ID: 1092198639

View in Genome Browser
Species Human (GRCh38)
Location 12:6565942-6565964
Sequence CTGGGAGGATATAAGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092198634_1092198639 5 Left 1092198634 12:6565914-6565936 CCTACAGCTCTTTCAAACTTGTA 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1092198639 12:6565942-6565964 CTGGGAGGATATAAGGCAGTAGG 0: 1
1: 0
2: 1
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092198639 Original CRISPR CTGGGAGGATATAAGGCAGT AGG Intronic
903830606 1:26171876-26171898 CTGGCAGGATGGTAGGCAGTGGG - Exonic
904260402 1:29284474-29284496 CTGGGAGGATCTGAGAAAGTGGG + Intronic
904459559 1:30668077-30668099 ATGGAAGGATAGAAGGGAGTAGG + Intergenic
905265149 1:36747818-36747840 CTGGCATCATAGAAGGCAGTTGG + Intergenic
906284419 1:44577342-44577364 CTGGGAGGAGAGGTGGCAGTGGG - Intronic
906284429 1:44577378-44577400 CTGGGAGGAGAGGTGGCAGTGGG - Intronic
906648474 1:47493087-47493109 GTGGCAGGACATCAGGCAGTAGG - Intergenic
906775699 1:48527681-48527703 CTGGGAGGATATCATGAAGTTGG + Intergenic
907823942 1:57997497-57997519 CTGAGGGGCTATAAGGCAGAGGG - Intronic
908514635 1:64880041-64880063 CTGGGAGAATATGAGGTAATAGG + Intronic
910842214 1:91571391-91571413 CTGGCAGGATCCATGGCAGTAGG + Intergenic
911246188 1:95520612-95520634 CTTGGAGGAGAGAAGGCAGTGGG + Intergenic
914232111 1:145772546-145772568 CATGGAGGCTAGAAGGCAGTGGG - Intronic
914918022 1:151830251-151830273 CTGGGTGGAGATTGGGCAGTAGG + Intronic
916080668 1:161229959-161229981 CAGGAGGGAAATAAGGCAGTTGG + Exonic
916685977 1:167147099-167147121 TTTGGAGGCTAGAAGGCAGTGGG - Intergenic
918154065 1:181827829-181827851 TTTGGAGGATAGAAGGCAGTGGG + Intergenic
920647219 1:207812495-207812517 CTGGGAGGGTGTGAGGCAGAAGG + Intergenic
921767111 1:218984770-218984792 CTGGGAAGACATCAGGCAGGAGG + Intergenic
923993974 1:239470701-239470723 CTGGGAAGAAACAATGCAGTTGG - Intronic
1063306475 10:4907159-4907181 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1063966960 10:11353728-11353750 GCAGGAGGATATAAGACAGTTGG - Intergenic
1065070140 10:22014986-22015008 CTGGAAGGAGATAAGGCTGAAGG - Intergenic
1065937277 10:30531868-30531890 CTGGGAGGCAAGAAGGCAGTAGG + Intergenic
1066668746 10:37814707-37814729 CTTGGAGGCCAGAAGGCAGTGGG - Intronic
1067290502 10:44936055-44936077 ATGGGAGGATAGGAGGAAGTGGG + Exonic
1069682429 10:70294882-70294904 CTTGAAGGAAATAAGGGAGTTGG + Intergenic
1070939530 10:80331460-80331482 CTTGGAGGACAGAAGGCAGTGGG + Intergenic
1071390844 10:85174026-85174048 CTAGGAGGATACAAGGTAATGGG - Intergenic
1071699347 10:87913403-87913425 CTTGAAGGACAGAAGGCAGTGGG - Intronic
1072742066 10:97915485-97915507 CTGGGAGGAAAGCAGGCAGAAGG - Intronic
1073510237 10:104038283-104038305 ATGGGACGATGTAGGGCAGTGGG - Intronic
1073579431 10:104650830-104650852 CTGGGAGGATGTCAGGCACGTGG - Intronic
1074724061 10:116289519-116289541 CTGTGAAGGTATAAAGCAGTGGG + Intergenic
1075708354 10:124516471-124516493 CTGGAAGCATCGAAGGCAGTAGG + Intronic
1078092088 11:8270122-8270144 TTGGGAGGATAGAAGAGAGTGGG - Intergenic
1078433773 11:11308029-11308051 CTGGGAGGATTGGAGGAAGTGGG - Intronic
1078472277 11:11600466-11600488 AATGGAGGATAAAAGGCAGTGGG - Intronic
1079407631 11:20160017-20160039 CTGGCAGGGGAGAAGGCAGTCGG + Exonic
1079548454 11:21664622-21664644 ATGGGAGGATATAAAACAGGAGG - Intergenic
1081948829 11:47024305-47024327 TTGGGAGGCTATAAGGCAAGAGG - Intronic
1083724268 11:64620143-64620165 CTGGGAGGATGTTAGGCAAGGGG + Intronic
1084955641 11:72689826-72689848 CAGGGAGGAAATTAGGCAGGCGG + Intronic
1084977954 11:72813751-72813773 CTGGGAGGACAGGAGGCAGAAGG - Intergenic
1087710328 11:101541702-101541724 CTTGGAGGATATCAGGCTGGAGG + Intronic
1089289161 11:117427408-117427430 CTTGGAGGAAAGAAGCCAGTAGG + Intergenic
1091012042 11:132010424-132010446 CTGGGAAGGTATGAGGCAGAGGG - Intronic
1091389485 12:117436-117458 CTGGGAGGCTATGAGGGAGGCGG + Intronic
1091563864 12:1633711-1633733 CTGGGAGAATGTCAGGCAGAAGG - Intronic
1092198639 12:6565942-6565964 CTGGGAGGATATAAGGCAGTAGG + Intronic
1092262201 12:6958758-6958780 CTGGGTGGATGAGAGGCAGTGGG + Intronic
1098049868 12:66442251-66442273 CTGGAACAATATAAGGGAGTTGG - Intronic
1098148924 12:67526486-67526508 TTAGGAGGATATAAAGTAGTTGG - Intergenic
1098192866 12:67968628-67968650 CTGGTAGAATAACAGGCAGTAGG - Intergenic
1098380449 12:69863972-69863994 CATGGAGGCTAGAAGGCAGTGGG - Intronic
1098883378 12:75939375-75939397 CTGGGAGGATGGGAGGCTGTGGG + Intergenic
1102202174 12:111064853-111064875 CTTGGAGTATATAAAGCACTGGG + Intronic
1103028052 12:117589993-117590015 CGGGGAAGAAATAAGGCAGAGGG + Intronic
1104823253 12:131690777-131690799 CTGGGAGAGTAAAAGGCCGTTGG + Intergenic
1107883665 13:44855959-44855981 CTGGGAGGCTCTTAGGCAGGGGG - Intergenic
1110156034 13:72317901-72317923 CTGGCATGATTTAAGGCAATGGG - Intergenic
1111978109 13:94988700-94988722 CTGGGAGGGTATGAAGTAGTCGG + Intergenic
1112725767 13:102302639-102302661 GTGGGAAGATATCTGGCAGTTGG - Intronic
1113737008 13:112686241-112686263 CTGGGGGGAAATAAGGGAGTGGG - Intergenic
1114581339 14:23762780-23762802 CTGGGATGATTTAGGGCAGGAGG + Intergenic
1115508971 14:34121004-34121026 CAGGGTGTATATAAGGCACTGGG - Intronic
1122304238 14:100751609-100751631 CTCGGAGAACAGAAGGCAGTGGG - Intergenic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1128498519 15:68211429-68211451 CGGGTAGGGAATAAGGCAGTGGG - Intronic
1128612319 15:69084064-69084086 CAGGGAGGACATAAGGCTGGAGG + Intergenic
1128990773 15:72258210-72258232 CTGGGAGGATGGAGGGTAGTTGG - Intronic
1129682061 15:77663628-77663650 CTGGTGGGATTTCAGGCAGTGGG - Intronic
1133226873 16:4344957-4344979 CTGGCAGGAGAGAAGGCAGAAGG + Intronic
1136155661 16:28380380-28380402 CTGGGAAGAAAGAAGGCAGAGGG + Intronic
1136207423 16:28734909-28734931 CTGGGAAGAAAGAAGGCAGAGGG - Intronic
1136749866 16:32624995-32625017 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1137541318 16:49364049-49364071 CTGGCTGAGTATAAGGCAGTAGG - Intergenic
1137728781 16:50674621-50674643 CTGGGAGGAGAAAGGGCAGAGGG + Intronic
1203052000 16_KI270728v1_random:884193-884215 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1144166842 17:12620461-12620483 CTGAGAGGAGAGAAGGCAGGGGG - Intergenic
1144513292 17:15895986-15896008 CAGGGAGGTTATAAGGAAGCTGG + Intergenic
1145958684 17:28872818-28872840 CGGGAAGGATTTGAGGCAGTAGG - Intergenic
1146092317 17:29892144-29892166 TTGGGAGACTATAAGGCAGGAGG - Intronic
1146292498 17:31620134-31620156 CATGGAGGACAGAAGGCAGTGGG - Intergenic
1147268340 17:39248464-39248486 CTGGCATGATACAAGGCAGAAGG + Intergenic
1147476251 17:40714492-40714514 TTGGGGGGATATATGGCAGGTGG + Intergenic
1147759455 17:42788034-42788056 CTGGGAGGATATTAGGGAGATGG - Intronic
1150973796 17:70060814-70060836 CTGGGAGGAAATAAGGGAGCAGG + Intronic
1151893114 17:76962831-76962853 CGGGGAGCTTATAATGCAGTTGG + Intergenic
1152083801 17:78205255-78205277 CCGGGAGGATTTCAAGCAGTTGG - Intronic
1155671898 18:28381466-28381488 TTTGGAGGATAGAAGGCAATGGG + Intergenic
1156352367 18:36312047-36312069 CTGGGAGGGTACAGGGCAGGGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158910410 18:62055638-62055660 CTGGGGGGAAATAAGGTAGAGGG + Intronic
1159423787 18:68257774-68257796 GTGGGGGGATGTGAGGCAGTAGG - Intergenic
1163527555 19:17830798-17830820 CTGGGAAGAGCTAAGGCTGTGGG + Intronic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
926942428 2:18152465-18152487 CTAGGAGTATTTAAGGCAATAGG - Intronic
927382972 2:22500080-22500102 CTGAAAGGATGTGAGGCAGTAGG - Intergenic
927554664 2:24023373-24023395 CTGAGAGGACATCAGGCAGTAGG + Intronic
929630005 2:43449838-43449860 TTTGGAGGCTAGAAGGCAGTGGG + Intronic
930790180 2:55317350-55317372 CTGGGGGGAAAAAAGGCATTTGG + Intronic
932521537 2:72419625-72419647 GTTGGAGGCCATAAGGCAGTGGG - Intronic
932877869 2:75472467-75472489 CTGGGAGGAGATTAGGCAATGGG + Intronic
936721032 2:115253409-115253431 CTGGGATGAAATAAGACATTGGG - Intronic
936993348 2:118388732-118388754 CACAGAGGATATAAGGCATTTGG + Intergenic
937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG + Intergenic
938844021 2:135189749-135189771 CTTGGAGGCCAGAAGGCAGTAGG + Intronic
939325764 2:140686166-140686188 CAGGGTGGATTTAAGGTAGTAGG + Intronic
940028997 2:149240738-149240760 ATGGGAGGATTTAAGCCAGGAGG + Intergenic
943431463 2:187807883-187807905 CTGGGAGGATGCAAAGCAATAGG + Intergenic
946579797 2:221115919-221115941 CTGGGAGGAAATAACGTAATAGG - Intergenic
948124620 2:235555645-235555667 TTGGCAGAATATAAGGAAGTTGG + Intronic
948439843 2:237979614-237979636 AGGGGAGGATGTAAGGCAGTTGG + Intronic
948687438 2:239677847-239677869 CTGAGAGCACAGAAGGCAGTGGG - Intergenic
1169067387 20:2701719-2701741 CTGGAAGGCTCTCAGGCAGTGGG - Intronic
1171478668 20:25435201-25435223 TTTGGAGGCTAGAAGGCAGTGGG - Intronic
1171480672 20:25453702-25453724 CTGGGAGGATAAAAGAGAGCAGG - Intronic
1172189606 20:33054017-33054039 ATGGGAGGGCAGAAGGCAGTGGG - Intergenic
1173554234 20:43954233-43954255 GTGGGAGCATTTAAGGCAGAGGG - Intronic
1173568838 20:44063593-44063615 CTGGGTGGATACCAAGCAGTGGG - Intronic
1174412577 20:50345578-50345600 CTGGGAAGATCTGGGGCAGTGGG - Intergenic
1175035080 20:55992674-55992696 CTGGGATGAGAAAAGGCACTAGG - Intergenic
1176909740 21:14550178-14550200 ATGGGAGGAGTTAAGGAAGTGGG + Intronic
949870768 3:8586446-8586468 TTGGGAGAATATAAGGAATTTGG + Intergenic
950426083 3:12925421-12925443 CTGGAAGGTTATATGGCTGTTGG - Intronic
950657798 3:14447872-14447894 AGGGGAGGAGATAAGGAAGTGGG - Intronic
951143791 3:19201435-19201457 CTTGGAGGAGAGAAGGCTGTGGG - Intronic
952775344 3:37040725-37040747 CTGGGAGGAAAGAAGGCATCAGG - Intronic
962379572 3:134886945-134886967 CTGGGAGGAAATAGGGAAATAGG + Intronic
967395900 3:189008651-189008673 CTGGGAGGCTCTAAAGCAATGGG + Intronic
967817708 3:193813289-193813311 CTGGGAGGGTCTGAGGTAGTGGG - Intergenic
968058801 3:195712923-195712945 CAGGGAGGAGTTAGGGCAGTAGG - Intergenic
968058947 3:195713422-195713444 CAGGGAGGAGTTAGGGCAGTAGG - Intergenic
968359412 3:198136885-198136907 CTGGAAGGATCTGAGGCAGAAGG - Intergenic
969460204 4:7325000-7325022 ATGGGAGGGCAGAAGGCAGTGGG + Intronic
971508271 4:27390454-27390476 CTTGGAGGAGATAACACAGTAGG + Intergenic
971562995 4:28105380-28105402 CTCTGAGGATGTAAGGCATTTGG + Intergenic
976087661 4:81422724-81422746 CTTGGTTGAGATAAGGCAGTTGG - Intergenic
977579512 4:98709452-98709474 TTTGGAGGCTAGAAGGCAGTGGG - Intergenic
980287054 4:130793510-130793532 TTGAGAGGATATAATGCATTAGG + Intergenic
981095693 4:140777589-140777611 CTAGGGGAATATAAGCCAGTTGG + Intergenic
983933008 4:173473712-173473734 TTGGGAGGCAATAAGGCCGTGGG + Intergenic
984023611 4:174516965-174516987 CTAGGAGGATATCATGAAGTAGG + Intronic
984132181 4:175891434-175891456 CTGGGAGGACTCAAGGAAGTGGG - Intronic
986767295 5:10939537-10939559 CAGGGAGGGCATAAGCCAGTGGG + Intergenic
988190008 5:27918126-27918148 TTTGAAGGATAGAAGGCAGTGGG + Intergenic
989082160 5:37634578-37634600 ATTGGAGGAAATAAGGCAATAGG + Intronic
992895334 5:81240337-81240359 CAGGGAGGATCTGAGGCAGCTGG + Intronic
995974796 5:118020835-118020857 CTGGGAAAATACAAGGCACTTGG - Intergenic
996480153 5:123966810-123966832 TTGGAAGGCTATAAGGCAATGGG + Intergenic
999519023 5:152331289-152331311 TTGGGAGAAGATAAGCCAGTGGG - Intergenic
999524513 5:152389360-152389382 ATGGCAGTATATGAGGCAGTAGG + Intergenic
999861310 5:155649693-155649715 CTGAGAGGAACTAAGGCAGGAGG + Intergenic
1000141775 5:158411730-158411752 CTGGGAGGATAAAAAGCAAGAGG + Intergenic
1005036034 6:21555639-21555661 CAGGGAAGATTTAAGGCAGGAGG + Intergenic
1006782114 6:36639153-36639175 GTGGGAGGAAATGGGGCAGTGGG - Intergenic
1011937379 6:92797947-92797969 ATTGGAGGACAGAAGGCAGTGGG - Intergenic
1012211317 6:96521885-96521907 CTGGGAAGAGATTAGGCGGTTGG + Exonic
1013131418 6:107237040-107237062 TTGGGAGGCTGTAAGGCAGAAGG - Intronic
1014825091 6:126040869-126040891 CTGGGAGGAAATAGTGGAGTAGG + Intergenic
1016406057 6:143732012-143732034 ATGGAAGGAGATAAGGCAGTTGG - Intronic
1019260587 7:79791-79813 CTGGAAGGATCTGAGGCAGAAGG + Intergenic
1024220647 7:47283989-47284011 CTGGGTGCATGTAAGGCAGATGG + Intronic
1024494013 7:50022010-50022032 CACAGAGGATAGAAGGCAGTGGG + Intronic
1029102725 7:98147063-98147085 CGTGGAGGCTAGAAGGCAGTGGG - Intronic
1031009025 7:116504622-116504644 CTGGGTGGGCATAAGGGAGTAGG - Intronic
1032995421 7:137440698-137440720 ATGAAAGGACATAAGGCAGTTGG + Intronic
1034312588 7:150101951-150101973 ATAGGAGGATAAAGGGCAGTGGG + Intergenic
1034710778 7:153189739-153189761 CTGGGATGATTTAGGGCAGGAGG - Intergenic
1034794268 7:153998710-153998732 ATAGGAGGATAAAGGGCAGTGGG - Intronic
1034896233 7:154878105-154878127 CTGGGAGGAGATAGAGCAGGTGG - Intronic
1036159857 8:6377268-6377290 CTTGGAGGCCAGAAGGCAGTGGG + Intergenic
1037831973 8:22195119-22195141 CAGGGAGGAAAAAAGGCAGTTGG + Intronic
1039617365 8:38966677-38966699 CTGGGAGGAAATAAGTAACTCGG + Intronic
1040935222 8:52775338-52775360 CTGGGAGGATTTAGGGCAGGGGG - Intergenic
1041206653 8:55506222-55506244 CTGGGAGGACTTAGGACAGTGGG + Intronic
1043774174 8:84243863-84243885 CTGGGAGGATATAAGTCAGGAGG + Intronic
1045314984 8:101035806-101035828 CTGGGAGATTAGAAGGCAGGAGG - Intergenic
1046805252 8:118473063-118473085 CTGGCAGGAGGTGAGGCAGTGGG + Intronic
1047809223 8:128390208-128390230 CTGGGAGGACACAAGACAGAGGG + Intergenic
1049044745 8:140140634-140140656 CTGGGAGGCAGAAAGGCAGTGGG - Intronic
1050155542 9:2663076-2663098 CAGGGAAAATATAAAGCAGTTGG - Intergenic
1053145695 9:35710757-35710779 CTCGGAGGAGAGAGGGCAGTAGG - Intronic
1054875476 9:70091848-70091870 TTGGGAGAAAACAAGGCAGTAGG - Intronic
1055649962 9:78397541-78397563 CTGGGAGTGAATAAGGCACTTGG - Intergenic
1055667456 9:78566816-78566838 TTGGGAGGATTTCAGGAAGTGGG + Intergenic
1056715922 9:89028030-89028052 CTGGGGAGAATTAAGGCAGTAGG + Intronic
1060215253 9:121735161-121735183 CTGGGAGCCTTTTAGGCAGTAGG + Intronic
1060555455 9:124505207-124505229 CTGGGCAGGTATAGGGCAGTGGG + Intronic
1061318418 9:129812500-129812522 CTGGGAAGCCATAAGGCAGAGGG + Intergenic
1062744099 9:138200599-138200621 CTGGAAGGATCTGAGGCAGAAGG - Intergenic
1186502997 X:10066799-10066821 GTGGGAGGAGACAAGGAAGTCGG + Intronic
1190321996 X:49185001-49185023 CTGGAAGGATCTAAGGCTGGTGG - Intronic
1193521478 X:82535132-82535154 CGGTGAGGATATAAGGCAGGCGG + Intergenic
1196105314 X:111888952-111888974 ATGGGAGGCTGTAAGGGAGTAGG + Intronic
1197398534 X:125959204-125959226 CTTGGAGGCCATAAGGCAGTAGG + Intergenic
1198444518 X:136698576-136698598 CTTGGAGGCCAGAAGGCAGTGGG + Intronic
1199924490 X:152448597-152448619 CTGAGGGGATACAATGCAGTGGG - Intronic
1200216947 X:154372094-154372116 CCGGGAGGATATGGGGCACTGGG + Intronic
1201233032 Y:11884011-11884033 CTGGCAGGGAATGAGGCAGTTGG - Intergenic
1201233038 Y:11884067-11884089 CTGGCAGGGAATGAGGCAGTTGG - Intergenic