ID: 1092201622

View in Genome Browser
Species Human (GRCh38)
Location 12:6587866-6587888
Sequence GCGCTCCTCCACTGACGCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092201619_1092201622 -10 Left 1092201619 12:6587853-6587875 CCACCTGCGTGATGCGCTCCTCC 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1092201622 12:6587866-6587888 GCGCTCCTCCACTGACGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1092201617_1092201622 28 Left 1092201617 12:6587815-6587837 CCGCACCACTAGATGCGTCAGCA 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1092201622 12:6587866-6587888 GCGCTCCTCCACTGACGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1092201618_1092201622 23 Left 1092201618 12:6587820-6587842 CCACTAGATGCGTCAGCATCATT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1092201622 12:6587866-6587888 GCGCTCCTCCACTGACGCACGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092201622 Original CRISPR GCGCTCCTCCACTGACGCAC GGG Exonic
900002670 1:23407-23429 GTCCTCCCCCACTGACTCACCGG - Intergenic
900022388 1:193932-193954 GTCCTCCCCCACTGACTCACCGG - Intergenic
900754324 1:4423200-4423222 GTGCTCCACCACTGCCGCAAGGG - Intergenic
901177618 1:7316165-7316187 GCGTTCCTCCCATGACACACAGG + Intronic
901201840 1:7471619-7471641 CTGCTCCTCCCCTGACCCACTGG - Intronic
905245423 1:36609976-36609998 AGGCTCCTCCACTGACTCTCTGG - Intergenic
910237172 1:85048172-85048194 GCGCTCCTCCACTGACCTGCGGG + Intronic
921584273 1:216929469-216929491 GCTCCCCTCCACACACGCACTGG - Intronic
922766238 1:228158066-228158088 CCGCTCCTGCTCAGACGCACGGG - Exonic
923712419 1:236397819-236397841 GCGCTCCTCCATTTAAACACAGG + Intronic
1074709354 10:116164096-116164118 GCCCTTCTCCAATGTCGCACAGG + Intronic
1081673929 11:44957383-44957405 GCTCTCCTCCTCCCACGCACCGG + Intergenic
1081741228 11:45442230-45442252 GCCCTCCTACACAGAGGCACTGG - Intergenic
1087124885 11:94615048-94615070 GAGCACCTCAACTGACTCACAGG - Intronic
1091376087 12:25470-25492 GTCCTCCCCCACTGACTCACCGG - Intergenic
1091932820 12:4410417-4410439 AAGCTTCTCCACTGACACACTGG + Intergenic
1092201622 12:6587866-6587888 GCGCTCCTCCACTGACGCACGGG + Exonic
1095148634 12:38763196-38763218 CAGCTCCTCCACTGATGCTCAGG - Intronic
1100420014 12:94423819-94423841 GCTCTCCTCGACTGAAACACTGG + Intronic
1102915730 12:116750378-116750400 GGGCTCCTCCTCTGAAGCCCAGG + Intronic
1122417077 14:101555095-101555117 GGCCTCCTCCACTCAAGCACTGG - Intergenic
1131095120 15:89649706-89649728 GGGGTCCTCCACTGACGGAGAGG - Intronic
1132450841 15:101967532-101967554 GTCCTCCCCCACTGACTCACCGG + Intergenic
1143555074 17:7654927-7654949 GCCCTCCTCCACCAACGCCCTGG + Intronic
1144158143 17:12528282-12528304 GTTCACCTCCACTGAGGCACAGG + Intergenic
1154483230 18:14856436-14856458 GCGCTCCTCAACTGCCAGACCGG + Intergenic
1160634421 19:65015-65037 GTCCTCCCCCACTGACTCACCGG - Intergenic
927461012 2:23298153-23298175 GATCTCCTCCACTGACAGACAGG - Intergenic
947635511 2:231679026-231679048 GGCCTCCTCCACTCATGCACTGG - Intergenic
947821883 2:233077954-233077976 GAGCTTCTACACTGAGGCACTGG + Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1175731605 20:61358048-61358070 GCGCTCCTTCCCTGTCGCTCTGG + Intronic
1176797276 21:13379715-13379737 GCGCTCCTCAACTGCCAGACTGG - Intergenic
1180898499 22:19354253-19354275 GCGCCCCTGCACTTCCGCACAGG + Intronic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
954575275 3:51672242-51672264 GCGCTCGGCCCCTGCCGCACTGG + Exonic
967443510 3:189537307-189537329 GCCCTTCTCCACTGCCTCACCGG + Intergenic
967868640 3:194211322-194211344 CCTCTCCTCCACTGTCTCACTGG + Intergenic
967908441 3:194520932-194520954 GGGTTCCTCCAATGACACACAGG - Intergenic
969354970 4:6619949-6619971 GCGCTCCTCCACTGCCACCACGG - Exonic
971715579 4:30171583-30171605 GTGCTCCTCCACTACCCCACAGG + Intergenic
990573740 5:57104970-57104992 GTGCACCTCCACTGATGCTCTGG - Intergenic
997050223 5:130371429-130371451 CTGCTCCTCCACTGGGGCACAGG - Intergenic
998175966 5:139902313-139902335 GCACTCCTGCACTGAGGCAGAGG + Intronic
1000114763 5:158143338-158143360 GCCTTCCTCCACTGCTGCACAGG - Intergenic
1002190394 5:177474486-177474508 GGGCTCCTCCAAGGACGCTCAGG + Intergenic
1005258249 6:24027854-24027876 TGACTCCTCCACTGACGGACTGG + Intergenic
1005964853 6:30720164-30720186 GCGCTCGTCCACTGGCTCAGAGG + Intergenic
1011993952 6:93561205-93561227 GCGCTCCTCCCGTGACACATGGG - Intergenic
1018901849 6:168055639-168055661 GCGCACCTCCCCTGCCGCACAGG + Intergenic
1019119214 6:169790070-169790092 GCCCTCCTCCAGTCAAGCACCGG - Intergenic
1035733436 8:1869801-1869823 CCGCTATTCCACTGACCCACAGG + Intronic
1049885476 9:23520-23542 GTCCTCCCCCACTGACTCACCGG - Intergenic
1198102365 X:133432983-133433005 GGGCTCTTCCACTGGCCCACAGG + Intergenic
1200256231 X:154584750-154584772 GCGCTCCCCCAAGGACGGACAGG + Intergenic
1200261538 X:154619653-154619675 GCGCTCCCCCAAGGACGGACAGG - Intergenic
1200267520 X:154653950-154653972 GCGCTCCCCCAAGGACGGACAGG - Intergenic