ID: 1092193928

View in Genome Browser
Species Human (GRCh38)
Location 12:6537851-6537873
Sequence GCGTCGGAGGGCCCCCTCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 1, 2: 12, 3: 13, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092193920_1092193928 12 Left 1092193920 12:6537816-6537838 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 12
3: 13
4: 30
1092193918_1092193928 29 Left 1092193918 12:6537799-6537821 CCGTCTAGAAAAACCTGCCAAAT 0: 1
1: 9
2: 14
3: 98
4: 1259
Right 1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 12
3: 13
4: 30
1092193919_1092193928 16 Left 1092193919 12:6537812-6537834 CCTGCCAAATATGATGACATCAA 0: 11
1: 12
2: 12
3: 18
4: 178
Right 1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG 0: 1
1: 1
2: 12
3: 13
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092193928 Original CRISPR GCGTCGGAGGGCCCCCTCAA GGG Exonic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
904807693 1:33143343-33143365 GGGTCGGAGCACCCCCTCCATGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
912451837 1:109772161-109772183 GCGATGGAGAGCCCCCTCCATGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1070559506 10:77555216-77555238 GAGTCAGACGGCCCCCTCACAGG + Intronic
1077367579 11:2167351-2167373 GCGTGTGAGGGCCGCCTCCAGGG - Intronic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1090199369 11:124843320-124843342 CCTTCGGAGGACCCCCTCCAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1105947330 13:25201427-25201449 GGGTGGGAGGGCCCCAACAAAGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1114443181 14:22767255-22767277 GCGTCGCAGGGCCCTCGCAATGG + Exonic
1123707249 15:22959384-22959406 GCGTGGGAGCGCCCCCTCTGTGG - Intronic
1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG + Intronic
1143530962 17:7503138-7503160 GCGCCGCAGGGCCCTCTCATTGG - Exonic
1144862533 17:18314683-18314705 GCCTCGGAGGGCCATCTCCATGG + Exonic
1148999986 17:51747652-51747674 GGGTCGGAGCACCTCCTCAATGG - Exonic
1157592285 18:48843070-48843092 GGGTGGGAGGCTCCCCTCAAAGG - Intronic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166679859 19:44759548-44759570 GCCTCGGAGGACCCCAGCAAAGG - Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
929562166 2:42962679-42962701 GCGTCTGAGCCCTCCCTCAATGG - Intergenic
946963478 2:225010317-225010339 GTGTGGGAGGGCACCCCCAAAGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
954577368 3:51684044-51684066 GGGTGGAAGGGCCCCCTCAGTGG + Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
968652845 4:1766981-1767003 GAGCCGGAGGGTCCCCTCCACGG - Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
985576925 5:677890-677912 GCGCCGGAAGGCCTCCTCCAGGG + Exonic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
1001389235 5:171365531-171365553 GCGTCGTATGGCCCCCTCTATGG - Intergenic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1007108379 6:39298629-39298651 GCGTTTGAAGGCCCCATCAACGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1061307955 9:129743236-129743258 GCCTCGGAGGGGCCCCTCTGCGG - Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189973394 X:46439899-46439921 GCGTTGAAGGCCCCCCTCAAGGG - Intergenic