ID: 1092194598

View in Genome Browser
Species Human (GRCh38)
Location 12:6541633-6541655
Sequence TGCCCCACCACAGCTGGAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092194598_1092194607 4 Left 1092194598 12:6541633-6541655 CCAACTCCAGCTGTGGTGGGGCA 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1092194607 12:6541660-6541682 GGGCCATCGGGGTTAACAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 63
1092194598_1092194606 1 Left 1092194598 12:6541633-6541655 CCAACTCCAGCTGTGGTGGGGCA 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1092194606 12:6541657-6541679 GCAGGGCCATCGGGGTTAACAGG 0: 1
1: 0
2: 0
3: 3
4: 61
1092194598_1092194604 -8 Left 1092194598 12:6541633-6541655 CCAACTCCAGCTGTGGTGGGGCA 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1092194604 12:6541648-6541670 GTGGGGCAGGCAGGGCCATCGGG 0: 1
1: 1
2: 6
3: 75
4: 564
1092194598_1092194603 -9 Left 1092194598 12:6541633-6541655 CCAACTCCAGCTGTGGTGGGGCA 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1092194603 12:6541647-6541669 GGTGGGGCAGGCAGGGCCATCGG 0: 1
1: 1
2: 12
3: 90
4: 667
1092194598_1092194605 -7 Left 1092194598 12:6541633-6541655 CCAACTCCAGCTGTGGTGGGGCA 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1092194605 12:6541649-6541671 TGGGGCAGGCAGGGCCATCGGGG 0: 1
1: 1
2: 1
3: 39
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092194598 Original CRISPR TGCCCCACCACAGCTGGAGT TGG (reversed) Exonic
900266437 1:1759607-1759629 TGCCCCTCCACAGCGGGGATGGG + Intronic
901201791 1:7471421-7471443 TGGCCCTGCCCAGCTGGAGTGGG - Intronic
903225164 1:21890476-21890498 TGTCCCTCCCCAGCTGGAGTCGG - Exonic
903305347 1:22409011-22409033 TGCCCCATCCCAGCTGGGGCTGG - Intergenic
904087539 1:27920121-27920143 TGACCCACCACACCTGGCCTGGG + Intergenic
904364096 1:29999602-29999624 TGCACCTCCACAGCTGGGGTGGG - Intergenic
904719174 1:32493848-32493870 AGCCCCACTGCATCTGGAGTGGG + Exonic
904748333 1:32725145-32725167 TGAAGCACCCCAGCTGGAGTGGG + Intergenic
905376688 1:37526378-37526400 TGAGCCACCACAGCTGGCCTGGG - Intergenic
906782015 1:48580997-48581019 TGCACCACCCCAGCTGGTTTAGG + Intronic
910059685 1:83074852-83074874 AGCCACACGAAAGCTGGAGTTGG + Intergenic
910151290 1:84150127-84150149 TGCGCCACCACACCTGTAGATGG - Intronic
911068475 1:93813028-93813050 TGCCCCAGCAAAGCTGTAGGTGG + Intronic
916628589 1:166587363-166587385 TTCTCCACCTGAGCTGGAGTGGG + Intergenic
922291517 1:224212747-224212769 AGACTCACCACAGCTGCAGTGGG + Intergenic
923021560 1:230168038-230168060 TTCCCAACCACAGCTGAAGCAGG - Intronic
1064520017 10:16191023-16191045 TGCCCTACCCCAGGTGGAATTGG - Intergenic
1064864310 10:19861746-19861768 AGCTCCACCTCAGCTAGAGTTGG + Intronic
1064901713 10:20302308-20302330 TGACCCACCACACCTGGTGCAGG - Intergenic
1064919996 10:20505638-20505660 TGCCACAACACAGTTGGAGGAGG + Intergenic
1065068924 10:22002898-22002920 TCCTCCAGCACAGCTGGAGGGGG + Intronic
1070731079 10:78828681-78828703 TGACCCTCCAGAGATGGAGTGGG + Intergenic
1071003334 10:80855684-80855706 TGCCCCACCACAGCGTGAGGTGG + Intergenic
1071882179 10:89911298-89911320 TGCCCTTCCACTGCTGCAGTGGG - Intergenic
1072117452 10:92377479-92377501 TGAGCCACCACAGCTGGCCTGGG - Intergenic
1072668728 10:97413690-97413712 TGAGCCACCACGCCTGGAGTTGG + Intronic
1072949169 10:99837418-99837440 TGAGCCACCACAGCTGGCCTGGG + Intronic
1074078806 10:110151856-110151878 TCCCAGGCCACAGCTGGAGTGGG - Intergenic
1074205000 10:111275446-111275468 TGCCCCATCCCAGCTGGAACAGG - Intergenic
1077007490 11:365157-365179 TGACCATCCACAGCTGGGGTGGG - Intergenic
1077573463 11:3357959-3357981 TGCTCCACCACAGTTAGAGGAGG + Intronic
1078552276 11:12289005-12289027 TGCCCCATCACAGCTGGTTCTGG + Intronic
1082709214 11:56533084-56533106 TGCACCACCACACCTGGAGATGG - Intergenic
1082877079 11:57999662-57999684 GACCCCACCACAGCTGAAGGAGG - Intergenic
1083304612 11:61755914-61755936 AGCCCCACCAGGGCTGGAGGAGG + Intronic
1083584011 11:63843411-63843433 TGCCCCACTTCTGCTGCAGTGGG + Intronic
1086832954 11:91587904-91587926 TGCACCACCACTCCTGGAGATGG + Intergenic
1089554846 11:119310662-119310684 TGCCCCTTGACAGCAGGAGTGGG - Intronic
1092180954 12:6446488-6446510 TGAGCCACCACATCTGGTGTTGG - Intronic
1092194598 12:6541633-6541655 TGCCCCACCACAGCTGGAGTTGG - Exonic
1092234155 12:6795688-6795710 TGCCCCTCCACAGCTTCTGTGGG - Intronic
1099501062 12:83415017-83415039 TCCCCCAGCACAGCTGGTGGTGG - Intergenic
1100778543 12:97999021-97999043 TCCCCCACCACAAATGAAGTGGG - Intergenic
1101365199 12:104064462-104064484 GACCCCAGCACAGCTGGAGGCGG + Exonic
1102894508 12:116587923-116587945 TGGCCCACCACAGTGGGATTGGG + Intergenic
1103153565 12:118663523-118663545 TAGCCCACCACAGCTCAAGTAGG - Intergenic
1103206637 12:119134701-119134723 TGCCCCACCACAGAGGAAGCTGG - Intronic
1103318081 12:120073195-120073217 TGCCTCATCACAGCAGTAGTTGG - Intronic
1103767766 12:123293902-123293924 TGCACCTCCACCACTGGAGTGGG + Exonic
1103829510 12:123767731-123767753 AGCCCCCCCGCAGCGGGAGTAGG + Intronic
1105848598 13:24314693-24314715 TGCACCACCACACCTGGGTTTGG - Intronic
1107430269 13:40334229-40334251 TGCCCCACCTCTGCTGGGGTGGG - Intergenic
1111850327 13:93565274-93565296 TGCTCCACCTCAGCAGGTGTTGG + Intronic
1113026441 13:105946126-105946148 AGCCCCACCACTTCTGGAGCAGG + Intergenic
1113326163 13:109283337-109283359 TGCCCCATCATAGCTGGATGTGG - Intergenic
1115113406 14:29851926-29851948 TGCAGCAACACAGATGGAGTTGG + Intronic
1115223849 14:31083954-31083976 CGCCCCTCCACAGATGGAGCAGG - Intronic
1115646200 14:35369804-35369826 TGCCCTACCACGGGTGGAGCTGG - Intergenic
1119012761 14:71013140-71013162 TGCCAATCCACAGCTGGGGTAGG - Exonic
1119854883 14:77892070-77892092 GGGCACACCACACCTGGAGTTGG - Intronic
1122963421 14:105110728-105110750 TGAGCCACCACAGCTGGCCTGGG + Intergenic
1124135262 15:27029690-27029712 TGCCCCACCAAAGCAGGCCTTGG - Intronic
1124662076 15:31558026-31558048 TTCCCCACCCCAGCAGGAGCAGG + Intronic
1125107240 15:35986480-35986502 TACATCACCACAGCTGGATTAGG - Intergenic
1125928361 15:43582117-43582139 TACCCCAGCTCAGCTGGAGGAGG - Exonic
1125941527 15:43681952-43681974 TACCCCAGCTCAGCTGGAGGAGG - Intergenic
1126053946 15:44711962-44711984 TCCCCCAGCGCAGCTGGAGTGGG + Intronic
1127832513 15:62763486-62763508 TGGCCCACCAGTGCTGGAGCAGG + Intronic
1128938777 15:71769961-71769983 TGAGCCACCACAGCTGGCCTGGG - Intronic
1131125775 15:89855563-89855585 TGAGCCACCACAGCTGGCCTGGG - Intronic
1133103118 16:3491133-3491155 TGCCCCATCACAGCTGCTCTTGG + Intergenic
1133186991 16:4107157-4107179 TTCCCCTCCACAGCTGGGGTGGG - Intronic
1135978069 16:27124258-27124280 TGAACCACCACAGCTGGATGGGG - Intergenic
1136689216 16:32016495-32016517 TGCACCACCACACCTGGCGGGGG + Intergenic
1139339589 16:66259403-66259425 TGCCCCGCCCCAGCTAGAGCAGG + Intergenic
1139847272 16:69929848-69929870 TGCCCCAGCACAGCTTCACTTGG - Intronic
1140845402 16:78882431-78882453 AGCTCCACTACAGCTGGAGAAGG + Intronic
1141418902 16:83899120-83899142 TGCCCCACAACAGCTGCCGAGGG - Exonic
1141882555 16:86869484-86869506 TGGCCCCCCACAGGTGCAGTGGG - Intergenic
1142093271 16:88226428-88226450 GGGCCTCCCACAGCTGGAGTGGG + Intergenic
1143119877 17:4599927-4599949 GCCCCCTCCACAGCTGGAGCAGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1145206390 17:20986233-20986255 TGAGCCACCACAGCTGGCCTGGG - Intergenic
1147178571 17:38671569-38671591 TCCCACAACACAGCTGGAGGGGG + Intergenic
1147403136 17:40192810-40192832 CCCCCCACCACAGACGGAGTGGG + Intronic
1148174328 17:45550554-45550576 TACCCCACCACAGCAGGCGCTGG - Intergenic
1148274934 17:46294893-46294915 TACCCCACCACAGCAGGCGCTGG + Intronic
1148297041 17:46512472-46512494 TACCCCACCACAGCAGGCGCTGG + Exonic
1148361594 17:47016952-47016974 TACCCCACCACAGCAGGCGCTGG + Intronic
1148836144 17:50466890-50466912 TGCCTCTCCCCAGCTGAAGTTGG - Intronic
1150311421 17:64131746-64131768 TGCCCCACGACACCTGGCTTGGG + Intergenic
1150405548 17:64897476-64897498 TACCCCACCACAGCAGGCGCTGG - Exonic
1150484822 17:65536465-65536487 TGCCCCCCCACAGATGGTGCCGG + Exonic
1152077842 17:78169686-78169708 TGCTCCACCTCAGCAGGTGTGGG - Intronic
1154352601 18:13598795-13598817 TGATGCTCCACAGCTGGAGTGGG + Intronic
1155000999 18:21686780-21686802 TGCTCATCCCCAGCTGGAGTGGG - Intronic
1155857975 18:30858738-30858760 TGCCCCAGGACAGGTAGAGTGGG + Intergenic
1161596614 19:5154055-5154077 AGCCCCACCAGGCCTGGAGTCGG + Intergenic
1161706648 19:5825260-5825282 TGCCCCACCGCAGGTGCTGTGGG + Intronic
1162958778 19:14114126-14114148 AGCCTCACCATCGCTGGAGTTGG + Intronic
1163905475 19:20148724-20148746 TGAGCCACCACAGCTGGCCTGGG + Intergenic
1164415580 19:28044426-28044448 TTCTCCACCCTAGCTGGAGTTGG - Intergenic
1164652082 19:29898285-29898307 TGAGCCACCACAGCTGGCCTGGG + Intergenic
1165783676 19:38448342-38448364 TCACCCTCCACAGCTGGAGTGGG + Exonic
1166261907 19:41645903-41645925 TGAGCCACCACAGCTGGCCTGGG - Intronic
1167118949 19:47505354-47505376 AGCCCCTCCACAGCTGGGGTTGG - Intronic
1167176349 19:47867114-47867136 TGAGCCACCACAGCTGGCTTTGG - Intergenic
1167238252 19:48327707-48327729 TCCCCCAACAAAGTTGGAGTGGG + Intronic
1167595061 19:50423068-50423090 TGCACCACCACACCTGGTTTGGG - Intronic
1167605371 19:50479057-50479079 GGCCCCACCTCACCCGGAGTCGG - Exonic
925719146 2:6811408-6811430 CTCCCCACCACATCTGGAGATGG + Intergenic
926206964 2:10840645-10840667 TATCCCACCTCAGCTGGACTGGG + Intergenic
927256372 2:21043942-21043964 CGCCCCACCGCAGCTGGCGATGG - Exonic
933801301 2:85962039-85962061 TGCCCCAACTCAGAAGGAGTGGG + Intergenic
934121070 2:88840267-88840289 TGGCCTTCCACAGCTTGAGTAGG + Intergenic
938029779 2:127981913-127981935 TGCTCCACCACAGTTAGAGGAGG - Intronic
940246851 2:151628305-151628327 TGCCCCAGCAGAGCTGGATTTGG - Intronic
941777555 2:169409342-169409364 TGAGCCACCACACCTGGACTCGG - Intergenic
943720446 2:191198608-191198630 AGCTCCTCCACAGCTGGAGCTGG - Intergenic
944967925 2:204956971-204956993 TGCCCTACCACTGCTAGAGATGG + Intronic
945668340 2:212770354-212770376 TGCCCTCCCTCAGGTGGAGTTGG + Intergenic
949045677 2:241871765-241871787 TGTCCCACCACAGGTGGAAGAGG - Exonic
1169777194 20:9268510-9268532 TGACCTACCACAGCTGGAGATGG - Intronic
1172034528 20:32001819-32001841 GGCCCCACCACAGCTTGAACTGG - Exonic
1173147119 20:40534572-40534594 ACCCCCACCACAGGTGGAGATGG + Intergenic
1174543353 20:51306824-51306846 CTCCCCACCACAGCTGGAGGTGG - Intergenic
1176111410 20:63412506-63412528 GGCCCCTGCACAGCAGGAGTGGG + Intronic
1176410472 21:6447097-6447119 TGCCTCATGACAGCTGGTGTAGG - Intergenic
1177838410 21:26210769-26210791 TGCCACAGCACAGCTTGAGGTGG + Intergenic
1179685965 21:43055419-43055441 TGCCTCATGACAGCTGGTGTAGG - Intronic
1179999991 21:44991227-44991249 TGCCCCAGCACAGCTGTGGGGGG - Intergenic
1180130809 21:45825780-45825802 TGCCCCAGCAGAGGTGGGGTTGG + Intronic
1181631704 22:24155108-24155130 GGCCTCCCCTCAGCTGGAGTGGG + Intronic
1182095559 22:27623056-27623078 TTCCCCACCAGAGTTCGAGTGGG - Intergenic
1182350640 22:29697433-29697455 TGCCTCCCCACAGATGGAGAAGG + Exonic
1182502020 22:30754767-30754789 TGCCCCAGCACAGCAGCAGGAGG - Intronic
1183180761 22:36258150-36258172 TGCCCTAACACAGCTGGGGGGGG - Intronic
1183406529 22:37633052-37633074 GACCCCACCCCAGCTGGGGTTGG - Exonic
1184710733 22:46247932-46247954 TGCTCCCCCACAGCTAGAGCAGG + Intronic
1185319988 22:50196222-50196244 AGCCCCTCCAGAGGTGGAGTGGG + Intronic
1185375036 22:50478738-50478760 TGCCCCTCCAGAGCTGGCGCTGG + Intergenic
949991406 3:9582339-9582361 TGCATCATCTCAGCTGGAGTTGG - Intergenic
950565671 3:13768294-13768316 TCCCCCAGCCCAGCTGGGGTTGG - Intergenic
953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG + Intergenic
954081255 3:48213120-48213142 TGAGCCACCACAGCTGGCCTGGG - Intergenic
954329109 3:49879906-49879928 TGCCCCACCTCTGCAGGAGGTGG - Intergenic
955281247 3:57596969-57596991 TCCCCCACCACAGCGGGCGGAGG + Intronic
959418930 3:106110486-106110508 TGAGCCACCACAGCTGGCCTGGG + Intergenic
960914134 3:122680134-122680156 TGAGCCGCCACAGCTGGACTAGG + Intergenic
961474887 3:127140401-127140423 TCCTCCAACACAGCTGGAGGAGG - Intergenic
961635275 3:128329303-128329325 TGCCCCTGCACAGCTGCACTGGG + Intronic
963222219 3:142825285-142825307 GGCCCCACCAAAGCAGGAGAAGG - Intronic
963280842 3:143383667-143383689 TGCCCCACTCCAGCTGAAGCAGG - Intronic
963343544 3:144067349-144067371 CGCACCACCACACCTGGTGTGGG - Intergenic
965287505 3:166835670-166835692 TTCCCCACCCAACCTGGAGTGGG - Intergenic
966808228 3:183822703-183822725 TGAGCCGCCAAAGCTGGAGTGGG + Intronic
968686399 4:1962142-1962164 TGCCCCACTACTGCAGGGGTAGG - Intronic
969260593 4:6030867-6030889 TGCCTCAGCCCAGCTGGGGTGGG + Intronic
969608965 4:8216600-8216622 TACCCGACCACAGCAGGAGGGGG + Intronic
971181976 4:24337234-24337256 TGACCCTCCACAGGTGGAATTGG - Intergenic
972253261 4:37327851-37327873 TGCACAACCAAAGATGGAGTCGG - Intronic
974143564 4:57919147-57919169 GACCCCACCACAGCTTGAGGAGG - Intergenic
974880217 4:67747155-67747177 TGCACCATCCCAGCTGGACTTGG + Intronic
978688931 4:111483613-111483635 TGCCCCGCCACTGCTGCTGTGGG + Intergenic
979649851 4:123115726-123115748 TGCCCCACCACAGCCGGTCCCGG + Intronic
981165234 4:141549805-141549827 AGCCCCACCACAGCTCAAGGAGG + Intergenic
984533282 4:180944170-180944192 TGAGCCACCACAGCTGGCCTGGG + Intergenic
984984972 4:185319480-185319502 TGAGCCACCACAGCTGGCCTGGG + Intronic
985760653 5:1746979-1747001 TGGCTCACCACAGCGGAAGTCGG + Intergenic
985818988 5:2147233-2147255 TGCCCCAAGTCAGCTGGAGTTGG + Intergenic
991091554 5:62698463-62698485 TGACCCACCACACCTGGCCTGGG - Intergenic
991994790 5:72376315-72376337 GGTCCCATCACAGCTGGATTGGG - Intergenic
993578908 5:89635553-89635575 AGCCCCACCACAGCTCAAGGAGG - Intergenic
996506949 5:124278037-124278059 TGCCCCACCTTTGCTGGGGTTGG + Intergenic
997464487 5:134078276-134078298 TTCCTGACCACAGCTGGAGTGGG - Intergenic
1002063244 5:176639082-176639104 TGAGCCACCACAGCTGGCCTGGG + Intronic
1002099725 5:176851427-176851449 TGCCCCGCCAGAGCTGGGGCCGG - Intronic
1002178004 5:177413236-177413258 TTCACCACCACAGCTGGGGAGGG - Intronic
1002505410 5:179675897-179675919 TGCCCCACCAAACCTGCAGAAGG - Intergenic
1004725544 6:18308014-18308036 TGACCCACCACACCTGGCCTGGG + Intergenic
1004727058 6:18321472-18321494 TGCAGAACTACAGCTGGAGTTGG - Intergenic
1007063275 6:38963647-38963669 TGAGCCACCACAGCTGGCCTGGG + Intronic
1007927867 6:45664123-45664145 TGCCCCACCAACGCTGGAGCTGG - Intronic
1008973959 6:57402285-57402307 TGCCCAAACACACCTGTAGTTGG + Intronic
1012681562 6:102188992-102189014 TGCCCTACTCCAGCTGGATTTGG + Intergenic
1013415055 6:109917544-109917566 TGCCCCACCAAGGCAGGGGTGGG - Intergenic
1018699236 6:166413393-166413415 TGTCCCACCCCAGCAGGAATAGG - Intronic
1019598559 7:1869803-1869825 TGCCACACCACACCTAGACTGGG + Intronic
1021684472 7:23169924-23169946 TGAACCACCACACCTGGACTAGG - Intronic
1026477123 7:70746427-70746449 TGAGCCACCACACCTGGCGTAGG + Intronic
1027734801 7:81919745-81919767 TGCCCCACCACAGCCGTGCTTGG - Intergenic
1033260358 7:139838822-139838844 TGCACCACCAGGGCTGGAGATGG + Intronic
1034935414 7:155196964-155196986 TGCAGCTCCACAGCTGGAGCTGG + Exonic
1036926222 8:12908854-12908876 TGCACCACCACACCTGGCTTAGG - Intergenic
1037859194 8:22392739-22392761 TGCTCCAGCCCAGCTGGAGCTGG - Intronic
1041240017 8:55841408-55841430 TGAGCCACCACACCTGGACTCGG - Intergenic
1041718306 8:60951898-60951920 TGCACCACCACACCTGGCTTGGG + Intergenic
1042280502 8:67051077-67051099 TGCACCACCACAGCTGGATTAGG - Intronic
1045489382 8:102656837-102656859 TGCCTCCCACCAGCTGGAGTGGG - Intergenic
1045509715 8:102805380-102805402 TGCCCCAGCAGAGGTGGACTGGG + Intergenic
1045541734 8:103092887-103092909 TGAGCCACCACACCTGGACTTGG + Intergenic
1048330870 8:133470022-133470044 TGCTCCATCTCAGCTGGTGTGGG - Intronic
1049205515 8:141361769-141361791 TGCCCCGCCACACCTGCAGCAGG - Intronic
1049219325 8:141421674-141421696 TGGCCCAAGGCAGCTGGAGTTGG + Exonic
1049410947 8:142473795-142473817 TGACCCACCACAGCTGTGGGAGG - Intronic
1049603475 8:143518691-143518713 AGGCCCACCAAAGCTGGAGATGG + Intronic
1049624775 8:143615093-143615115 AGCCCCACCAAGGCTGGAGGAGG + Intronic
1049782797 8:144436462-144436484 TGCTCCATCACAGGTGGAGCGGG - Intronic
1049866138 8:144937788-144937810 TGCCTCAGCACCCCTGGAGTAGG + Intronic
1053100485 9:35367656-35367678 TGACTCACAACAGCTGGAGCAGG - Intronic
1056192161 9:84194952-84194974 TGCCCCAACTCAGATGGAGTGGG + Intergenic
1056285939 9:85088264-85088286 TGCCACCACACAGCTGGTGTCGG + Intergenic
1057222923 9:93267481-93267503 TGCCCTGCCCCAGCTGGAGCTGG - Intronic
1058562906 9:106248719-106248741 TGCCCCACAAAAGCTGGTGGGGG + Intergenic
1058739661 9:107930491-107930513 TGAGCCACCACAGCTGGCCTGGG - Intergenic
1060213870 9:121726701-121726723 GCCCCCACCACATCTGGTGTTGG + Intronic
1061262772 9:129489120-129489142 TGCCCCACATCATCTGCAGTAGG + Intergenic
1061727072 9:132587827-132587849 TGCCCCAGCTCAGCCGGAGTGGG + Intronic
1062209006 9:135353189-135353211 TCTCCCACCACAACTGGAGCTGG - Intergenic
1062269679 9:135702720-135702742 TGCCCCACCCCAGCTTGGGGAGG + Intronic
1203758235 Un_GL000218v1:156013-156035 TGGCCCACCACAGCTCAAGGAGG - Intergenic
1192827966 X:74718387-74718409 TGCCCAACCACAGTGAGAGTGGG - Intergenic
1199395377 X:147330854-147330876 TGCTCCACCACAGTTAGAGGAGG - Intergenic
1200243735 X:154511734-154511756 TGGACCACCACAGCTGGTTTGGG + Intronic