ID: 1092194314

View in Genome Browser
Species Human (GRCh38)
Location 12:6540219-6540241
Sequence TAGCAGACACCCACGCGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092194310_1092194314 14 Left 1092194310 12:6540182-6540204 CCGCAATCGCTCTGGCAGCATTT 0: 1
1: 0
2: 0
3: 12
4: 83
Right 1092194314 12:6540219-6540241 TAGCAGACACCCACGCGTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092194314 Original CRISPR TAGCAGACACCCACGCGTGA AGG Exonic
903262608 1:22139520-22139542 TAGCAGAATCCCACGGGTGAGGG - Intronic
905745638 1:40415032-40415054 CAGCAGACGCCCAGGCCTGAAGG - Intronic
909517697 1:76531078-76531100 CAGCAGACAGCCACCCTTGAGGG - Intronic
909863561 1:80637650-80637672 TAGCAGATACCCAGGTGTAAGGG - Intergenic
910379385 1:86609484-86609506 CAGCTGACACCCACCCATGAAGG - Intergenic
916470076 1:165114995-165115017 TTGCAGACACACACGCCTGCAGG + Intergenic
919757197 1:201073568-201073590 GAGCAGAAACCCAAGGGTGAGGG - Exonic
1075091654 10:119447188-119447210 GAGCAGACACCCAGGTGAGACGG - Intronic
1083163778 11:60871332-60871354 TAGCACACAGCCACGCCTGTAGG - Intronic
1084967357 11:72751675-72751697 TAGCAGAAACCACAGCGTGATGG + Intronic
1091188836 11:133672263-133672285 TTGCAGACACTCACAGGTGAGGG + Intergenic
1092194314 12:6540219-6540241 TAGCAGACACCCACGCGTGAAGG + Exonic
1092262623 12:6960593-6960615 TAGCAGAGGCCCACACGTGTGGG - Intronic
1108130115 13:47289829-47289851 TAGCAGTCAATCATGCGTGAGGG - Intergenic
1120524959 14:85567258-85567280 AAGCAGACACCCACCAGGGATGG - Intronic
1121955038 14:98205828-98205850 TAGCACACACCCACCAGTGTGGG - Intergenic
1123404621 15:20012334-20012356 TAGCAGACTTCCACGGGAGAGGG + Intergenic
1123513954 15:21018981-21019003 TAGCAGACTTCCACGGGAGAGGG + Intergenic
1126617297 15:50597621-50597643 TAGCAGACAGCCAGGCGTGATGG + Intronic
1148026333 17:44591541-44591563 GAGCAGACAGCCAAGGGTGAAGG + Intergenic
1155096303 18:22559543-22559565 TCGCTGACACCCACCCGGGATGG - Intergenic
1155499078 18:26469184-26469206 TAGCTGTAACCCACGCTTGAGGG - Intronic
1165033495 19:33015759-33015781 TAGCAGACAGCCAGGTGTGGTGG + Intronic
1168398291 19:56067017-56067039 TAGCAGACACCCAAGAATGTAGG + Intergenic
1171012653 20:21516989-21517011 TTGCAGGCTCCCACGGGTGAGGG - Intergenic
1173139212 20:40467499-40467521 TAACAGACACCCAAGGGAGATGG + Intergenic
1175790879 20:61739171-61739193 CAGCAGCCGCCCAGGCGTGAAGG - Intronic
953350804 3:42214371-42214393 TGGCAGACACCAACAGGTGAAGG - Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
964476156 3:157099830-157099852 CAGCAGACACCCACTCTAGAGGG + Intergenic
981203913 4:142016188-142016210 CAGCAGACACCCACACATGAAGG - Intergenic
987289968 5:16499699-16499721 GGGCAGACACCCACACATGATGG - Intronic
1018674572 6:166207744-166207766 TAGCAGGCACTCAGGTGTGATGG - Intergenic
1018813268 6:167313085-167313107 TAGCAGACAGGCAGGAGTGAGGG + Intronic
1022649467 7:32261241-32261263 TTGCAGACCCCCACACTTGATGG + Intronic
1023029587 7:36080615-36080637 CAGCAGCCACCCACATGTGATGG + Intronic
1023879747 7:44311753-44311775 GAGCAGAGACCCAGGCCTGAAGG - Intronic
1050692128 9:8240229-8240251 TAGCAGAAACCCAGGTGTAAAGG + Intergenic
1054813116 9:69450527-69450549 AAGCAGACACCAACCTGTGAAGG - Intronic
1057561130 9:96128775-96128797 CACCTGACACCCAAGCGTGAAGG - Intergenic
1189804409 X:44720769-44720791 GAGCAGACACCCAAGGGTAAAGG - Intergenic
1194253079 X:91602407-91602429 CAGCTGACATCCACACGTGAAGG + Intergenic
1196669058 X:118346478-118346500 TAGGACACACCCGCGGGTGAGGG - Exonic
1198023228 X:132679735-132679757 TAGAAGACAACCACGCCTGGGGG + Intronic
1199563512 X:149189254-149189276 TAGCTGACACCCATGACTGAAGG - Intergenic
1200572015 Y:4843651-4843673 CAGCTGACATCCACACGTGAAGG + Intergenic