ID: 1092197070

View in Genome Browser
Species Human (GRCh38)
Location 12:6555929-6555951
Sequence CTGGGAGGCGACCACTTCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092197070_1092197087 26 Left 1092197070 12:6555929-6555951 CCGGCGAAGTGGTCGCCTCCCAG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1092197087 12:6555978-6556000 CCTGCTGCTCCTGCTGCAGGAGG 0: 1
1: 1
2: 29
3: 196
4: 1049
1092197070_1092197075 -3 Left 1092197070 12:6555929-6555951 CCGGCGAAGTGGTCGCCTCCCAG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1092197075 12:6555949-6555971 CAGTGAGTCCCCCAGTGGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 213
1092197070_1092197072 -8 Left 1092197070 12:6555929-6555951 CCGGCGAAGTGGTCGCCTCCCAG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1092197072 12:6555944-6555966 CCTCCCAGTGAGTCCCCCAGTGG 0: 1
1: 0
2: 1
3: 26
4: 205
1092197070_1092197076 2 Left 1092197070 12:6555929-6555951 CCGGCGAAGTGGTCGCCTCCCAG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1092197076 12:6555954-6555976 AGTCCCCCAGTGGCCCGGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 219
1092197070_1092197084 23 Left 1092197070 12:6555929-6555951 CCGGCGAAGTGGTCGCCTCCCAG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1092197084 12:6555975-6555997 GGCCCTGCTGCTCCTGCTGCAGG 0: 1
1: 5
2: 20
3: 154
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092197070 Original CRISPR CTGGGAGGCGACCACTTCGC CGG (reversed) Exonic
900427515 1:2587271-2587293 CTGGACGGCGACTACTTCGCGGG + Exonic
901149658 1:7092830-7092852 CTGGGAGACGCCAACTTCCCAGG - Intronic
901879245 1:12184574-12184596 GTGGGAGGCCACCACTCAGCCGG + Intronic
911789634 1:101996991-101997013 CTGGGGGGCGATCATTCCGCAGG + Exonic
915902125 1:159854834-159854856 CGGGGAGGGGCCCGCTTCGCAGG + Exonic
917924071 1:179774378-179774400 CTTGGAGCCCACCACTTCCCTGG - Intronic
1070287481 10:75094520-75094542 CTGGGTGGTGACCTCTTAGCGGG - Intronic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1076543124 10:131226997-131227019 CAGGGAGGCGGCCCCCTCGCAGG + Intronic
1076835447 10:133018691-133018713 CTGGGAGGCGAAGGCTCCGCCGG - Intergenic
1077994164 11:7438906-7438928 CTGGGAGGAGAGGACTTAGCAGG - Intronic
1083600756 11:63946144-63946166 CAGGGAGGCAGCCACTTCACTGG - Intronic
1083723831 11:64618233-64618255 CTGGGAGGCTAGAACTTCGGTGG + Intronic
1088230667 11:107670518-107670540 CTGGGATGCAACCTCTTTGCTGG + Intergenic
1092197070 12:6555929-6555951 CTGGGAGGCGACCACTTCGCCGG - Exonic
1094847541 12:34367914-34367936 CTGGGTGGGGACCACTTCCTCGG + Intergenic
1101757967 12:107635981-107636003 CTGGGAGGCGTGCACTGTGCCGG + Intronic
1104386515 12:128355775-128355797 GTGGGAGGGGAGCACTTTGCAGG - Intronic
1104568167 12:129903510-129903532 CCGGGAGGCGACGACCGCGCGGG + Exonic
1114836216 14:26205337-26205359 CTGGGAGGCATCCATTACGCCGG + Intergenic
1121183553 14:91947639-91947661 CTGGGAGGAGAGCCCTTCCCCGG + Exonic
1121433884 14:93906241-93906263 CTGGGAGGACACCCCTTCTCTGG - Intergenic
1121495456 14:94388882-94388904 CTGGGAGAGTACCACTTAGCTGG + Exonic
1122945287 14:105005867-105005889 CTGGGATCTGACCACTTCCCCGG + Intronic
1124635116 15:31360310-31360332 CTGGGGGGCCACCTCTTCTCAGG - Intronic
1130370910 15:83284655-83284677 TGGGGAGCCGCCCACTTCGCCGG - Exonic
1131046698 15:89321133-89321155 CTTGGAGACGCCCACTTTGCCGG - Exonic
1138495231 16:57404874-57404896 CTGTGAGGTGACCCCCTCGCTGG + Intronic
1141755879 16:85990495-85990517 CTCGGAGGCCACCAGTCCGCGGG - Intergenic
1143374312 17:6458300-6458322 CTGGGTGGCGAGCACCTCACAGG - Intronic
1146923601 17:36729519-36729541 CTGGGAGGGGGACACTTCTCTGG + Intergenic
1146950279 17:36900588-36900610 CTGGGAGGCGACAACTCAGAGGG + Intergenic
1148800285 17:50220939-50220961 GTGGGAGGGGACCACGGCGCAGG - Intergenic
1152426062 17:80219497-80219519 CTGGGAGGCGAGGAGTTGGCAGG + Intronic
1153008821 18:519414-519436 CTGGCAGGCTGTCACTTCGCTGG - Intergenic
1155114919 18:22754546-22754568 TTGGGAGGAGACCACTATGCAGG - Intergenic
1161887985 19:7011814-7011836 CTGGGAGGTCACCACGCCGCAGG + Intergenic
1166807309 19:45494922-45494944 CGAGGAGGAGACCACGTCGCAGG - Exonic
1167269032 19:48497874-48497896 CCGGGAGGAGACCACTGCGCTGG + Exonic
925173620 2:1767481-1767503 CTGGGAGGTGACCTCTCGGCCGG + Intergenic
925662608 2:6219003-6219025 GTGGGAGGGGACCACTTCAGTGG - Intergenic
927491046 2:23521172-23521194 CTGGGAGGGGACTGCTTCGAGGG + Intronic
929284062 2:40115598-40115620 CTGGGTGGCTGCCACTTTGCTGG + Exonic
936548024 2:113409508-113409530 CTGGGAGGCAACCCCTTCCCAGG - Intergenic
948374066 2:237509426-237509448 CCTGGAGGCCACCCCTTCGCTGG - Intronic
948726683 2:239938537-239938559 CTGGGAGGCGGCTACTTCCAGGG + Intronic
949042392 2:241855308-241855330 CTGGGTGGCGACCCCCACGCAGG + Intronic
1179989575 21:44940147-44940169 CCCGGAGGCGACCCCTCCGCCGG + Exonic
1180228405 21:46412009-46412031 ATGGGAGGCCTCCACGTCGCCGG - Exonic
1181808064 22:25386975-25386997 CTGGGAGGCGAGGACTTGCCTGG - Intronic
1183697573 22:39431921-39431943 AGGGGAGGCGTCCACTTCCCAGG - Intronic
960947777 3:122978656-122978678 CTGGGAGCAGACCCCTCCGCTGG + Intronic
962613849 3:137104533-137104555 CTGGGAGGCCACCACTCTGCAGG - Intergenic
968693588 4:2009116-2009138 CTGGGTGGCGACCGCGTCTCCGG + Exonic
969617735 4:8263167-8263189 CTGGGAGGCCACCACCCCACAGG - Intergenic
970434339 4:16018838-16018860 CTGGGTGGTGACAACTTTGCTGG - Intronic
992492056 5:77255060-77255082 TTGGGAGGGCACCACTTCGGAGG - Intronic
992639029 5:78752637-78752659 CCTGGAGCCGACCACTTCCCTGG - Intronic
1000353755 5:160373484-160373506 CTGGGAGGAATCCACTTTGCTGG + Intergenic
1016416890 6:143842974-143842996 AAGGGAGGCGACCACCCCGCTGG - Intronic
1019693615 7:2432246-2432268 CTGGGAGGCGTCCTCTTCTTGGG + Intronic
1026045658 7:66904039-66904061 CCGGGAGGCGGCCACTGGGCTGG - Intergenic
1026800529 7:73397376-73397398 CTGGGAGGAGACCCCTCTGCCGG - Intergenic
1027011140 7:74745829-74745851 CTGTGAGGCCACCACTGTGCTGG + Intronic
1036369950 8:8154333-8154355 CTGGGCGGCCACCCCCTCGCAGG + Intergenic
1036880942 8:12511297-12511319 CTGGGCGGCCACCCCCTCGCAGG - Intergenic
1059406080 9:114098822-114098844 CTGGGAGAGGACCACTCCGGGGG + Intronic
1061327019 9:129870073-129870095 CAGGGAGGTGACCACATGGCAGG + Intronic
1061393727 9:130332000-130332022 CTGGAAGGGGACCACTGGGCCGG + Intronic
1062361962 9:136192671-136192693 CTGGGTGGCGTCCCCTTGGCGGG - Intergenic
1185789495 X:2918079-2918101 CAGGGCGGCGTCCACTTCGGGGG + Exonic
1186965879 X:14785700-14785722 TTGGGAGGCCAGCACTTCCCTGG + Intergenic
1195668486 X:107450373-107450395 CTAGGAGGTGGCCACTTAGCCGG + Intergenic