698438-82698460 CTATGAGGGTGTGGGGGAGCGGG - Intronic
1130343345 15:83018980-83019002 CCTTGGGGGTGGGGGGGTGGGGG + Intronic
1130467509 15:84199953-84199975 CTGCGGGGGGGGGGGGGGGAGGG + Intergenic
1130915330 15:88300241-88300263 TTATGGGGCAGGGGAGGAGATGG - Intergenic
1131045837 15:89314831-89314853 AAAAGGGGGGGGGGGGGAGAGGG - Intronic
1131153298 15:90060094-90060116 GTATGGGGGTGGGGTGGGGTGGG - Intronic
1131358989 15:91772605-91772627 CTCTGGGGGTGGGGGTGGGGGGG + Intergenic
1131421099 15:92306080-92306102 ATATGGGGTTTGGGGAGAGAGGG + Intergenic
1131457259 15:92591427-92591449 TTTTGGGGGTGTGGGGGAGGGGG - Intergenic
1131607398 15:93921406-93921428 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
1132064854 15:98722526-98722548 ATATGGAGGTGGGGGGCAGAGGG - Intronic
1132157241 15:99504240-99504262 CTATGGTGGTGGGGGTGAGGAGG - Intergenic
1132566799 16:627295-627317 CCATGGGGCTGTGGGGGAGGAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132891239 16:2205794-2205816 CTGCGGAGGTGGGGGGGGGACGG + Intronic
1132919398 16:2377458-2377480 GTTTGGGGGTGGGGGGGGAAGGG - Intergenic
1133027563 16:2995370-2995392 AGATGGAGGTGGGGGTGAGAGGG - Intergenic
1133225082 16:4337122-4337144 CAGTGGGGGTGGGGGGGGCATGG + Exonic
1133229504 16:4359927-4359949 TTTTGGGGGTAGTGGGGAGATGG - Intronic
1133372769 16:5257842-5257864 TTTTTGGGGTGGGGGGGAAATGG + Intergenic
1133448577 16:5884451-5884473 GTAGGGGGGTGGTGGGGAGCGGG - Intergenic
1133699254 16:8293854-8293876 GTGAGGGGGTGGGGAGGAGATGG + Intergenic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1134289479 16:12892134-12892156 CTAGGAGGGTCGGGAGGAGATGG - Intergenic
1134510679 16:14844469-14844491 CTAGGGGGATAGGGGTGAGAGGG + Intronic
1134588700 16:15434710-15434732 CTATGGGGCGGTGGAGGAGACGG + Exonic
1134632060 16:15763742-15763764 CTTTGGGGTTGGGGGGGTGGGGG - Intronic
1134658667 16:15967171-15967193 CCATGGGGATGGGGTGGAGGAGG + Intronic
1134698318 16:16242955-16242977 CTAGGGGGATAGGGGTGAGAGGG + Intronic
1134815776 16:17204544-17204566 GGATGGGGATGGGGGGCAGAGGG + Intronic
1134973516 16:18551722-18551744 CTAGGGGGATAGGGGTGAGAGGG - Intronic
1135304191 16:21354718-21354740 GCATGGGGGTGGGGAGGAGAGGG - Intergenic
1135712694 16:24730739-24730761 GTATGGGGGGGGGGGGGGGGCGG - Intronic
1135742651 16:24989585-24989607 CTTTGGGGGTGGGGGGAATGGGG + Intronic
1135833741 16:25803956-25803978 CTCTGGAGGTGAGGAGGAGAGGG - Intronic
1135868276 16:26125278-26125300 AGATGGGGGTGGGGTGGGGATGG + Intronic
1135947910 16:26881632-26881654 TTATGAGGGTGGTGGGGAAAAGG - Intergenic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1136248542 16:28989114-28989136 GGATGGGGGTCGGGGGGAGGAGG + Intronic
1136300932 16:29333855-29333877 GCATGGGGGTGGGGAGGAGAGGG - Intergenic
1136394909 16:29987457-29987479 CTATGGCAGCGGGGGGCAGATGG + Exonic
1136467221 16:30453045-30453067 CTAAGGGGGTGTGCGTGAGAAGG + Intergenic
1136538777 16:30916502-30916524 CAATGGAGGTGGGGGTGGGAGGG - Intergenic
1136554363 16:30999046-30999068 TTTTGGGGGTGGGGGGTGGAGGG - Intronic
1137570162 16:49560202-49560224 CTCTGGGGGTGGGAAGGAGCAGG - Intronic
1137606892 16:49793100-49793122 TTATGGGGGTGGTGGGGGGTTGG - Intronic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1137783058 16:51114050-51114072 GGATGGGGGTGGGGGCGAGGAGG + Intergenic
1137818848 16:51424571-51424593 GTTTGGAGGTGTGGGGGAGACGG + Intergenic
1138247568 16:55479081-55479103 GTAGGGGGGTGGGGCAGAGAGGG + Exonic
1138299149 16:55911890-55911912 CTATGGGGCTGCCAGGGAGAGGG + Intronic
1138477903 16:57283091-57283113 CTTTTGGGGGGTGGGGGAGAAGG - Intronic
1138505607 16:57476823-57476845 CCAAGGGGGTGGGGAGCAGAGGG + Intronic
1138565798 16:57831919-57831941 CTTTGGGGGTTGAGGGGAAAGGG + Intronic
1138600610 16:58051845-58051867 CCATGGGGGTGGGGAGGTCAGGG - Intergenic
1138659479 16:58508907-58508929 CAATGGGGGTGGGGAGGGGCAGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139545370 16:67647380-67647402 CTGAGGGGGTGAGGGGGACAGGG + Exonic
1139613950 16:68077891-68077913 TGGTGGGGGTGGGGGGGAGTGGG - Intronic
1139802058 16:69530757-69530779 ATGCGGGGGTGGGGGGGAAAGGG + Intergenic
1139954093 16:70685198-70685220 CTGTGGGGGTGGGGCGGGGCTGG + Intronic
1140087409 16:71809211-71809233 GTAGGGGGGTGGGGGGTAGGGGG + Intergenic
1140355167 16:74299006-74299028 TTTTGGGGGTGGGGGGGTAAGGG - Intronic
1140414100 16:74760951-74760973 CTATGGGGCGGGGTGGGAGGAGG + Intronic
1140870515 16:79102052-79102074 GTAGGGGGGAGGGGGGGAGGGGG + Intronic
1141223392 16:82092264-82092286 CTCTTGGGGTGGAGGGGAGGTGG - Intronic
1141581819 16:85004539-85004561 CCATGGTGGTGGGGTGGAGTGGG - Intronic
1141673681 16:85506356-85506378 ATGTGGGGGTGGGGAGGAGCAGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142036807 16:87867552-87867574 CTTTGGGGGGGAGGGGGAGGGGG - Intronic
1142062632 16:88040584-88040606 GCATGGGGGTGGGGAGGAGAGGG - Intronic
1142397343 16:89839734-89839756 CTCTGGGGGTGGGGTGAAAAGGG + Intronic
1142752702 17:1998201-1998223 CTTTGGGGGAGGGGCGGGGAGGG + Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143164206 17:4889844-4889866 ATCTGGGGGTGGGGGAGAGAAGG - Intronic
1143290385 17:5823490-5823512 ACCTGGGGGTGGGGAGGAGATGG + Intronic
1143412367 17:6718011-6718033 CTAAGGGGGTGCGCGTGAGAGGG - Intergenic
1143501210 17:7340427-7340449 CTAAGGGGGAGGGGCTGAGATGG + Intronic
1143514389 17:7412085-7412107 AGATGGGGGTCGGGGGGAGGTGG - Intronic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1144529273 17:16020665-16020687 CTTGGGGGGTGGGGGGTAGTGGG - Intronic
1144680754 17:17192424-17192446 TTTTGGGGGGGGGGGGGGGAGGG + Exonic
1144773142 17:17770625-17770647 CCATGGGGGTGGGTGGGGGTGGG + Intronic
1145042140 17:19584945-19584967 GTAGGGGGATGGGGGGGATAGGG - Intergenic
1145214586 17:21042418-21042440 GAATGGGGGAAGGGGGGAGAGGG + Intronic
1145266902 17:21384000-21384022 CTCTGGGGGTGGGGGAGGCAGGG - Intronic
1145715531 17:27016550-27016572 CTATGGGGGGTGGGGGGCTAGGG - Intergenic
1145792670 17:27637709-27637731 ATATGGTGGTGGTGGGGAGAGGG + Intronic
1145807543 17:27745577-27745599 ATATGGTGGTGGTGGGGAGAGGG + Intergenic
1145846305 17:28041881-28041903 GTGGGGGGGAGGGGGGGAGACGG + Intronic
1147017760 17:37506258-37506280 GGACGGGGGCGGGGGGGAGATGG - Intronic
1147028290 17:37608983-37609005 CTCTTGGGGTGGGGGGGGGCGGG - Intronic
1147139251 17:38452282-38452304 CAAGGGGGTTGGGGGGGAGATGG - Intronic
1147162207 17:38574844-38574866 CTTGGGGGGTGGGGTGGAGGTGG + Intronic
1147250833 17:39151666-39151688 CGGTGGGGGTGGGGGGGAGCTGG + Intronic
1147261728 17:39212945-39212967 CTATGGCGGAGGGAGGGAGTGGG - Intronic
1147301660 17:39533713-39533735 AAATGGGGGTGGGGGTGAGATGG - Exonic
1147305760 17:39563461-39563483 ATATGGGGGCGGGGGGGGGGCGG - Intronic
1147317055 17:39626101-39626123 CTAATGGGGTGGGGAGGACAGGG - Intergenic
1147450120 17:40499287-40499309 CTAAGGGGGTGCGTGTGAGAGGG - Intronic
1147551668 17:41447264-41447286 CCATGGGGGTGGGTGGGGGCAGG + Intergenic
1147703113 17:42408276-42408298 CTTTAGGGGTGGGGTGGAGCAGG - Intronic
1147809850 17:43160399-43160421 CTAAGGGGGTGTGCGTGAGAGGG + Intergenic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148050166 17:44766182-44766204 AGATGAGGGTGGGGAGGAGAGGG + Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148647206 17:49225859-49225881 CTTGGGGGGTGTGGAGGAGAGGG + Intronic
1149001820 17:51765139-51765161 ATTTTGGGGTTGGGGGGAGAAGG + Intronic
1149266402 17:54932225-54932247 CTAAGGGGGTGCGTGTGAGAGGG + Intronic
1149492275 17:57093759-57093781 TAATGGGGGTGGGGGGCAGTGGG - Intronic
1149512699 17:57256458-57256480 AGATGGGGGTGGGGAGGAGGAGG + Intronic
1149512789 17:57256711-57256733 TTTTGGGGGTGGGGGGGCGGGGG + Exonic
1150259298 17:63774998-63775020 CTATAGGAGTGGGGGCAAGAGGG - Intronic
1150269139 17:63851221-63851243 CTATGGGGATAGTGGGGTGAGGG + Intergenic
1150287858 17:63963980-63964002 CCATGGTGGTGGGGGTGACAGGG + Intronic
1150443562 17:65210868-65210890 CGAAGGCGGTGGGTGGGAGAGGG + Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151062152 17:71107765-71107787 GAATGGGGGTAGGGGTGAGAAGG + Intergenic
1151351306 17:73533678-73533700 CTGGGGGGGTGGGGGGGTGGGGG - Intronic
1151400477 17:73852700-73852722 CGATGGTGGTGGTGGGTAGAGGG - Intergenic
1151636735 17:75354261-75354283 TTTTGGGGGGGGGGGGGAGATGG + Intronic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151714795 17:75825814-75825836 ACATGGGGGTGAGGGGGAGTGGG + Intergenic
1151724761 17:75877595-75877617 CTATGGGGGTGTAGGCGGGAGGG - Intronic
1151728853 17:75899344-75899366 CTGTTGGGGTGGCGGGGTGAGGG - Intronic
1151729399 17:75901946-75901968 ATACGGGGGTGGGGGGGGCAGGG + Intronic
1151843683 17:76636233-76636255 GTATGGGGGTGGGGTGGAGAGGG - Intronic
1151930289 17:77227874-77227896 CTCTGCGGCTGGTGGGGAGAAGG + Intergenic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152128598 17:78462252-78462274 GTAGGGGGGTGGGGGGGTGGGGG + Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152492740 17:80648690-80648712 ATTTGGGGGTGGGGGGCACAAGG - Intronic
1152653631 17:81509180-81509202 ATATGGGGATGGGGGAGAGGAGG - Intergenic
1152699956 17:81813802-81813824 CACTGGGGGTGGGGGGTAGGTGG - Exonic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1153046256 18:857899-857921 CTCAGGGGGTGAGGGTGAGACGG + Intergenic
1153530273 18:6039042-6039064 GCATGGGGCTGGGGGAGAGAGGG - Intronic
1153774820 18:8443108-8443130 CTAAGGGGCTGGGGTGGGGATGG - Intergenic
1154445312 18:14431131-14431153 CTCTGGGGGTGAGGAGGAGCTGG - Intergenic
1155083750 18:22435111-22435133 CTAAGTGGGTGGGGGTGAGGCGG + Intergenic
1155090857 18:22509481-22509503 TGCTGGGGGTGGGGGGGAGGCGG - Intergenic
1155375396 18:25151632-25151654 CTAAGGGAGTGGGGTGCAGAGGG - Intronic
1155631337 18:27897058-27897080 CTATGGGGGTGAGGAGCAGGGGG + Intergenic
1155966733 18:32042775-32042797 GTATGGGGGTAGGGGAAAGATGG + Intronic
1156271115 18:35532736-35532758 CTAAGGGGGTGCGTGTGAGAGGG - Intergenic
1156778375 18:40821394-40821416 CTATTGGGGTGGGGTCAAGATGG + Intergenic
1157009794 18:43633442-43633464 CTATGGGCGGGGGGGGGCAAGGG - Intergenic
1157106796 18:44781495-44781517 AGGTGGGGGTGGGGGGGAGAGGG - Intronic
1157279466 18:46336041-46336063 CCATGGGGGTGAGGGGGAGTGGG + Intronic
1157302019 18:46485969-46485991 CTATGGGTGGGGGAGGGAGAGGG - Intronic
1157574832 18:48736598-48736620 TGATGGGGGTTGGGGGAAGAAGG + Intronic
1157613594 18:48974499-48974521 CCATGGGGGTGGGGAGGGCAGGG + Intergenic
1157682188 18:49615830-49615852 CAATGGGGGTTGGGGGGGGTGGG + Intergenic
1157752587 18:50193272-50193294 CTCTGGGGGAGGAGGGGAGGAGG - Intronic
1157792925 18:50549000-50549022 CTCATGGGGTGGGTGGGAGAAGG + Intergenic
1157821643 18:50775768-50775790 CGATGGGGGTGGGGGGCGGTAGG - Intergenic
1157849958 18:51039476-51039498 GTGGGGGGGTGGGGGGGGGAAGG - Intronic
1158423118 18:57313464-57313486 GAAGGGGAGTGGGGGGGAGAAGG + Intergenic
1158435087 18:57429898-57429920 CTATGGGGCTTTGGGGCAGAAGG + Intergenic
1158495505 18:57951765-57951787 CTAGGGGGGTGATGGGGAAAGGG - Intergenic
1158625764 18:59070353-59070375 CAATGTGGGTGGGGAGGGGAAGG + Intergenic
1158650064 18:59276173-59276195 TGATGGGGGTGGGGGAGACAGGG + Intronic
1159087811 18:63813897-63813919 TTCTGGGGGTAGTGGGGAGAAGG - Intergenic
1159415129 18:68137314-68137336 CTGTGGGGGTGTGGTGGACAAGG - Intergenic
1159923418 18:74246814-74246836 ATAGTGGGGTGGTGGGGAGATGG - Intergenic
1160048233 18:75407360-75407382 GGATGGGGGTGGGGAGGAGTAGG + Intronic
1160134404 18:76260301-76260323 TCCTGGGGGTGGGGGGGAGGGGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160678857 19:404304-404326 CTGAGGGGGTGTGGGGGGGACGG + Intergenic
1160679130 19:404887-404909 CGAGGGGTGTGGGGGGGGGACGG + Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160764403 19:801013-801035 CCCTGGTGGTGGGGGGGAGGGGG - Intronic
1161014729 19:1978040-1978062 CTAGGGAGGTGGGGGGGCGGGGG + Intronic
1161055406 19:2188482-2188504 CTGTGCGGGTGGGGGGGGGGGGG - Intronic
1161129839 19:2581321-2581343 TGATGGGGGTGGGGGGGTGGGGG + Intronic
1161253506 19:3293802-3293824 CTCTGGGGGTGGGGGTGCGGTGG + Intronic
1161302395 19:3548920-3548942 ATCTGGGGGTGGGGAGGAGCTGG + Intronic
1161366344 19:3881864-3881886 CTATGGGGTCGGGGGGGGGGCGG - Intronic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1161519965 19:4718424-4718446 GTATGGGGGTGGTGAGGACAGGG + Intronic
1161528798 19:4774241-4774263 CCTTGGGGGTGGCTGGGAGAGGG - Intergenic
1161615374 19:5267206-5267228 ATGTGGGGGCGGGGGGGAGCGGG + Intronic
1161615945 19:5270284-5270306 AAAGGGGGGTGGGGGGGAGGGGG - Intronic
1161726368 19:5931575-5931597 CTATGTGAGTGGGGGTGGGAGGG - Intronic
1161830211 19:6597337-6597359 CTAAGGGGGTGAGCGTGAGAGGG - Intronic
1161949552 19:7460189-7460211 CTTTGGGGGTATGTGGGAGAGGG + Intronic
1161988815 19:7672282-7672304 GTATGGGGTAGGGGGGGAGCGGG + Intergenic
1162197049 19:8992979-8993001 TTTTTGGGGTGGTGGGGAGACGG + Intergenic
1162256736 19:9496594-9496616 AGGTGGGGGTGGGGGGGACAGGG + Intronic
1162393363 19:10402946-10402968 CTACGGAGGTGGGGGGGCGATGG + Intronic
1162615824 19:11799477-11799499 CTATGGGGGCGGGGGGAGGGGGG - Intronic
1162904578 19:13816114-13816136 ATATGGGGGTGGGGGACAGGAGG + Intronic
1162910247 19:13844143-13844165 CTCTGGGGGTGGGGGCGCGGGGG + Intergenic
1162926357 19:13932223-13932245 CATGGGGGGTGGGGGGCAGAAGG - Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163198887 19:15747821-15747843 CGGTGGGGGAGGGAGGGAGAGGG + Intergenic
1163372274 19:16908026-16908048 CCATGGGGCTGGGTGGGACAGGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163463888 19:17455239-17455261 GGATGGGGGTGGGGGGGTGGGGG - Intronic
1163618103 19:18341351-18341373 GTTTGGGGGTGGGGGGGAGTCGG - Intronic
1163664003 19:18594623-18594645 CTGGGGAGGTGGGGGGGAGGGGG + Intronic
1163691162 19:18739204-18739226 CCATGGGGATGGTGTGGAGATGG + Intronic
1163702142 19:18791266-18791288 CCATGGCGGTGGCGGGGAGCTGG + Exonic
1163843733 19:19627450-19627472 CCATGGGGCTGGGGTGGAGGTGG + Exonic
1164137348 19:22427187-22427209 CTAAGGGGGTGGCGGGGGGGGGG + Intronic
1164147764 19:22522754-22522776 CTAAGGGGGTGCGTGTGAGATGG - Intronic
1164623787 19:29713811-29713833 GTATGGGGGTGGGCAGGGGACGG - Intronic
1164878482 19:31710897-31710919 TTATGTTGGTGGTGGGGAGAAGG + Intergenic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1166201981 19:41243595-41243617 CTCTGGGGGGGAGGGGGAGTAGG - Exonic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166260950 19:41640505-41640527 CTCTGGGAGTGGGTGGGAGGAGG - Intronic
1166317197 19:41995893-41995915 GTATGAGGGTGGGTGGGTGAAGG + Intronic
1166947879 19:46408381-46408403 CTATGGGGGGGGGGGGGTCTCGG - Intergenic
1166949434 19:46416647-46416669 CTAAGCGGGTGGGGCGGAGGCGG + Intergenic
1166988651 19:46677747-46677769 GGATGGGAGTGGGGAGGAGAAGG - Intronic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167272206 19:48511826-48511848 TTGCTGGGGTGGGGGGGAGAGGG + Intronic
1167400232 19:49261669-49261691 CTAGGGGGGTGCTGGGCAGAGGG + Intergenic
1167575833 19:50317053-50317075 CTATGGGATTGAGGGGGAGAGGG - Intronic
1167740717 19:51323580-51323602 CCGAGGGGGTGGGTGGGAGAAGG - Intronic
1167741363 19:51326620-51326642 CAATGGGGGTGGGGTGGGGGAGG - Intronic
1167903252 19:52637850-52637872 GGAGGGAGGTGGGGGGGAGACGG + Intronic
1167935482 19:52903416-52903438 CTGTGGGGGGCGGGGGGAGGAGG + Intergenic
1168083797 19:54029990-54030012 AAATGGGGGAGGGGGGGAGAGGG + Intergenic
1168113437 19:54207889-54207911 ATATAGGGGTGGGAGGGAGCCGG + Intronic
1168219934 19:54953322-54953344 CTAAGGGGGTGTGCGTGAGAGGG + Intronic
1168235373 19:55059577-55059599 TTTTGGGGGTGGGGGGGGGCGGG + Intronic
1168594264 19:57663014-57663036 CTATTGGGGGTGGGGGGTGAGGG - Intergenic
925007086 2:451938-451960 GGATGGGGGTGGTGGGGGGATGG + Intergenic
925138442 2:1535143-1535165 CAATGGGGGGGGGGGGGATTTGG - Intronic
925402107 2:3582159-3582181 AAATGGGGGGTGGGGGGAGAAGG - Intergenic
925799676 2:7585793-7585815 CTAAGGGGGTGCGTGTGAGAGGG + Intergenic
925878703 2:8332982-8333004 GTGTGGGGGTGTGGGGGCGAGGG - Intergenic
925898722 2:8493562-8493584 GAATGGAGGTGGGAGGGAGACGG + Intergenic
925991751 2:9260080-9260102 CTATGGAGGTGGGAGGGGAAAGG + Intronic
926031673 2:9596203-9596225 ATATGGGGGTGGGGGAAAGGAGG - Intronic
926117224 2:10221182-10221204 CTCTGGGGGTGGGGGGGTGGCGG + Intergenic
926160958 2:10489005-10489027 CTATGTGGGGGTGGGGGACACGG - Intergenic
926491803 2:13533246-13533268 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
926891055 2:17639090-17639112 CTAAGGGGCTGGTGGGGTGAAGG + Intronic
927425523 2:22977220-22977242 ATATGGGGGTGAGGGAGAGGAGG - Intergenic
927461712 2:23305032-23305054 CTATGTGGGTGGTGGAGGGAGGG - Intergenic
927758359 2:25727102-25727124 CTGTTGGGGTCGGGGGCAGAGGG - Intergenic
928142941 2:28746306-28746328 CTTGGGGGGCGGGGGGGAGTGGG - Intergenic
928383284 2:30839614-30839636 CAAGGTGGGTGGGTGGGAGAGGG + Intergenic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
928692168 2:33811303-33811325 TCATGGGGGAGGGGTGGAGAAGG + Intergenic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929241333 2:39656777-39656799 CTCAGGGGGTGGCGAGGAGAGGG + Intergenic
929545878 2:42855005-42855027 CAATGGGGGTGGTGGGGTGGGGG + Intergenic
929892468 2:45929712-45929734 TCCTGGGGGTGGGGGGAAGATGG - Intronic
929918546 2:46155794-46155816 CAATGGGGATAGTGGGGAGAAGG - Intronic
929945616 2:46369545-46369567 GTACCGGGGTGGTGGGGAGAGGG + Intronic
930001176 2:46862473-46862495 GCTTGGAGGTGGGGGGGAGAGGG + Intergenic
930022522 2:47009900-47009922 TTTTGGTGGTGGGGGGGACAGGG + Intronic
930166254 2:48206452-48206474 CTAAGGGGGTGCGGGTGAGAGGG + Intergenic
930471097 2:51814840-51814862 TTGTGTGGGTGGGTGGGAGAGGG + Intergenic
931458007 2:62427053-62427075 CGATGGGGCTGGGGGAGACATGG + Intergenic
931528396 2:63185394-63185416 ATTTGGGGGTGGGGGAGAGGGGG - Intronic
931592155 2:63896345-63896367 GTATGGGGGTGGGAGGGAGAAGG + Intronic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932686838 2:73877990-73878012 CTATTGGGGGGTGGGGGACAAGG - Intergenic
932777364 2:74536260-74536282 GCATGGAGGTGGGAGGGAGAGGG - Intronic
933061883 2:77748003-77748025 CTATGGGGGAGTTGGGGTGAGGG - Intergenic
933317630 2:80734704-80734726 GGATGGGGGTTGGGGGGAGAAGG + Intergenic
933555961 2:83831032-83831054 ATATGGGGGTGGGTGGGGGAGGG - Intergenic
933727463 2:85434966-85434988 CTGCGGGGGTGGGGGGTAGGAGG - Exonic
933732905 2:85471143-85471165 GGATGGGGGTGGGAGGGAGGTGG + Intergenic
933738827 2:85517006-85517028 GATTGGGGGTGGGGGGGCGAGGG + Intergenic
934103855 2:88678627-88678649 TGATGGGAGTGAGGGGGAGATGG + Intergenic
934180241 2:89612714-89612736 CTCTGGGGGTGGGGGGGTGGGGG - Intergenic
934562588 2:95320873-95320895 CGAGGGGGGCGGGGAGGAGAGGG - Intronic
934761673 2:96860109-96860131 ATATGGAGGTGGGGTGGACAGGG - Exonic
935493279 2:103746833-103746855 GTTTTGGGGTGGGGGGGAGGGGG - Intergenic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
936580768 2:113698605-113698627 CTATTGGGGGTGGGGGGAAAGGG + Intergenic
936614311 2:114033042-114033064 CCATGGGGGTTGGGGGCAGCAGG - Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
937246804 2:120498985-120499007 CCATGGGGTTGGAGGGGTGAAGG + Intergenic
937372848 2:121314093-121314115 CTTTGGGGGCGGGGGTGGGACGG - Intergenic
937510300 2:122587697-122587719 CAATGGGGATGAGGTGGAGAAGG + Intergenic
937664970 2:124476440-124476462 GTTTGTGGGTGGGTGGGAGAGGG + Intronic
938102045 2:128504078-128504100 CTCTGAGGGTGGTTGGGAGATGG + Intergenic
938140791 2:128793400-128793422 TTCTGGGGATGGGGGGGAGTGGG + Intergenic
938253263 2:129833031-129833053 CTGTGGGGGGGGGGGGGAGGAGG - Intergenic
938390333 2:130899777-130899799 CCAAGGGGGTGGGAGGGCGATGG + Intronic
939263443 2:139839823-139839845 GTAAGAGGGTGGGGAGGAGATGG - Intergenic
939365474 2:141224813-141224835 TCATGGGGGTGGGGTGGGGAAGG + Intronic
939548281 2:143581368-143581390 CTATGGGGCTGTGGGGTGGAAGG - Intronic
940100456 2:150031748-150031770 CAATGGGGGTGGGGGGTGGGGGG + Intergenic
940471304 2:154104195-154104217 CCATGGGGGTGGGGGGATGGTGG + Intronic
941225144 2:162838827-162838849 CTGTGGGGGTGGGGTGGGAAGGG + Intergenic
941488279 2:166109859-166109881 CTATGTGGGTGGTGGGGAGGTGG + Intronic
941692807 2:168518912-168518934 CTAAGGAGGTGGGTGGGAGGAGG - Intronic
941707666 2:168677166-168677188 CTGTTGGGGGGTGGGGGAGAAGG - Intronic
941819309 2:169828212-169828234 GAAAGGGGGTGGGGAGGAGAAGG + Intronic
941994218 2:171586338-171586360 CTATGGGGATGGGGTGGGGCTGG - Intergenic
942133712 2:172905172-172905194 CTGTTCGGGTGGGGAGGAGAGGG - Intronic
942173450 2:173309060-173309082 CTAAGGGGGTGTGGGTGAGAGGG - Intergenic
942246536 2:174013337-174013359 CTCTGGGGAAGGGGAGGAGAGGG - Intergenic
942307316 2:174621492-174621514 CGATGGGGGTGGAGGGGAGGGGG - Intronic
942426527 2:175866266-175866288 TTTTGGGGGTGGGGCGGAGCAGG - Intergenic
942578989 2:177396075-177396097 ATATGGGGGTGGGAGGGTGGGGG + Intronic
943033788 2:182716156-182716178 CTGCGGCGGTGGGGTGGAGAGGG - Intronic
943527215 2:189031349-189031371 CTAGGGTGGCGGGGGGGAGTGGG + Intergenic
943572749 2:189593202-189593224 CTTTGGGGATAAGGGGGAGAGGG + Intergenic
944207841 2:197175561-197175583 CTTTGGGGGAGGGAGGGAGAAGG - Intronic
944264706 2:197710535-197710557 CTTGGGGGGTGGGGGGAAGGGGG - Intronic
944284956 2:197939045-197939067 TAATGGGGGTGGTGGTGAGAAGG + Intronic
944442001 2:199752222-199752244 CTGTGGGGTGGGGAGGGAGAGGG - Intergenic
944565460 2:200985743-200985765 ATTTGGGGGAGGGAGGGAGAGGG - Intronic
944621085 2:201516786-201516808 GTATGGGGGTGGGCGGGGAAGGG + Intronic
944904319 2:204247278-204247300 TTATGGGAGTGGGGTGGGGAGGG + Intergenic
945027918 2:205637064-205637086 AAAGGGGGGTGGGGGGGAGGAGG - Intergenic
945070481 2:205983901-205983923 CTAAGGGGGTTGGAGGGGGAGGG + Intergenic
946248440 2:218399922-218399944 CTAGGGGGGAGGGGGAGGGAGGG - Exonic
946276083 2:218632905-218632927 CTATGGGGAAGGGAGGCAGAGGG + Intronic
946434114 2:219640725-219640747 CGATGTGGGTGGGTGGGAGCAGG + Intronic
946525527 2:220515243-220515265 CTTTGGGGGCGGCGGGGAGGGGG + Intergenic
946755091 2:222936609-222936631 CTACGGGGGTGGGGTGGGGGGGG - Intronic
946782212 2:223203704-223203726 CTAAGGGGGTGCGTGTGAGAGGG - Intergenic
946906598 2:224422831-224422853 TTTTGGGGGTTGGGGGGGGATGG - Intergenic
947286347 2:228519762-228519784 CTGTGGTGGTGGGGTGGAGGTGG - Intergenic
947439874 2:230109809-230109831 CTATGGGGATGGGTGAGGGATGG + Intergenic
947717398 2:232348809-232348831 ACATTGGGGTGGGGTGGAGAAGG - Intergenic
947749787 2:232526141-232526163 GAATGAGGGTGGGCGGGAGAGGG - Intronic
947811165 2:233004732-233004754 CGATGGGGGGTGAGGGGAGAGGG - Intronic
947828728 2:233124368-233124390 CCATGAGGGTGGGAGGGAGCAGG - Intronic
947911068 2:233801316-233801338 GGGTGGGGGTGGGGTGGAGAGGG + Intronic
948016992 2:234699194-234699216 CTTTTGGGGTTGGGGGAAGAAGG + Intergenic
948349025 2:237323036-237323058 CAATGGGGGTGGCGGGGGCAGGG + Intergenic
948586952 2:239025730-239025752 CTATGGCGGGGTTGGGGAGACGG + Intergenic
948813734 2:240499342-240499364 ATGTGGGGGTGGGGGTGAGTAGG + Intronic
948856211 2:240731860-240731882 CTATGGGGATTGGGGGGTAAGGG + Intronic
1168809819 20:697892-697914 AGATGGGGGTGGGGAGGAGGTGG + Intergenic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1168939217 20:1694889-1694911 CCATAGGGGAGGTGGGGAGAGGG - Intergenic
1169464155 20:5822995-5823017 ATATGGGGGTGGGGGCGGGGTGG - Intronic
1169569919 20:6894983-6895005 GTCTGGGGGTGGGGAGGGGAAGG + Intergenic
1169689999 20:8319842-8319864 CTCTTGGGGTGGGGGGAAGGGGG + Intronic
1170228094 20:14014224-14014246 TATTGGGGGTGGGGGGGAGGGGG - Intronic
1170690100 20:18606772-18606794 CTGTGGTGGGGGGGGGGAGGGGG + Intronic
1170954365 20:20964763-20964785 TTATGAGGGTGTTGGGGAGATGG - Intergenic
1171277992 20:23874948-23874970 CCATGGGGGTGGAGAGGAAATGG + Intergenic
1171422249 20:25025051-25025073 CTATGGGCGAGGAAGGGAGATGG + Intronic
1172101056 20:32484034-32484056 CGGTGGGGGCTGGGGGGAGAGGG + Intronic
1172183130 20:33015702-33015724 TTATGGGGTTGGAGGGGAGGGGG + Intronic
1172240630 20:33410330-33410352 GTCTGGGGGTTGGGGGCAGAGGG + Exonic
1172245872 20:33444425-33444447 CTATCGGGGAGGGCGGGGGATGG + Intergenic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172942215 20:38661927-38661949 CTATGGGGGAGGGGGAGGGTGGG + Intergenic
1172944089 20:38674552-38674574 CTCTGGGGGCGGGGTGGGGACGG - Intergenic
1173169676 20:40713806-40713828 CACTGGGGGTGGGGAGGACATGG - Intergenic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173569223 20:44066038-44066060 CCATGGGGGTGGGCAGGACAGGG - Exonic
1173707928 20:45126652-45126674 GTCTGGGGGTGGGGGGAATAGGG - Intergenic
1173753161 20:45492526-45492548 GTCTGGGGGTGGGGTAGAGATGG + Intergenic
1173777287 20:45720690-45720712 TCATGGGGGTGGTAGGGAGAGGG + Intergenic
1174045081 20:47727545-47727567 CTAAGGGGGTGGGACAGAGAGGG + Intronic
1174077223 20:47946253-47946275 CTGTGGGGGTGGCAGGGAGCAGG + Intergenic
1174110861 20:48196937-48196959 TTGTGGGGGCGGGGGGGTGAGGG - Intergenic
1174201198 20:48807887-48807909 CTAGAGGGGTGTGGGGGAGCAGG + Intronic
1174317195 20:49712832-49712854 CGAGGTGGGGGGGGGGGAGATGG + Intronic
1174454985 20:50642586-50642608 TCATGGGGGGAGGGGGGAGATGG - Intronic
1174494478 20:50930444-50930466 TTTTGGGGGTGGGGGGCGGACGG + Intronic
1175336305 20:58198532-58198554 CCCTGGTGGTGGGGTGGAGAAGG + Intergenic
1175743459 20:61436716-61436738 AGATGGGGGTGGGGGGGTGTTGG - Intronic
1175966285 20:62661663-62661685 CTCTGAGGGAGGGAGGGAGATGG - Intronic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176151802 20:63595274-63595296 CCGTGGGGGTGGGAGGGAGGGGG + Intronic
1176283785 20:64330598-64330620 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
1176924200 21:14727107-14727129 CTCTGGGGGTTGTGGGGAGTGGG - Intergenic
1176968030 21:15233600-15233622 TCATGGGGGTGGAGGGGAGGGGG + Intergenic
1177351187 21:19944023-19944045 CTATCGGAGTGGGGAGTAGAAGG - Intergenic
1177431890 21:20999881-20999903 CTATAGCTGTGGGGAGGAGAAGG - Intronic
1177512965 21:22113999-22114021 CTGTGGGGGTTGGGTGGTGAGGG + Intergenic
1177667610 21:24181409-24181431 GTAGGGGGGTGGGGGGGTGGTGG - Intergenic
1177822719 21:26049172-26049194 GCCTGGGGGTGTGGGGGAGAGGG + Intronic
1177899908 21:26902132-26902154 CTAGGGGGTTGAGGGGGAGGTGG + Intergenic
1177995730 21:28094859-28094881 AGATGGGGGTGGGGGAGTGAGGG + Intergenic
1178042997 21:28662175-28662197 AAATGAGGGTGGGCGGGAGAGGG + Intergenic
1178680934 21:34670979-34671001 CTTTGGGGGTGGGGGCGACGGGG + Intronic
1178922064 21:36745198-36745220 CCATGGCGGTGGGTGGCAGATGG + Intronic
1179421361 21:41239181-41239203 AGATGGGGGTGGGGTGGGGAGGG + Intronic
1179605523 21:42513465-42513487 CTTTGGGGGTGGGGGCGCGGCGG + Intronic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1179921966 21:44512333-44512355 CTGTGGGGGTGGGGTGGGGTGGG + Intronic
1180197770 21:46207833-46207855 CAATGGGGGTGGGGGGCACCTGG - Intronic
1180296793 22:10946222-10946244 TTGTGTGGGTGGGGGGGAAAAGG + Intergenic
1180599481 22:17006851-17006873 CTATTGGGGTTGGGGGGCAAGGG + Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180752977 22:18137971-18137993 CTACGGGGGTGCGCGTGAGAGGG - Intronic
1180769329 22:18369278-18369300 CTTGTGGGGTGGGGGGGGGAGGG - Intergenic
1180914551 22:19476567-19476589 ATATGGGGGTGGGGGGTGGGAGG - Intronic
1181387703 22:22557877-22557899 GGCTGGGGGTGGGGAGGAGATGG + Intronic
1181487211 22:23238867-23238889 CAAGGGGGGTGGGGGGCAGGTGG + Intronic
1181990379 22:26832495-26832517 CTATGTGGGTCGGAGGGAAATGG - Intergenic
1182026269 22:27121662-27121684 TTATTGGGGTGGGAGGAAGACGG - Intergenic
1182032878 22:27173976-27173998 TTGTGGGGGAGAGGGGGAGATGG - Intergenic
1182162700 22:28139049-28139071 TTTTGGGGGTTGGGGAGAGATGG + Intronic
1182388694 22:29970955-29970977 GTCTGGGGGTGGGGGGGAAGAGG - Exonic
1182551305 22:31102247-31102269 TCCTGGGGGTGGGAGGGAGAGGG + Intronic
1182755140 22:32673221-32673243 CTATGGAGCTGTGGGGAAGAGGG + Intronic
1183034432 22:35130477-35130499 CTTTAGGGGTGGTGTGGAGAGGG + Intergenic
1183303778 22:37071189-37071211 CTGTGGGGGGCGGGGGGACATGG - Intronic
1183345888 22:37307484-37307506 CTATGGGGGTGGGGAAGAGCAGG - Intronic
1183427336 22:37746740-37746762 CTAGGGGGCTGGAGGGGAGGTGG - Intronic
1183478535 22:38050466-38050488 CCAGGGGGATGGGGAGGAGAGGG - Intergenic
1183486285 22:38089224-38089246 CTCGGGGGCTGCGGGGGAGATGG + Exonic
1183819249 22:40331744-40331766 CAAAGGGGGTGGGGAGGAGAGGG + Exonic
1184150744 22:42636957-42636979 GGATGAGGGTGGTGGGGAGAGGG - Intronic
1184187118 22:42872216-42872238 CTAGGGTGGTGAGGGGGAGGTGG + Intronic
1184441417 22:44518839-44518861 CCATGGGGTTGTGGGGCAGAGGG + Intergenic
1184615169 22:45633038-45633060 CTGTGGGGGCGGGGGAGACAGGG + Intergenic
1184646401 22:45897612-45897634 CTATGGGGCTGTGGGGAAGATGG + Intergenic
1184800295 22:46754892-46754914 CAGTGGGGGTGGGGAGGGGATGG - Intergenic
1185276049 22:49950555-49950577 ATAGGGGGGTGGGGGGGTGGGGG + Intergenic
1185323752 22:50215626-50215648 CCAGGGGGGTGGGGGGGGGGGGG + Intronic
1185326545 22:50228382-50228404 CAAAGGGGCTGGGGGGGAAATGG + Intronic
1203255435 22_KI270733v1_random:135399-135421 TGGTGGGGGTGGGGGGGGGAGGG + Intergenic
949730919 3:7111895-7111917 CTCTGAGGGTGGGGGGGTGCTGG - Intronic
949766239 3:7530087-7530109 GTTGGGGGGTGGGGGGGATAGGG - Intronic
949948065 3:9205960-9205982 CTAGGGGGTTGGGGAGGAGAAGG + Intronic
950006853 3:9697006-9697028 TTTTGGGGGTGGGAGGAAGAAGG - Intronic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950465770 3:13153001-13153023 GGATGGGGGTAGGGAGGAGAGGG - Intergenic
950654877 3:14430405-14430427 CTCTGGGGGTGCTGGGGACATGG - Intronic
950770852 3:15309898-15309920 TTATGGGGGGGGGGTGGAGCGGG - Intronic
950813647 3:15674927-15674949 GTGTAGGGGTGAGGGGGAGAAGG + Intronic
951248885 3:20371131-20371153 CTAAGGGGGTGTGCGTGAGAGGG + Intergenic
951512702 3:23521882-23521904 CTGGGGGGGTGGGGGGTACACGG - Intronic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
951614208 3:24523162-24523184 CTTTGTGTGTGGGGGGGGGAGGG + Intergenic
951619400 3:24584420-24584442 CTATGGCTGTGTGGGGGGGAGGG + Intergenic
952331464 3:32367736-32367758 CTGTGGGAGGGTGGGGGAGAAGG - Intronic
952959616 3:38581114-38581136 CTCTGGGGGTGGCGGGGAGTAGG + Exonic
953186594 3:40643400-40643422 CTCTGAGGCTGGGGGAGAGATGG + Intergenic
953342724 3:42149323-42149345 CTATGGGGGAAGGAGGGAGTAGG - Intronic
953342857 3:42150161-42150183 AGATGGGGGTGGGGAGGTGATGG + Intronic
953408148 3:42670349-42670371 CTCTGAGGGTGGGGCAGAGAGGG - Intergenic
953680792 3:45036513-45036535 CTATGGGGTCGGCGGGGAGTGGG + Intergenic
953682772 3:45052060-45052082 AGATGGGAGTGGGGGAGAGAAGG - Intergenic
953822734 3:46222254-46222276 CCATGGTGGAGGTGGGGAGATGG + Intronic
953974382 3:47371376-47371398 GGGTGGGGGTGGGGGGGAGGGGG - Intergenic
954005693 3:47588701-47588723 CTGTGGGGGCGGGGGGGGGGCGG - Intronic
954151153 3:48657764-48657786 CTATGCTGGAGGAGGGGAGAAGG - Intronic
954217694 3:49133530-49133552 GAATGGGGCTGGGGGAGAGATGG + Intergenic
954224919 3:49175172-49175194 CTATGGGGCTGGGGAGAGGAGGG + Intronic
954304313 3:49717463-49717485 CCAAGGGGGTGGGAGGGAGTGGG - Exonic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
954681876 3:52350283-52350305 GTCTGGGGGTAGGGGGGAGCTGG + Intronic
954704034 3:52469270-52469292 ATGTGGGGGTGGGGGGCTGAGGG + Intronic
955672991 3:61421444-61421466 GAATGGGGGTGGGGGGGGGTGGG - Intergenic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956006408 3:64783121-64783143 CTATTGGGGTGTGGGGGACAAGG + Intergenic
956973440 3:74553082-74553104 CTGTGGGGGTTGGGGGGCTAGGG - Intergenic
957079380 3:75623536-75623558 CACTGGGGGGGGGGGGGAGCGGG - Intergenic
957284142 3:78195571-78195593 GTTGTGGGGTGGGGGGGAGAGGG + Intergenic
957358565 3:79124195-79124217 CTATGGGGGTGGGATGGTGAGGG - Intronic
958060697 3:88476247-88476269 CTGTGGGGGCGGGGGTGGGATGG - Intergenic
958421414 3:93936082-93936104 GAAGGGGTGTGGGGGGGAGATGG - Intronic
958795335 3:98701191-98701213 CACTGGGGGTGGGTGGGAAATGG - Intergenic
958916900 3:100060045-100060067 AAATGGGGGCGGGGGGAAGATGG + Intronic
959091170 3:101904697-101904719 GTCTGGGGGTGGGGGGGTTAGGG - Intergenic
959453256 3:106528733-106528755 CTTTGGGGGTTGGGGGGTGAGGG + Intergenic
959539704 3:107524611-107524633 CAGAGGGGGGGGGGGGGAGAGGG + Intronic
960582954 3:119295748-119295770 AGATGGGGGTAGGGGGGAGTTGG + Intronic
960588248 3:119341233-119341255 CTAAAGGGGTGGGGAGGAGAGGG + Intronic
961210292 3:125120297-125120319 AAATGGGGGTGGGGGAGGGACGG + Intronic
961218129 3:125177640-125177662 CTATGGGGGTTAGGGGGAGATGG + Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961483260 3:127197309-127197331 CAATGGGGGAAGGGGGCAGAGGG - Exonic
961516407 3:127440205-127440227 ATGTGGGGGTGGGGTGGGGAAGG - Intergenic
961538724 3:127586320-127586342 ATAATGGGGTGGGGAGGAGAGGG - Intronic
961545548 3:127630171-127630193 CTATGGAAATGGCGGGGAGAAGG + Intronic
961869534 3:129977473-129977495 CTGTGGTGGGGGGGGTGAGAGGG - Exonic
962165091 3:133039458-133039480 GTATGGGAGTCCGGGGGAGATGG + Intronic
962690714 3:137895360-137895382 ATATGGGGGTGTGGGAGGGATGG + Intergenic
962804521 3:138917129-138917151 CTTTGGGGGTGGGAGGTAGGGGG + Intergenic
962874132 3:139522807-139522829 GTTGGGGGGTGGTGGGGAGATGG + Intronic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
963028377 3:140942174-140942196 CGAGGGGGGTGGGGGGGTGGGGG + Intronic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964502620 3:157365624-157365646 CCATGGGGGTGGGGTGGTGCAGG - Intronic
964951363 3:162298345-162298367 CTATGGAGCTGGGGAAGAGAAGG + Intergenic
965381000 3:167987811-167987833 CACTGGGGGTGGGGTGGGGATGG + Intergenic
965410776 3:168327718-168327740 ATAGGGGGGTGTGGGGGAGTAGG + Intergenic
965597250 3:170421143-170421165 CTCTGGGGGTGGGGGGGGGGTGG + Intronic
965613673 3:170570838-170570860 CTATTGGGGTGGGTGGGGGGTGG - Intronic
966252865 3:177886275-177886297 ATATGGGGGTAGGGAGGTGAAGG - Intergenic
966331479 3:178819502-178819524 GGATGGGGGTGGGGGGAACAGGG - Intronic
966413977 3:179670372-179670394 CCATGGGGGTGAGCGGCAGAAGG - Intronic
966710027 3:182962562-182962584 ATCTGGGGTTTGGGGGGAGAGGG - Intronic
966892499 3:184417444-184417466 CCATGGGCGGGGGGCGGAGAGGG + Intronic
967033713 3:185631600-185631622 CTGCGGGGGGGGGGGGGGGAGGG - Exonic
967182412 3:186917913-186917935 TTATGGGGGTGGAAGGCAGAAGG - Intergenic
967451112 3:189624307-189624329 TTATGGGGGTGGGGGTGACAGGG - Intergenic
967763386 3:193250830-193250852 GTGCGGGGGTGGGGGGGATAGGG - Intronic
968035308 3:195543352-195543374 CTAGGGAGGAGGCGGGGAGAGGG + Exonic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
968756234 4:2417835-2417857 CAATGGGGGTGGGGGCAGGACGG + Intronic
968887220 4:3341335-3341357 GTATGGGGGAGGAGGGGACAAGG + Intronic
968931227 4:3580533-3580555 ATAGGTGGGTGGGGGGGTGATGG - Intronic
969167699 4:5331067-5331089 CTATGGGAGTGGAGGGGAAGGGG - Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969993045 4:11283854-11283876 CTATGGGGGTGGGGGTCTCATGG - Intergenic
970230402 4:13904151-13904173 GTGTGGGGGTGGGGAGGAAAAGG + Intergenic
971105030 4:23515329-23515351 ATATGGGGGTGGGAGTGAGCTGG - Intergenic
971394938 4:26218804-26218826 GTATGGGGGTGGGGCAGGGAGGG + Intronic
971428269 4:26537261-26537283 TCATGGGGGTCGGGGGTAGAAGG - Intergenic
971873998 4:32280744-32280766 TTCTGGGGGTGGGGGGGAAGGGG + Intergenic
971893520 4:32558610-32558632 CTGTTGGGGGGTGGGGGAGAAGG + Intergenic
972784266 4:42312372-42312394 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
972847813 4:43010590-43010612 GGATGGGGGTGGGGTGGGGATGG + Intronic
973797245 4:54440076-54440098 GTGTGGGGGGGGGGGGGGGAGGG + Intergenic
973954604 4:56049716-56049738 CTCCGGGGGCGGTGGGGAGAGGG - Intergenic
974164490 4:58184136-58184158 GTATGTGTGTGGGGGGGAGTGGG + Intergenic
974271367 4:59655670-59655692 ATGTGGGGGTGGGGCCGAGATGG + Intergenic
975535952 4:75450583-75450605 TTCTCGGGGTGGGGGGAAGAAGG - Intergenic
975579145 4:75891399-75891421 CCCTGGGGGTGGGAGGGAGTGGG - Intronic
975897161 4:79106735-79106757 CTGTGGTGGTGGGCGGGAGCAGG + Intergenic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976278498 4:83303019-83303041 TTATTGGGGTGGGGGGAATAAGG - Intronic
976360535 4:84173374-84173396 GTATTGGGGAGGGGGGGAGGAGG - Intergenic
976871312 4:89797072-89797094 CCATGGGGCTGGGGTGGAGGTGG - Intronic
977210820 4:94215623-94215645 AAAGGGGGGTGGGGGGGAGGAGG + Intronic
977410046 4:96651303-96651325 GTATGTGGGTGAGGAGGAGAAGG + Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977551074 4:98444527-98444549 CTAATGGGGTTGGGGGGAAAGGG - Intergenic
977573848 4:98657500-98657522 CAGTGGGGGTGCGGGGTAGAGGG - Intronic
977669222 4:99676753-99676775 CTATTGGGGGAGTGGGGAGAGGG + Intergenic
978285587 4:107073430-107073452 TGGTGGGGGTGGGGGGGAGGGGG - Intronic
978379652 4:108113448-108113470 TTGTGGGGGTGGGAGGGAAACGG + Intronic
978629712 4:110730324-110730346 CTGTCGGGGTGGGGAGGGGAGGG - Intergenic
978759744 4:112343751-112343773 TAACGGGGGTAGGGGGGAGAAGG - Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979578937 4:122332777-122332799 CTGTGGGGGGTGGGGGGAGGGGG - Intronic
979776572 4:124596023-124596045 CTGTGGGGGTTGGAGGGAGCAGG + Intergenic
980117246 4:128691314-128691336 CTAAGGGGGTGCGCGTGAGAGGG - Intergenic
980156760 4:129117384-129117406 CTATGGGGCTGGGGGACAGTGGG - Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
980629290 4:135412252-135412274 CTCTGGTGGTGGGGAGGGGAAGG + Intergenic
981042124 4:140233170-140233192 CGGTGGGGGTGGGGGGGGGTGGG - Intergenic
981171030 4:141623607-141623629 CCTTGGGGGTGGGGGGTAGGTGG - Intergenic
981194473 4:141902739-141902761 CTATGGGGGAGGGAGGGTGTTGG - Intergenic
981229080 4:142331906-142331928 CTGGGGGGGTGGGGGGTGGAGGG + Intronic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
981523142 4:145685496-145685518 CTAAGGGGGTGTGTGTGAGAGGG + Intronic
981550633 4:145937851-145937873 GTTTGGGGGTGTCGGGGAGAGGG - Intronic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
981743822 4:148032328-148032350 ATATGGGGGGGGGGGGGGGGGGG - Intronic
981997321 4:150988937-150988959 AATTGGGGGTGGGGGGGACACGG + Intronic
982116879 4:152105428-152105450 TTCTGGGGGTGGGGGGTTGAGGG - Intergenic
982188779 4:152831925-152831947 CTCGGGGGGTGGGGGGCAAAGGG - Intronic
982288898 4:153760285-153760307 AAATGGCGGTGGGGGGGCGAGGG + Intergenic
982955708 4:161763528-161763550 CTATGGGTGTAGGGGAGAGAAGG + Intronic
983315594 4:166129084-166129106 ATACTGGGGTGGTGGGGAGAGGG - Intergenic
983938688 4:173520795-173520817 AGATAGGGGTGGGTGGGAGAGGG + Intergenic
983971281 4:173877581-173877603 GTCTGGTGGTGGGGGAGAGAAGG - Intergenic
984117718 4:175703174-175703196 TTTTGGGGGTGGGTGGAAGATGG + Intronic
984977464 4:185242366-185242388 CGTTGGGGGTGGGGGGTTGAGGG - Intronic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985432413 4:189893940-189893962 CAGAGGGGGTGGGGGGGAGGCGG + Intergenic
985577766 5:681667-681689 CGCTGGGGGTGGGTGGGAGTGGG - Intronic
986291183 5:6400408-6400430 GTAGGGGGGTGGTGGGTAGATGG + Intergenic
986321374 5:6634412-6634434 CTGTGGGGGCGGGGGGGAGGGGG + Intronic
986347191 5:6846253-6846275 CTTCGGGGGTGGAGGGGAGGGGG - Intergenic
986367022 5:7042635-7042657 CTAAGGGGGTGCGTGTGAGAGGG + Intergenic
986402628 5:7395565-7395587 CTGTGGGGGAGGGTGGGAGCAGG + Intergenic
986551653 5:8962758-8962780 CTGTGGGGTTTGGGGGGATAGGG - Intergenic
986571276 5:9168519-9168541 CCATGTGGGTGAGGGGGAGGAGG + Intronic
986797081 5:11222964-11222986 CATTGGAGGTGGGAGGGAGAAGG + Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987595155 5:19988369-19988391 GTGGGGGGTTGGGGGGGAGAAGG - Intronic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
988081986 5:26426462-26426484 TTGTGGGGGTGGGGGGGAGGGGG + Intergenic
988207070 5:28152318-28152340 GGATTGGGGTGTGGGGGAGATGG - Intergenic
988607344 5:32690198-32690220 CTAAGGGAGGGAGGGGGAGAGGG - Intronic
988735478 5:34016215-34016237 GTGCGGGGGTGGTGGGGAGAGGG + Intronic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
989105268 5:37857242-37857264 GTGGGGGGGTCGGGGGGAGATGG - Intergenic
989400937 5:41006819-41006841 CTTTGGGGGTTTGGGGGAAAGGG + Intronic
989702432 5:44286255-44286277 GTTGTGGGGTGGGGGGGAGAGGG - Intergenic
989809326 5:45653764-45653786 CTATTGTGGGTGGGGGGAGAGGG + Intronic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
990852695 5:60224847-60224869 ATCTGGGGGAGGCGGGGAGAGGG + Intronic
990945944 5:61249619-61249641 CTATCGGGGGGGCTGGGAGAGGG - Intergenic
991718217 5:69471873-69471895 CTGTAGGGGGGTGGGGGAGAAGG + Intergenic
991743655 5:69709535-69709557 CTACGGGGGTGGGGGAAAGAGGG + Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991795228 5:70289267-70289289 CTACGGGGGTGGGGGAAAGAGGG + Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991833370 5:70720820-70720842 CTACGGGGGTGGGGGAAAGAGGG - Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991934178 5:71785566-71785588 CTTTGGGGGTGGGGCTGGGAGGG - Intergenic
992091940 5:73325113-73325135 GAATGGGGGTGGGGGAGAAATGG - Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992261120 5:74971259-74971281 CTAAGGGGGTGCGCGTGAGAGGG - Intergenic
992271232 5:75064891-75064913 CTATGCGTGTGGGGTGGAGGTGG - Intergenic
992314400 5:75537270-75537292 GCATGGGGGTGGGGGGCACAGGG + Intronic
992844867 5:80736223-80736245 TTAGGGGGGTGGGTGGGTGAGGG - Intronic
993069663 5:83144553-83144575 CCGTGGGGGTGGGGGGGGGGGGG - Intronic
993095650 5:83474702-83474724 CAATGGGGGCGGGGCGGGGAAGG + Intronic
993881196 5:93363418-93363440 CACTGGGGGTGGGGTGGGGATGG + Intergenic
994748998 5:103715351-103715373 CTGAGGGGGTGGGGGGGTGGGGG + Intergenic
994938600 5:106289779-106289801 TTTTGGGGGGGTGGGGGAGATGG + Intergenic
995799510 5:115978809-115978831 CCATGGGGCTGGGGGTGACAGGG + Intronic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
996393817 5:122992323-122992345 TTATGTGGGTGGGTGGTAGATGG - Intronic
996412374 5:123172208-123172230 GGATGGAGGTGGCGGGGAGAGGG + Intronic
996606312 5:125327693-125327715 ATTTGGGGGTGGGGTGGAGGAGG + Intergenic
996787232 5:127252654-127252676 CTCTGGGGATGGGTGGGATAGGG + Intergenic
997215778 5:132109324-132109346 CTGTTGTGGTGGGGGGGAGCGGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997250802 5:132387159-132387181 CCATGTGGGTGTGGGTGAGAGGG + Intronic
997305241 5:132831210-132831232 CTACCGGGGTGGGGGAGAGGGGG + Intergenic
997321816 5:132983941-132983963 CCGTGGGGGGGGGGGGGAGAGGG + Intergenic
997523094 5:134535682-134535704 CTCTGTGGGTGGGTGGGAGAGGG + Intronic
997616107 5:135247330-135247352 CCCTGGGGGCGTGGGGGAGAAGG + Intronic
997634897 5:135398275-135398297 CGCTGGGGGTGGGGTGGAGTGGG - Intronic
997795555 5:136806390-136806412 ATATAGGGGAGGGGGGGAGGGGG + Intergenic
997824071 5:137090921-137090943 AGATGGGGGTGGGGAGGAGAGGG - Intronic
997862352 5:137429341-137429363 TAATGGGGGTGGGGGTGAGCTGG - Intronic
997941241 5:138159479-138159501 TAATGGGGGTGGGTGGCAGAGGG - Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998005447 5:138653977-138653999 ATTTGGGGGAGGGTGGGAGAAGG + Intronic
998130843 5:139650395-139650417 ATGCGGGGGTGGGGGGGACAGGG - Intronic
998394874 5:141811963-141811985 CTAAGGGGGTGGGGGGGCCTGGG + Intergenic
998395733 5:141816687-141816709 AGATGGGGGATGGGGGGAGATGG - Intergenic
999386580 5:151157862-151157884 CTAGAGGGGTGGGGTGGAGGAGG - Exonic
999435416 5:151559673-151559695 AAATGGGGTTGGGGGAGAGAGGG - Intronic
1000089693 5:157919530-157919552 CTAAGGGGGTGCGTGTGAGAGGG + Intergenic
1000858599 5:166430322-166430344 CTATGGGGGTATGGGTGGGAGGG - Intergenic
1001040910 5:168334542-168334564 AAATGGGGGTGGAGGGGGGAGGG - Intronic
1001139700 5:169134457-169134479 CTATGGGGGAGTGGGAGAAAGGG - Intronic
1001528792 5:172447879-172447901 CTATGGGGTGGGGTGGGGGATGG + Intronic
1001822867 5:174723681-174723703 TAATGGGGGTGGGGGGGAGGAGG - Intergenic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002104930 5:176875351-176875373 CTCTGGGGGAGGGTGGGAGACGG - Intronic
1002158285 5:177300058-177300080 CTATGGGGGCGGGGGGGGGGGGG - Exonic
1002275832 5:178103922-178103944 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
1002633910 5:180597875-180597897 GTATTGGGGTGGGGAGGACAGGG - Intergenic
1002992524 6:2250998-2251020 GGATGGGGGTGGGAGGGAGGTGG - Intergenic
1003127221 6:3364879-3364901 CTCTGGCGGTGTGGTGGAGAGGG + Intronic
1003551538 6:7106497-7106519 CTACGGGGGCGGGGGGGGGGGGG + Intergenic
1003592222 6:7445892-7445914 GCATGGGGGTGGGTGGGAGAAGG + Intergenic
1003866983 6:10372217-10372239 TTCTGGTGGTGGGGGGGAGCTGG + Intergenic
1003943242 6:11049248-11049270 CTGTCGGGGTTGGGGGGTGATGG - Intergenic
1004228644 6:13811787-13811809 ATGTGGGGGTGGGGGTGAGGAGG - Intronic
1004549092 6:16629326-16629348 CTCAGGGGGAGGCGGGGAGAAGG - Intronic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1004978674 6:20997529-20997551 CCACGGGGGTGGCGGGGGGAGGG + Intronic
1005005224 6:21281407-21281429 AGATGCGGGTGGGGTGGAGAGGG - Intergenic
1005084907 6:21995281-21995303 CGGGGGGGGTGGGGGGGGGATGG + Intergenic
1005394811 6:25370313-25370335 TTATGGGGGTAGGCGGGGGAAGG + Intronic
1005479030 6:26237740-26237762 CTATGGTGGTGGTGGGGATGGGG - Intergenic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1005717683 6:28567096-28567118 CTAAGGGGGTGCGTGTGAGAGGG + Intergenic
1005825001 6:29627453-29627475 ACATGGGGGTGGGTGGGAGGTGG - Intronic
1005843944 6:29763058-29763080 CTCTGGAGGGGGTGGGGAGAGGG + Intergenic
1006136469 6:31899245-31899267 TCATGGGGGTGGGGGGGATAGGG - Intronic
1006197519 6:32254981-32255003 GGATGGGGGTGGGGAGGCGAGGG + Intergenic
1006300992 6:33193417-33193439 TTGTCGGGGAGGGGGGGAGAGGG - Intergenic
1006303497 6:33206352-33206374 CTATGAGAATGGTGGGGAGAGGG - Intronic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006984188 6:38166647-38166669 CTATGGGAGTGCGGGGGAGGTGG - Intergenic
1007152018 6:39703020-39703042 AAATGGGGGTGGGGTGGAGTTGG - Intronic
1007178828 6:39913878-39913900 CTGTGGGGGTGTGGGGGAAGAGG - Intronic
1007361365 6:41358703-41358725 CTATGGGGGCGGGCGGGGGGTGG - Intergenic
1007643747 6:43364436-43364458 CTAGGCGGGTGGGGGAGAGCTGG - Intronic
1007838337 6:44695263-44695285 GTTGTGGGGTGGGGGGGAGAGGG - Intergenic
1008071929 6:47106856-47106878 GTATGGGGGGGGGGCGGGGAGGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008608812 6:53167055-53167077 TTATGGGGGTGGGGTGGGGATGG - Intergenic
1008645684 6:53511896-53511918 CTTTGGGGGGGGGGGTGGGAGGG + Intronic
1008727880 6:54442981-54443003 CTGTGGGGGTGGGGGAGCGGTGG + Intergenic
1009478149 6:64121062-64121084 CTATGGGGGAGGGGGGCACATGG - Intronic
1010134918 6:72540421-72540443 TTGTGGGGGTGGGGGGGTGGGGG - Intergenic
1010410356 6:75554589-75554611 ATATGGTGGGGGTGGGGAGAGGG - Intergenic
1010550156 6:77211736-77211758 ATTTGGGGGGTGGGGGGAGACGG - Intergenic
1010726410 6:79338857-79338879 TTGTGGGGGTGGGGGGGGGCGGG - Intergenic
1010890244 6:81298948-81298970 CTAAGGGGATGAGGGAGAGAAGG + Intergenic
1011046719 6:83092553-83092575 ATATGGTGGGGGGGGGGGGAGGG - Intronic
1011223743 6:85084841-85084863 CTATGGGGGTGGGGGGTGAGGGG + Intergenic
1012392840 6:98762645-98762667 GTTTGGAGGTGGGGGGGTGAGGG - Intergenic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1012979557 6:105815258-105815280 CTAGGGAGGTGGGGAGGGGAGGG - Intergenic
1013532142 6:111029865-111029887 GAATGGGGGTAGGGGTGAGATGG - Intergenic
1013896348 6:115093165-115093187 GTTAGGGGGTGGGGGAGAGAGGG - Intergenic
1013902401 6:115173516-115173538 TTATGTGGTTGGGGTGGAGACGG + Intergenic
1013997153 6:116322078-116322100 CTAAGGGGGTGCGTGTGAGAGGG + Intronic
1014633091 6:123811421-123811443 GTGGGGGGGTGGGGGAGAGAGGG + Intronic
1015171539 6:130260439-130260461 CTATGGGGGTCCGTGAGAGAGGG - Intronic
1015691214 6:135926082-135926104 TTTTGGGGGGGGGGGGGGGAGGG + Intronic
1015788954 6:136947153-136947175 CAACGGGGGTGGGGGGGGGACGG - Intergenic
1015917606 6:138233379-138233401 TTTTGGGGGGTGGGGGGAGATGG + Intronic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1017482441 6:154871141-154871163 GTTTTGGGGTGGGGGGGAGGTGG - Intronic
1018153722 6:160965507-160965529 CTTGGGGGGTTGGGGGAAGATGG - Intergenic
1018368741 6:163148955-163148977 CTATGGCGGGGGGGGGGGGGGGG + Intronic
1018542527 6:164898035-164898057 CTTTGGGGGTGGGGGAAAAAAGG - Intergenic
1018640049 6:165897415-165897437 ATTTGGGGGTGGGGGAGATAGGG + Intronic
1018651531 6:165995767-165995789 GTCTGGGGGTGGGAGGGAGATGG - Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019207682 6:170376474-170376496 ACACGGGGGTGGGGGGGAGGCGG + Intronic
1019376226 7:693880-693902 TTGTGGGGGTGTGGGGGACATGG - Intronic
1019414144 7:919782-919804 AGATGGGGGAGGGAGGGAGATGG + Intronic
1019414161 7:919817-919839 AGATGGGGGAGGGAGGGAGATGG + Intronic
1019427149 7:983150-983172 CTATAAGGGTGCGGGGGGGACGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1020076587 7:5262753-5262775 CTGTGGTGGTGGGGTGGAGGGGG - Intergenic
1020141532 7:5614640-5614662 CTTTGAGGGAGGGGAGGAGATGG + Intergenic
1020283538 7:6663771-6663793 ATGTGGAGGTGGGGGGGTGAAGG + Intergenic
1020983177 7:15097116-15097138 CTATTGGGGCGGGGGGGGGCGGG - Intergenic
1021278451 7:18685710-18685732 CTAAGGGGGGTGGGGTGAGATGG + Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021731581 7:23600375-23600397 ATATGGTGGTGGGGGGGGGGGGG - Intronic
1021843422 7:24741884-24741906 CTATAGGGGAGGGGAGGACAGGG - Intronic
1022007373 7:26278246-26278268 CTCGGGGGGAGGGGGGGAGGCGG + Intergenic
1022150990 7:27606166-27606188 ATATGGGGGAGGGGGTAAGATGG + Intronic
1022444377 7:30457730-30457752 CTGTGGGGTTTGGTGGGAGACGG + Intronic
1022452588 7:30528830-30528852 CTTTGGGGTTTGGAGGGAGAAGG + Intronic
1022504834 7:30903424-30903446 TTATGGGGCTGGGGAGGAGTAGG + Intergenic
1023346028 7:39271987-39272009 GTGTGGGGGTGGGGGAGAGGGGG + Intronic
1023375736 7:39553174-39553196 CTTTGGGGGCAGGGGGGAGGGGG - Intergenic
1023734082 7:43219554-43219576 CTAAGGGGGTGTGTGTGAGAGGG + Intronic
1023963235 7:44945191-44945213 GAATGGGGGTGGGAGGGAGGTGG + Intergenic
1023990179 7:45124095-45124117 CCAGGGGGGTGGTGGGGAGGAGG + Intergenic
1024395752 7:48864768-48864790 ATTTGGGGGTGGGGGTGGGAAGG + Intergenic
1024399482 7:48907508-48907530 ATTTGGGGGTGGGGGTGGGAAGG - Intergenic
1024549944 7:50554305-50554327 CTGTGGGGGGCAGGGGGAGAGGG + Intronic
1024624004 7:51188585-51188607 CCTTGGGGGTGGGGTGGAAAGGG + Intronic
1024747612 7:52426724-52426746 CTATAGGGGTGGGAGGGAGAAGG - Intergenic
1025678552 7:63663509-63663531 CTATGGGGGGGGTGGGGGGGCGG + Intergenic
1026045178 7:66902094-66902116 CTGTTGGGGTGGGCGGGAGCTGG - Intergenic
1026117285 7:67506574-67506596 CTATGGGGTTGCTGGGGAGAGGG + Intergenic
1026145564 7:67743596-67743618 GTACGGGGATGGGGTGGAGAGGG + Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026376782 7:69759771-69759793 ATATGGGGGGGGGGGGGGGGGGG - Intronic
1026522351 7:71128422-71128444 CAAGGGGGGTGGGGGGGAAATGG + Intergenic
1026785399 7:73298976-73298998 ATATGGGGGTGGGGTGGGGGTGG + Intergenic
1026829003 7:73600286-73600308 CGAGTGGGGTGGGGGCGAGAGGG + Intronic
1026829131 7:73600639-73600661 CGAGTGGGGTGGGGGCGAGAGGG + Intronic
1026829146 7:73600678-73600700 CGAAAGGGGTGGGGGCGAGAGGG + Intronic
1026853374 7:73738280-73738302 CTTTGGGGCTGGGCGGGAGTGGG - Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027108675 7:75420957-75420979 ATATGGGGGTGGGGTGGGGGTGG - Intronic
1027202938 7:76074282-76074304 CCATCGGGGTGGGCGGGAGCTGG + Intergenic
1027374595 7:77537391-77537413 CTAGGGCGGTGGGGAGGAGGAGG + Exonic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1027652806 7:80891354-80891376 TTATGGGGGAGGGAGGGATAAGG - Intronic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1028253686 7:88565950-88565972 CTTTGGGGGGGGGGGGGGGGGGG + Intergenic
1028420197 7:90624207-90624229 ATAAGGGGGTGAGGGTGAGAGGG - Intronic
1028616639 7:92776057-92776079 CTGTCGGGGTGGGGGGGTTAGGG - Intronic
1028832879 7:95345451-95345473 CTCTGGGGGTGGGGGCGGGTAGG + Intergenic
1029407128 7:100382005-100382027 CTACGGGGGTGGGGTGGGGGTGG - Intronic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1029587738 7:101486318-101486340 CTGTGGGGTTGGGGGGGACGTGG - Intronic
1030338176 7:108347917-108347939 GTATGGGGGTGGAGAGGAGGCGG - Intronic
1030422848 7:109330172-109330194 CAATGGGGGAGGGTGGGAGGAGG + Intergenic
1030491239 7:110237515-110237537 CTATTGGGGGGGGGGGGAGGGGG + Intergenic
1030866170 7:114704102-114704124 CAAAATGGGTGGGGGGGAGAGGG + Intergenic
1030947260 7:115738968-115738990 GTTGTGGGGTGGGGGGGAGAGGG + Intergenic
1031052804 7:116961930-116961952 GTCAGGGGGTGGGGGGGTGAGGG - Intronic
1031155700 7:118108867-118108889 GTTTGGGGGTGGGGGGCTGAGGG + Intergenic
1031448060 7:121879332-121879354 CTCTGGTGTTGGGGAGGAGAGGG + Intronic
1031636503 7:124107624-124107646 ATATCGGGGTGGGGGGCAAAAGG + Intergenic
1031731212 7:125303020-125303042 TTTTGGGGGTGGGGGTGAGGGGG - Intergenic
1032281480 7:130506313-130506335 CCAGAGGGGTGGGGGGGAGGGGG - Exonic
1032290262 7:130583341-130583363 CTGTGGGGGGTGGGGGGAGTGGG + Intronic
1032322734 7:130899245-130899267 TTATGGGGGGTGGGAGGAGATGG + Intergenic
1032413855 7:131720925-131720947 CTATAGGGGTCGGGAGGAAAGGG - Intergenic
1032676027 7:134130281-134130303 CTCTGGGGGGGGGGGGAAGCTGG - Intronic
1032731183 7:134644716-134644738 CTTTTGGGGTGAGGAGGAGAAGG + Intergenic
1032754686 7:134878067-134878089 CTCTGTGGGTGGGGAGGTGAAGG - Intronic
1033277721 7:139985297-139985319 CTAGAGGGGTGGGGGGTGGATGG - Intronic
1033361423 7:140640974-140640996 CTCTCGGGGTGGGGGAGAGGTGG + Intronic
1033423796 7:141225273-141225295 CTATGGTGGGGGAGGGGTGAAGG - Intronic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1034879286 7:154751135-154751157 CTAGGGGGCTGGGTTGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035421110 7:158729633-158729655 GTATGGAGGTGCTGGGGAGAGGG + Intergenic
1035427540 7:158790526-158790548 CTATGGGGGGTGTGGGGGGAAGG + Intronic
1035436508 7:158863776-158863798 GTGTGGGGGCGGGGGGGAGCGGG + Intronic
1035449441 7:158966445-158966467 CTATGGGGGTGTGAAGGAGTTGG + Intergenic
1035650026 8:1257197-1257219 CTCTGTGGGTGAGCGGGAGAGGG - Intergenic
1035905352 8:3503811-3503833 CAAGGGGGGATGGGGGGAGATGG - Intronic
1036103304 8:5811439-5811461 CTAGGGGGCTGGGGAGAAGAGGG + Intergenic
1036195064 8:6707293-6707315 TTATGGTGGTGGTGGGGAGGGGG + Intergenic
1036210504 8:6836462-6836484 GGATGGGGGTGGGGTGGAGCAGG + Intergenic
1036235397 8:7035472-7035494 GTATGGGGGCTGGGAGGAGAGGG - Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037521089 8:19681393-19681415 CGATGGGGATGGGGGCGCGAAGG - Intronic
1037588541 8:20294683-20294705 CTTTGGGGGTGGCGGGGAGCAGG + Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037759026 8:21729752-21729774 CTTTGGGGGTGGCGGTGGGAGGG - Intronic
1037789485 8:21924444-21924466 TTAGTGGGGTGGGGGGGGGAGGG - Intronic
1037953086 8:23031494-23031516 ATTTGTGGGTCGGGGGGAGAGGG - Intronic
1038126932 8:24685121-24685143 CTGTGGGGGGTGGGGGGAGGGGG + Intergenic
1038244972 8:25846952-25846974 GTATGGGGGTAGGGGGTATAGGG + Intronic
1038437887 8:27549543-27549565 CTATTGTGGGTGGGGGGAGAGGG - Intergenic
1038498426 8:28023783-28023805 GGATTGGGGTGGGGGGAAGAGGG - Intronic
1038536040 8:28353282-28353304 GCCTGGGGGTGGGGGGGCGAGGG + Exonic
1039273793 8:35912600-35912622 TTATGGGAGTGGGGTGGAGGTGG + Intergenic
1039446852 8:37639841-37639863 ATATGGGGGTGGTGGGGAAGGGG + Intergenic
1039468715 8:37800923-37800945 CCATGGGAATGTGGGGGAGATGG - Intronic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1039772997 8:40707217-40707239 AGATGGGGGTGGGGGGGTGGGGG - Intronic
1039859620 8:41445692-41445714 ACTTGGGGGTGTGGGGGAGAGGG + Intergenic
1040948201 8:52907402-52907424 TTTTGGGGGTGGGGTGGGGACGG + Intergenic
1040998759 8:53428569-53428591 CTATGGGGGTGGGCCAGAGATGG - Intergenic
1041023873 8:53664983-53665005 CTGTGGGGGTGGGGTGGGGTAGG - Intergenic
1041054903 8:53974529-53974551 GGGTGGGGGTGGGGGGGGGACGG + Intronic
1041637155 8:60156783-60156805 TGATGGGGGTGGTGGGGGGAGGG - Intergenic
1041924290 8:63220694-63220716 CGAAGGGAGTGGGGGAGAGAAGG - Intergenic
1042224421 8:66504399-66504421 TTCTGGGGGTGGGGGGGCGGTGG - Intronic
1042465173 8:69121383-69121405 CTTTGGGGTTTGGGGGGAGTGGG - Intergenic
1042856053 8:73268739-73268761 TAATGGGCGTGGGAGGGAGAGGG + Intergenic
1042860557 8:73309058-73309080 GTATGTGGGTAAGGGGGAGATGG - Intronic
1042953018 8:74220544-74220566 TTAAGGGGGTGGGTGGGAGGTGG - Intergenic
1043291357 8:78605613-78605635 CTATGTGGGGGGTGGGTAGAGGG - Intergenic
1043486642 8:80704592-80704614 CTCTGGGGGTGGTGGGGGAAAGG + Intronic
1043844933 8:85152886-85152908 CCATGGGGGTGGGGGGGTAGGGG - Intergenic
1043983598 8:86668330-86668352 CTATCGGGGGGTGGGGGACAAGG + Intronic
1044111617 8:88282079-88282101 TTTTGGGGGGGGGGGGGCGACGG + Intronic
1044270768 8:90240447-90240469 GTTGTGGGGTGGGGGGGAGAGGG + Intergenic
1044418337 8:91961660-91961682 CTATGAGTGTGGTGGGGAGGGGG + Intronic
1045304833 8:100950654-100950676 CCGTGGGGGGGGGGGAGAGATGG + Intronic
1045985594 8:108246273-108246295 CTAAGGGGGTGTGGGGGGGGGGG + Intronic
1046027756 8:108745962-108745984 CTAAGGGGGTGCGTGTGAGAGGG - Intronic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1047171095 8:122492964-122492986 TGATGGGGGAGGGTGGGAGAAGG - Intergenic
1047436961 8:124842825-124842847 CTTTGGGGGTGGGGTTGAGAAGG + Intergenic
1047903566 8:129449409-129449431 GGAAGGGAGTGGGGGGGAGAGGG + Intergenic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048953749 8:139517164-139517186 CTATGGGGGATGGGGTGAGTGGG + Intergenic
1049157401 8:141075411-141075433 CTTAGGCGGTGGGGTGGAGAGGG - Intergenic
1049201040 8:141340804-141340826 CAATGGGAGTGGGGGAGAGATGG + Intergenic
1049221991 8:141432609-141432631 CTCGGGGGGTGGCGGGGACAGGG + Intergenic
1049280714 8:141742761-141742783 CAAGTGGGGTGGAGGGGAGAGGG - Intergenic
1049304486 8:141893708-141893730 CTGAGGGGGTGGGGAGGAGCTGG - Intergenic
1049549997 8:143252778-143252800 GCATGGGGGTGAGGGGGTGAGGG + Intronic
1049643140 8:143724573-143724595 GAATGGGGCTGGTGGGGAGAGGG + Exonic
1049689387 8:143952042-143952064 ATAGGGCGGTGGGGGGGAGTGGG + Intronic
1049732295 8:144184912-144184934 CTATGGGGCTGGGGCAGAGCAGG + Intronic
1049784321 8:144443419-144443441 CTGTGGGGGTTAGGGGGAGCAGG - Intronic
1049839809 8:144763680-144763702 CTGTGGGGGTAAGGAGGAGAAGG + Intergenic
1050158213 9:2690366-2690388 CTTTGGGGGCTGGGTGGAGAAGG + Intergenic
1050214709 9:3309577-3309599 GAATGGGGGTGGGGAGGAGAGGG + Intronic
1050336715 9:4596557-4596579 ATTTGGGGGTGGTGGGGAGGAGG + Intronic
1050398655 9:5227705-5227727 CTGTGGGGGTGGTGGGGCAAGGG + Intergenic
1050408154 9:5331663-5331685 CTAGGGGGGTGGGGGGCTGTGGG + Intergenic
1050773227 9:9230171-9230193 CAATGGGGGTGGGTGGGTGCAGG + Intronic
1050822082 9:9891232-9891254 GTATGGGGATGGGGATGAGATGG + Intronic
1050861959 9:10446116-10446138 CAAAGGGGGTGGGGTGGAGAAGG - Intronic
1051041782 9:12820496-12820518 TTTTGGGGGGGGGGGGGGGACGG - Intronic
1051604590 9:18907370-18907392 CTGTGGGGTTGGGAGGGAGGGGG - Intronic
1051787958 9:20766971-20766993 CTGTGGTGGGGTGGGGGAGAGGG - Intronic
1052475262 9:28951368-28951390 CAATGGGGGTGGGGGGGCACTGG + Intergenic
1052507717 9:29377413-29377435 CTATGGGGGTCTGCGTGAGAGGG - Intergenic
1052728873 9:32262310-32262332 TTATGGGGGAGAGGGAGAGAGGG - Intergenic
1052819727 9:33129175-33129197 CTCTGGGGGATGGGGGGAGGTGG + Intronic
1052885617 9:33644846-33644868 CTATGGGGGGGGGGGGGGGCGGG + Intergenic
1052988686 9:34505970-34505992 ACATGGGGCTGGTGGGGAGAAGG + Intronic
1053281928 9:36826126-36826148 AGCTGGGGGTGGGGGGGGGAGGG - Intergenic
1053311837 9:37025413-37025435 CTGTTGGGATGGGGGGGAGCGGG + Intronic
1053533707 9:38905619-38905641 CTATGGGGAGAGGGTGGAGAAGG + Intergenic
1054205933 9:62130048-62130070 CTATGGGGAGAGGGTGGAGAAGG + Intergenic
1054632427 9:67458322-67458344 CTATGGGGAGAGGGTGGAGAAGG - Intergenic
1054836015 9:69675111-69675133 TCATGGGGGTGGGGGAGGGAGGG - Intergenic
1054894481 9:70293326-70293348 GTAGGGGGGTGGGGGAGAGGGGG - Intronic
1055403388 9:75948305-75948327 TTCGGGGGGTGGGGGGGCGAGGG - Intronic
1055758458 9:79580973-79580995 CTATGTGTGTGGGGGTGGGAAGG + Intronic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056112581 9:83410295-83410317 CTGTGGGGGAGGGAGGGACAAGG - Intronic
1056397162 9:86192520-86192542 TTTGGGGGGTAGGGGGGAGATGG - Intergenic
1056764390 9:89435983-89436005 ATTTGGGGGTGGGGGGCAGCGGG - Intronic
1056775888 9:89512316-89512338 GTATGGAGGTGAGGGGGAGATGG + Intergenic
1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG + Intergenic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057768543 9:97945490-97945512 GTCTGGGGGTGGGGGGCAGGGGG - Intergenic
1057775058 9:98001155-98001177 AAAGGGGGGTGGCGGGGAGAAGG - Intronic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1058075459 9:100646028-100646050 CTGTGAGGGGTGGGGGGAGAGGG - Intergenic
1058596502 9:106621321-106621343 CTATGGAGGTTGGGGGGGGTGGG - Intergenic
1058781387 9:108339518-108339540 CTTTTGGGGTGGGGGTGGGAGGG + Intergenic
1058862063 9:109126274-109126296 CTATGGGAGTGGGAGGGATGAGG - Intergenic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059630609 9:116117830-116117852 GTCTGGGGGTGGGGGGGCTAGGG - Intergenic
1060104785 9:120866821-120866843 CCTTGGGCGTGGTGGGGAGAGGG - Intronic
1060544435 9:124451999-124452021 CTCTGGGGGTGGGTGGGAGGGGG - Intronic
1060557409 9:124515521-124515543 CTCTGGGGGTGGGGTGGGGTGGG + Intergenic
1060622297 9:125078583-125078605 GTATAGGGGTGGTGGGGGGAAGG - Intronic
1060857522 9:126926787-126926809 CTAGGTGGATGGGGAGGAGAAGG + Intronic
1061191384 9:129084789-129084811 CACTGGGGGTGGGGTGGGGAGGG - Intronic
1061244103 9:129392451-129392473 CTTTGGGGGGGCGGGGTAGAGGG - Intergenic
1061421275 9:130474057-130474079 CTGTGGGGGGGGGGGGGTGCGGG - Intronic
1061464655 9:130768129-130768151 GTATGGGGGTTGGGGGGAAGGGG - Intronic
1062027477 9:134347149-134347171 CTATGGGGGTGGCAGGCAGGTGG + Intronic
1062094430 9:134695590-134695612 CTATGGGGGTACAGGGGAGTGGG - Intronic
1062107558 9:134764120-134764142 GCATGGGGGTGGGGGGTACAGGG + Intronic
1062132705 9:134908568-134908590 CCATGGGGCTTGGGGGGAGAGGG + Intronic
1062335903 9:136067310-136067332 CAGTGGGGGTGGGGGAGGGATGG + Intronic
1062405774 9:136395554-136395576 CTCTGGGGGTGGGGAGGTGTGGG + Intronic
1062444620 9:136588428-136588450 GAATGGGGGTGGGGGGGGGGCGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062517436 9:136943672-136943694 CTTGGGGGGTGGGGGGTACAGGG - Intronic
1185849801 X:3474747-3474769 CTCGGGGGGTGGGGCTGAGATGG + Intergenic
1186153447 X:6700920-6700942 AAATGGGGGTGGGGTGGGGAGGG + Intergenic
1186441478 X:9590845-9590867 CTGTGGGGGTGGGGAGGATGGGG + Intronic
1186776083 X:12865869-12865891 CTAAGGTGGTGGGGGGAGGATGG - Intergenic
1187077196 X:15947035-15947057 CGGTGGGGGTAGGGGGGAGGCGG + Intergenic
1187163558 X:16785603-16785625 ATATGATGTTGGGGGGGAGAGGG - Intergenic
1187253866 X:17623482-17623504 GGATGGGGGTAGGGGGGAGGTGG + Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187950247 X:24464492-24464514 CTATGGTGGTGGTGTAGAGAAGG + Intergenic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1189732500 X:44036069-44036091 CCTTGGGGGTGGGGGGTAGGGGG + Intergenic
1189834782 X:45008497-45008519 CAATGGGGGTGTGGGGGTGAGGG - Intronic
1189866062 X:45328499-45328521 GTTTGGGGTTGGGGTGGAGATGG - Intergenic
1190416740 X:50187575-50187597 TTGGGGGGGTGGGGGGGAAAGGG + Intergenic
1190859584 X:54331056-54331078 AAATGGGGGTGGGTGGGAGGAGG + Intronic
1190914648 X:54802147-54802169 TTGAGGGGGTGGGAGGGAGATGG + Intergenic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191714557 X:64185441-64185463 ATATGGGGGTGGGGGTGGGGGGG - Exonic
1191715684 X:64192170-64192192 CCAAGGAGGTGGGGAGGAGATGG - Exonic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1191850496 X:65582470-65582492 GTTTGGGGGTGAGGGTGAGAAGG + Intergenic
1191908544 X:66122400-66122422 CTCTGGGGGTGGGGGTGAGGGGG + Intergenic
1191927395 X:66328396-66328418 CTGGGGGGGGGCGGGGGAGAGGG + Intergenic
1192203501 X:69081863-69081885 CTCTGGGGGTGGGCGGGTGCAGG - Intergenic
1192251439 X:69417041-69417063 CCACGGCGGGGGGGGGGAGAGGG - Intergenic
1192381509 X:70621142-70621164 CTATGCATGTGGTGGGGAGAGGG + Intronic
1192503943 X:71669732-71669754 TGATAGGGGTGGAGGGGAGAGGG + Intergenic
1192510037 X:71716156-71716178 TGATAGGGGTGGAGGGGAGAGGG - Intronic
1192516660 X:71765397-71765419 TGATAGGGGTGGAGGGGAGAGGG + Intronic
1192529168 X:71871279-71871301 TGATAGGGGTGGAGGGGAGAGGG - Intergenic
1192552765 X:72067263-72067285 GCATGGGGGTGGTGGGGAGGAGG - Intergenic
1192743759 X:73918473-73918495 CTAAGGGGGTGCGCGTGAGAGGG + Intergenic
1192917305 X:75666337-75666359 CTCTGGGGGTGGAGCAGAGAGGG + Intergenic
1193032715 X:76916703-76916725 ACATGGGGGTGGGGGGAGGAGGG + Intergenic
1193091683 X:77500550-77500572 CTGTAGGGGTTGGGGGGTGAGGG + Intergenic
1193096698 X:77556406-77556428 AGGTGGGGGTGGGGGAGAGAGGG + Intronic
1193278274 X:79617428-79617450 GCATGGGGGTGGTGGGGAGGAGG - Intergenic
1193349050 X:80436537-80436559 CTATCGGGGTTGGGGGGCTAGGG - Intronic
1193380125 X:80808757-80808779 ATATGGGGGGGGGGGGGAAGGGG + Intronic
1193659958 X:84245529-84245551 CTCTGGCGGTGGGGGGGCGGGGG - Intergenic
1193774380 X:85623903-85623925 CTAAGGGGGTGTGGGTGACAGGG - Intergenic
1194297665 X:92146333-92146355 TTTGGGGGGTGGGGGTGAGAGGG + Intronic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195138166 X:101931760-101931782 CTATGGCGGCGGCGGGGAGGGGG - Exonic
1195159635 X:102158326-102158348 GTCTGGGGGTGGGGGGGCAAGGG - Intergenic
1195168558 X:102244580-102244602 CTTGGGGGGTGGGGGAGATAAGG - Intergenic
1195190299 X:102442507-102442529 CTTGGGGGGTGGGGGAGATAAGG + Intronic
1195263784 X:103160590-103160612 CAATGGAGTTGGGGTGGAGAAGG + Intergenic
1195329216 X:103783005-103783027 GTTTGGGGGTGGGGAGGAGTTGG + Intronic
1195397460 X:104426507-104426529 GTATGGGGGTGGTGGGGGTAGGG + Intergenic
1195691429 X:107628839-107628861 GACTGGGGGTTGGGGGGAGAGGG + Intronic
1195803677 X:108737989-108738011 CTGGGGTGGTGGGGGAGAGAGGG - Intergenic
1196211228 X:112997836-112997858 TTAAGGGGGTGGCAGGGAGAAGG + Intergenic
1196387862 X:115177790-115177812 CTGTGGGGGTGTGGGGGGCAAGG - Intronic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1197616258 X:128695193-128695215 CTAAGGGACTGGGGAGGAGAGGG - Intergenic
1197659548 X:129155376-129155398 ATTTGGGGGTGGAGGGGTGAGGG + Intergenic
1197749793 X:129956816-129956838 TTGCGGGGGTGGGGGGGAGGTGG - Intergenic
1197753965 X:129982460-129982482 CTACGCGGGTGGGGGGGAATGGG - Intronic
1198270332 X:135051184-135051206 CTCTGGGGATGGGGAGGAAATGG + Exonic
1198535128 X:137577818-137577840 AAATGGGGGTGGGGGGGAACCGG + Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1199582350 X:149372910-149372932 CTATGGGGAGGGGAAGGAGAAGG + Intergenic
1199736970 X:150693817-150693839 TTCCGGGGGTGGGGGGGAGGAGG - Intronic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1200062512 X:153489898-153489920 TTATGGGGGTAGGGGGTGGAGGG - Intronic
1200122548 X:153798002-153798024 GTGTGGGGGTGGGGAGGGGAGGG - Intronic
1200296081 X:154921875-154921897 GTTGGGGGGTGGGGGGAAGAGGG + Intronic
1200615240 Y:5371232-5371254 TTTGGGGGGTGGGGGTGAGAGGG + Intronic
1200877542 Y:8173864-8173886 ATCAGGGGGTGGGGTGGAGAGGG + Intergenic