ID: 1092199345

View in Genome Browser
Species Human (GRCh38)
Location 12:6570440-6570462
Sequence AGCCCGCCAGCTCCTGCAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092199342_1092199345 -6 Left 1092199342 12:6570423-6570445 CCAGGGTCCAGAAGGCCAGCCCG 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1092199345 12:6570440-6570462 AGCCCGCCAGCTCCTGCAGATGG 0: 1
1: 0
2: 0
3: 20
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092199345 Original CRISPR AGCCCGCCAGCTCCTGCAGA TGG Exonic
900493339 1:2964244-2964266 AGCCCGCCTGCCCCAGCATAAGG + Intergenic
900504053 1:3020438-3020460 AGCCCCTCAGCTCCTGCTGGTGG - Intergenic
901922427 1:12546876-12546898 AGCCTGCCAGCTCCTGGATGGGG - Intergenic
902902787 1:19531499-19531521 AGATTGCCTGCTCCTGCAGAGGG + Intergenic
904678985 1:32215783-32215805 GGCCTTCCACCTCCTGCAGAGGG + Exonic
905335341 1:37240932-37240954 AGCCTGCCAGCTCCAACAGATGG + Intergenic
905369929 1:37477488-37477510 AGCCCGCCTGCCCCTGGGGAGGG - Intronic
905896310 1:41547992-41548014 ACCCTGCCAGTTCCTCCAGATGG + Intronic
907463292 1:54618733-54618755 CCACCGCGAGCTCCTGCAGATGG - Intronic
908128061 1:61050238-61050260 GGCCCGCCAGCCCCTGGAGAGGG - Intronic
910713434 1:90204990-90205012 AGCCCCCAAGCTCCCCCAGATGG - Intergenic
911415103 1:97562014-97562036 AGACTGCAAGCTCCTGCAGATGG + Intronic
913197654 1:116471426-116471448 TGACATCCAGCTCCTGCAGAGGG - Intergenic
915651071 1:157311358-157311380 AGCCTGTCAGCTTCTGCAGGGGG - Intergenic
922774705 1:228209287-228209309 AGCCCCCCAGACCCTGCAGTCGG + Intronic
922785775 1:228281640-228281662 GGGCAGCCAGCTCCAGCAGAGGG + Intronic
923116965 1:230949351-230949373 GGCCCTCCAGCTCTTGCAGCTGG + Intronic
923490234 1:234478233-234478255 AGCGCGCTACCTGCTGCAGAGGG - Exonic
1062856805 10:783890-783912 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1062856826 10:783951-783973 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1062856847 10:784012-784034 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1062856868 10:784073-784095 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1062856888 10:784134-784156 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1062856909 10:784195-784217 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1062856930 10:784256-784278 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1062856951 10:784317-784339 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1062856971 10:784378-784400 GGCCGGCCAGCACCTGCTGACGG + Intergenic
1065134595 10:22655353-22655375 AGACCTCCACCTCCTGCCGAGGG - Intronic
1067453610 10:46397752-46397774 GGCCAGCCAGCTCCTGCTCAGGG + Intergenic
1067583620 10:47461994-47462016 GGCCAGCCAGCTCCTGCTCAGGG - Intronic
1067633623 10:47987342-47987364 GGCCAGCCAGCTCCTGCTCAGGG - Intergenic
1068906031 10:62323813-62323835 AGCCCGAAAGCTCCTTCAGCTGG + Intergenic
1070166872 10:73905564-73905586 AGGCAGCCACGTCCTGCAGAGGG - Intergenic
1073297857 10:102451657-102451679 AGCCTCCCAGCGCCTGCAGGTGG + Intergenic
1076462988 10:130659051-130659073 AGGCCCCCAGCCCCTCCAGATGG - Intergenic
1076720151 10:132388893-132388915 AGCCCCCGAGCCCCTGCAGGCGG - Intergenic
1076882982 10:133248481-133248503 AGCCCGCGAGCACGTGGAGAGGG + Intergenic
1077394335 11:2313722-2313744 TGGCCGCCAGCTCCTGCCGCCGG - Exonic
1078909568 11:15718301-15718323 AGCCCTGCAGCTCCTGGAGCTGG - Intergenic
1079128617 11:17735245-17735267 GGCCCGCCATCTCCTCCAGGAGG + Exonic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081715410 11:45246487-45246509 ACCTCTCCAGCTCCTGCAGATGG + Exonic
1083731471 11:64654660-64654682 AGCCAGTCAGGTCTTGCAGAGGG + Intronic
1084089645 11:66871266-66871288 GGCCCCGCAGCTCCTGGAGAGGG - Intronic
1084101827 11:66954980-66955002 AGGCCTCCAGCCCATGCAGAAGG + Intronic
1085337987 11:75711977-75711999 AGGCCACCCTCTCCTGCAGATGG - Intergenic
1086885270 11:92198385-92198407 AGACCTGCAGGTCCTGCAGAAGG - Intergenic
1088728149 11:112657468-112657490 ACCCCTCCAGGGCCTGCAGAGGG - Intergenic
1089322104 11:117633347-117633369 ACCCCTCCAGCTCTTGCAGTTGG - Intronic
1091637480 12:2208492-2208514 AGCCTGCCAGCTCCCTCAGCCGG - Intronic
1092199345 12:6570440-6570462 AGCCCGCCAGCTCCTGCAGATGG + Exonic
1092727531 12:11500057-11500079 TGCCCGGCAGTGCCTGCAGAAGG + Intronic
1094443870 12:30508632-30508654 AGCTTGACAGCACCTGCAGAAGG + Intergenic
1097350216 12:58540651-58540673 AGTGCGACAGCTCCTGTAGATGG + Intergenic
1098042679 12:66368221-66368243 AACACTCCAGCTCCTGCAGGTGG - Intronic
1101468926 12:104977035-104977057 GGCCCGCCACACCCTGCAGATGG - Intergenic
1101897710 12:108768759-108768781 AGCGCGCCACCTCCTCCAGACGG + Intergenic
1102517088 12:113456958-113456980 TGCCCCCCAGCACCTGCTGATGG - Intergenic
1106768554 13:32940233-32940255 AGCCCGACAACTCCTTCAGATGG + Intergenic
1108408666 13:50127167-50127189 AGCGCGCCAGCTCCCGCACCAGG - Intronic
1112953943 13:105036474-105036496 TGCCCACCAGCTCCTACACAGGG + Intergenic
1113635609 13:111917010-111917032 AGCCCCCCAGTTCCTCAAGATGG - Intergenic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1120703888 14:87727521-87727543 AGCCAGCCAGCTTCAGCACATGG + Intergenic
1121231003 14:92358425-92358447 AGCACCCCAGCACCTACAGATGG - Intronic
1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG + Intronic
1129461116 15:75700484-75700506 CCCCCGCCAGCCCCTGCAGAAGG - Intronic
1129723716 15:77891258-77891280 CCCTCGCCAGCCCCTGCAGAAGG + Intergenic
1130404353 15:83584641-83584663 AGCACTCTAGCTCCTACAGATGG - Intronic
1130683012 15:86012885-86012907 TCCCCGGCAGCTCCTGCCGATGG + Intergenic
1130902947 15:88220674-88220696 AGCCAGCCATTTCCTGCACATGG + Intronic
1131445159 15:92492759-92492781 AGCCAGCCTCATCCTGCAGATGG - Intronic
1132038168 15:98503551-98503573 AGCCCTCAAGCTTCAGCAGAAGG + Intronic
1133222537 16:4324972-4324994 TGCCCGCCAGCCCCTGCTGCTGG + Intronic
1134135473 16:11673957-11673979 AAACCGGCAGCTTCTGCAGAGGG - Intronic
1135194939 16:20386561-20386583 AGCACGCCTGCTCCTGCAATGGG + Intronic
1137581460 16:49636007-49636029 TGCCCGCCAGCTTCTGCATGTGG + Exonic
1138178234 16:54923064-54923086 AGGCCGGGAGCTCCTGCACAGGG - Intergenic
1138477523 16:57280910-57280932 AGGCTCCCAGCTCCTGGAGAAGG - Intronic
1141435623 16:83998195-83998217 TGCCCGGCAGCACCTGCAGCTGG + Exonic
1142121534 16:88388865-88388887 AGCTCCCCAGCTTCTACAGATGG - Intergenic
1142223392 16:88866008-88866030 GGCCTGCCAGCTCCAGCAGAGGG + Intronic
1142348254 16:89568022-89568044 AGTGCGGCAGCTTCTGCAGAGGG - Intergenic
1142848718 17:2694264-2694286 TGCCCCCCAGGTCCTGCTGAAGG - Exonic
1144848711 17:18233372-18233394 TGCCTCCCAGCTTCTGCAGATGG + Intronic
1146343341 17:32040892-32040914 GGCCCTCCAGCTTCTGCAGGTGG - Intronic
1148216622 17:45836993-45837015 AGCCCCGCAGCTCCTGCTGAGGG + Intergenic
1148331869 17:46818282-46818304 AGTCCTCCAGCCCCTGCAGCGGG + Intronic
1148807021 17:50269071-50269093 AGCTGGCCAGCCCCTGCAGCAGG + Intergenic
1150782604 17:68135118-68135140 GGCCCTCCAGCTTCTGCAGGTGG + Intergenic
1151272468 17:73007614-73007636 CACCCACCAGCTCCTGCAGCTGG - Intronic
1152944123 17:83189821-83189843 AGCCTGCCTGCTGCTGGAGACGG + Intergenic
1153820437 18:8827144-8827166 AGCCAGGCTGCTCCCGCAGATGG + Intronic
1153985030 18:10343932-10343954 AGCCCGCCGGCCCCTCCAGCAGG - Intergenic
1155914582 18:31543335-31543357 ACCAAGCCTGCTCCTGCAGAGGG - Intronic
1156521454 18:37725304-37725326 AGACCCCCAGCTCCTTAAGAAGG + Intergenic
1158230143 18:55245520-55245542 AGCACGGCAGCTCCAGCAGTTGG - Intronic
1158960943 18:62587328-62587350 CGCCTCCCAGCTCCTGCAGCAGG - Intronic
1160858992 19:1229793-1229815 GGCGCGCCGGCTGCTGCAGATGG - Exonic
1160865889 19:1255751-1255773 AGCCCACCAGCTCACACAGAGGG - Intronic
1161962142 19:7528811-7528833 ACCCCACAAACTCCTGCAGAAGG - Exonic
1162517123 19:11155341-11155363 AGACCCCCAGCTCCTGCTCACGG + Intronic
1162896218 19:13766023-13766045 AGCCCGCCACCTCCTGGAGCGGG + Exonic
1166314269 19:41980030-41980052 AGCCAGCCAGCCAGTGCAGAGGG - Intronic
1166738518 19:45100314-45100336 AGCCGGCCACCTGCTGCAGTAGG + Intronic
1167382974 19:49149256-49149278 GGCCCGGCAGCTTCTGGAGAAGG + Exonic
929002467 2:37361589-37361611 AGCCTGCCAGTCCCAGCAGAAGG + Intronic
930116512 2:47722909-47722931 AGCCTTCCCGCTCCTGCAGTTGG + Intronic
930666462 2:54103898-54103920 AGCCGGCCAGGTCATGCAGCAGG + Intronic
932493364 2:72134886-72134908 GGCTCGGCAGATCCTGCAGAAGG - Exonic
933560093 2:83877388-83877410 TGCCCTCCAGCTCCTCCAGCTGG - Intergenic
935446069 2:103158213-103158235 AGCCACCTAGCTCCTGCTGAAGG + Intergenic
937079145 2:119127900-119127922 AGCTCTCCAGCTGCTGCGGAGGG + Intergenic
938175587 2:129124486-129124508 ATCAGGCAAGCTCCTGCAGAGGG - Intergenic
940276644 2:151947140-151947162 AGCCCTCCACAGCCTGCAGAAGG + Intronic
945470489 2:210223546-210223568 AGCCCCCCAGCCCATTCAGAGGG + Intronic
946414589 2:219533483-219533505 AGCCCGTCAACTCCTGGAGAGGG + Intronic
948179663 2:235969806-235969828 AGCCCGCCAGCCTCCGCAGAAGG + Intronic
948926004 2:241098477-241098499 AGACCCCCAACTCCTCCAGAAGG + Intronic
1170509192 20:17059398-17059420 AGGCCGCCAGCTCATTCACAGGG - Intergenic
1171278727 20:23879454-23879476 AGGCAGCCATCACCTGCAGAGGG + Exonic
1171401153 20:24873655-24873677 AGCACGCTAGCTCCATCAGAAGG + Intergenic
1172570797 20:35968786-35968808 TGCCTGGCAGCTCCTGAAGAAGG + Exonic
1172896637 20:38304770-38304792 TGGCCGCCAGCCCCTGCAGTGGG - Intronic
1172993459 20:39052522-39052544 AGCCCGGCGGCTGCTGCTGAAGG + Intergenic
1174255768 20:49253779-49253801 ATACCGCCAGATCCTACAGAAGG - Exonic
1174349633 20:49957724-49957746 GGCCCGCTATTTCCTGCAGATGG + Intergenic
1174386842 20:50192358-50192380 CGCCCGCCGGCGCCTGGAGAGGG - Exonic
1174568879 20:51486978-51487000 AGCCTGGCAGCTCATGGAGATGG + Intronic
1175166666 20:57048888-57048910 ATCCCCCAAGCTCCTCCAGAGGG - Intergenic
1175826113 20:61937570-61937592 AGCCCTTCAGCCCCAGCAGAAGG + Exonic
1175889508 20:62310069-62310091 ACCCCGCCAGGTCCTGCTGCGGG - Exonic
1176163221 20:63659093-63659115 GCCCCGCCAGCTCCTCGAGATGG + Intronic
1179980203 21:44891656-44891678 ATCTCCCCACCTCCTGCAGAAGG + Intronic
1180854799 22:19039070-19039092 AGCCTGCCAGCCCCTGGGGATGG - Exonic
1181570628 22:23766239-23766261 TGCCCCCCAGCCCCTGCAGATGG - Exonic
1183743449 22:39680450-39680472 AGTCCTCCAGCTCCTGCTGATGG - Intronic
1185250422 22:49798909-49798931 ACGCTGGCAGCTCCTGCAGAGGG - Intronic
950196883 3:11015597-11015619 AGGCAGGCAGCTCCTACAGAGGG - Intronic
950643325 3:14362243-14362265 AGCCCCCCTGCTTCTGCACAGGG - Intergenic
953433139 3:42856036-42856058 AGCCTGTGAGCTGCTGCAGAAGG - Intronic
954291331 3:49651533-49651555 TGCCCACCAGGTCCTGCAGCAGG - Exonic
957730442 3:84126358-84126380 AGCCCGCCAGCTGCTGTAGTGGG - Intergenic
960952525 3:123008875-123008897 AGCCCCCCAGCTCCAGCTGCAGG - Intronic
961009648 3:123427138-123427160 AGCCCTCCAGCTCCCTCAGTGGG + Intronic
961346872 3:126268658-126268680 AGCAGGGCAGCCCCTGCAGAGGG + Intergenic
964980013 3:162667014-162667036 ACCCCTCCAGATCCAGCAGAGGG - Intergenic
967814700 3:193788853-193788875 AGCTCGCCAGCTCTGGCTGATGG + Intergenic
967870462 3:194225104-194225126 AGCCAGCCAGCCCCCGCAGCAGG + Intergenic
967930556 3:194687456-194687478 CGCCCACCAGCTCCTGCTGCTGG - Exonic
968186041 3:196634214-196634236 AGACCGCCACCTCCTCCAGGAGG + Intergenic
969518844 4:7664091-7664113 AGCCTGCCATCCCCTGCAGGAGG - Intronic
970332901 4:15003315-15003337 AGCCGGCCCGCTCCTCCAGCCGG + Exonic
971158627 4:24109885-24109907 TGTCCTCCAGCTACTGCAGATGG + Intergenic
972121796 4:35712767-35712789 GTCCCACCAACTCCTGCAGAGGG + Intergenic
981478729 4:145213992-145214014 AGCAGGCCATCTCCTGCAGCAGG - Intergenic
983096501 4:163568628-163568650 AGCCACTCAGCTCCTGAAGAAGG - Intronic
986215163 5:5712930-5712952 AGACACCCAGCTCCTGCACACGG + Intergenic
990716362 5:58641654-58641676 AGACAGCAAACTCCTGCAGAAGG - Intronic
994948165 5:106423250-106423272 AGCCACCCAGCACCAGCAGAGGG - Intergenic
1001773548 5:174312547-174312569 ACCCCGCCAGCTGGTGCAGGAGG - Intergenic
1001999105 5:176187130-176187152 AGCCTGCCAGCTCCTGCCTCTGG - Intergenic
1002372758 5:178768214-178768236 AGCCAGCCATCTGCAGCAGACGG + Intergenic
1005761160 6:28969418-28969440 GGCCCGCTATGTCCTGCAGATGG - Intergenic
1008618297 6:53247012-53247034 AGCCCACCAGCTCCAGCAACAGG - Intergenic
1018629444 6:165809566-165809588 AGCCTGCCAACTCCTGGAGGTGG + Intronic
1018844775 6:167547942-167547964 AGCCTACCATCTGCTGCAGATGG - Intergenic
1019711444 7:2519885-2519907 CGCCCGCCAGCGCCAGCAGCAGG - Exonic
1019743794 7:2688513-2688535 GCCCCGGCAGGTCCTGCAGAGGG + Intronic
1020082725 7:5295521-5295543 TGGCCTCCAGCCCCTGCAGAGGG + Intronic
1020142750 7:5621555-5621577 GGCCCGCCACCTCCTGAAGCAGG - Intronic
1020418231 7:7969507-7969529 AGCCGGCCGGCTCCCGCAGCCGG - Exonic
1023255887 7:38311661-38311683 TGCCCCCCAGCCCCTGCAGATGG + Intergenic
1024782249 7:52864999-52865021 AGCCCACCACCCCCAGCAGAGGG + Intergenic
1027151992 7:75739388-75739410 ACCCTGCCCGCTCCTGCAGGGGG + Intergenic
1028625321 7:92870883-92870905 TGCCTGCCAGGTTCTGCAGATGG - Intergenic
1029577154 7:101411243-101411265 AGACTCCCAGCTCCTGAAGACGG - Intronic
1034470280 7:151251194-151251216 AGCTCACCAGCTCCTCCACAGGG - Intronic
1037459579 8:19095446-19095468 GGTCCAGCAGCTCCTGCAGATGG + Intergenic
1040015515 8:42696129-42696151 AGACCACCAGCTCCTGCAGGAGG - Intergenic
1040905153 8:52461422-52461444 ACTCCGGCAGCCCCTGCAGAAGG - Intergenic
1043320715 8:78982626-78982648 AGCTAGCCAGCTCCTGGAGATGG + Intergenic
1048899266 8:139022172-139022194 AGCCCAGAGGCTCCTGCAGAGGG - Intergenic
1048915316 8:139177501-139177523 AGCCTGATGGCTCCTGCAGAAGG - Intergenic
1049102397 8:140589069-140589091 GGACCGCCTGCTCCTGCAGGAGG - Intronic
1049260271 8:141635300-141635322 TGCCTGCCAGCACCAGCAGATGG - Intergenic
1049745526 8:144261653-144261675 AGCGCTCCAGATCCTGCTGAAGG + Exonic
1052612942 9:30799749-30799771 AGCCCGCTACGCCCTGCAGATGG - Intergenic
1052994161 9:34541058-34541080 GGCACACCAGCTCCTGCAGCAGG + Intergenic
1053316014 9:37052430-37052452 ACCCCTCCAGCTCTTTCAGAGGG + Intergenic
1057227012 9:93297780-93297802 ACACCGCCAGCTCCTCCAGGAGG - Intronic
1057298347 9:93862150-93862172 AGCCCACCAGCTCCTCCTGGAGG + Intergenic
1059235323 9:112755849-112755871 AGCTTCCCAGCTCCAGCAGAAGG + Intronic
1059638374 9:116192269-116192291 AGACAGCCAGCCCATGCAGAGGG + Intronic
1060588105 9:124799416-124799438 GGGCCTCCAGCTGCTGCAGAAGG + Exonic
1061862441 9:133475017-133475039 TGCCCGTCAGCTGCTGCAGGAGG + Exonic
1061954440 9:133954277-133954299 CGCCCACCAGCACCTGCTGAGGG + Intronic
1062398090 9:136360585-136360607 ATCCCGCCAGCTCCTGCCTGAGG - Intronic
1062400495 9:136370530-136370552 AGGCCTCCAGCTCCTGCACCCGG + Exonic
1193057550 X:77169234-77169256 AGCCTGCCAGCTCCTTCAAAAGG + Intergenic
1199540483 X:148952977-148952999 GGCCCCCCAGCTCCTTCAAAGGG - Intronic
1200179127 X:154139785-154139807 AGCCCGGCAGCTGGGGCAGAGGG + Intergenic
1200281323 X:154779326-154779348 AGCCCTGCAGCAGCTGCAGAAGG - Exonic
1200939471 Y:8766896-8766918 AGGTTGACAGCTCCTGCAGATGG - Intergenic