ID: 1092203196

View in Genome Browser
Species Human (GRCh38)
Location 12:6600002-6600024
Sequence CCTTTACTGCAGGAGAAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092203196 Original CRISPR CCTTTACTGCAGGAGAAGGA AGG (reversed) Exonic
903935664 1:26893176-26893198 CCTTTCTTGGAGGAGGAGGAGGG - Intronic
904041886 1:27590109-27590131 CCTCCCCTCCAGGAGAAGGAGGG - Intronic
904409977 1:30319473-30319495 CCTGTCCTGCAGGAGGAGCACGG + Intergenic
904490483 1:30855829-30855851 CCTTGACTGCTGGAGAGAGAGGG + Intergenic
905645545 1:39622913-39622935 GCTTTCCAGGAGGAGAAGGAAGG - Intergenic
907408876 1:54270935-54270957 CCTTCACAGAAGGTGAAGGAGGG + Intronic
909561968 1:77017190-77017212 TGTTTACTGCTTGAGAAGGAAGG - Intronic
910314040 1:85861561-85861583 TTTTTTCTGCAGTAGAAGGAAGG + Intronic
910434442 1:87190953-87190975 GCTTTTCTGCTGGAGAGGGAGGG + Intergenic
910535765 1:88295747-88295769 CCTTTCCTGCAGGTGTAGGGTGG - Intergenic
910639819 1:89447249-89447271 CCTCTCCTCAAGGAGAAGGAAGG + Intergenic
912745854 1:112244628-112244650 CCTTGACTTCTGGAAAAGGATGG + Intergenic
912757409 1:112335915-112335937 CCTATAATGCAGGAGAAGGAAGG - Intergenic
912932844 1:113980191-113980213 CCTTTTCTGCAGGAGTGGAAGGG + Intronic
914397104 1:147280147-147280169 CCTTGCCTGCAGCAGAAGGAGGG + Exonic
914398383 1:147292191-147292213 CATTTACTGCATGAGTAAGAAGG + Intronic
915575327 1:156772194-156772216 CCTTTGTTGTAGGTGAAGGATGG + Intronic
915701152 1:157797934-157797956 CATTCACTGCAAGAGAAGGAGGG + Exonic
916931842 1:169586659-169586681 GTTTTACTGCAGGTGAAGAAGGG + Intergenic
917202332 1:172531312-172531334 CTCCAACTGCAGGAGAAGGAAGG + Intergenic
918476256 1:184928251-184928273 CCTCTCCTGAAGCAGAAGGAAGG + Intronic
921348809 1:214214472-214214494 CCTTTCCTGCAGTAGAAAAAGGG - Intergenic
921668177 1:217897497-217897519 CCTGTACTTCAGGAGAAGATAGG - Intergenic
922346466 1:224700678-224700700 CCCTTTCTCCAGGAGAATGATGG - Intronic
923069255 1:230547860-230547882 CCCAAACTGCAGGGGAAGGAAGG - Intergenic
924265468 1:242277190-242277212 CCTTTGCTCCAGGGGAAAGAGGG + Intronic
1063154323 10:3364547-3364569 ACTTTACTGTGGGAGAAGAAAGG + Intergenic
1065625876 10:27627755-27627777 TCTTTACTGAATGCGAAGGAGGG - Intergenic
1065787366 10:29229319-29229341 CCCCTAGTGCAGCAGAAGGAAGG - Intergenic
1066719359 10:38321286-38321308 CCTTTGCTCCAGGGGAAAGAGGG - Intergenic
1067542594 10:47166573-47166595 CCGGTACTGCAGGAAAAGAAAGG - Intergenic
1067554056 10:47255511-47255533 CCTTTACTGCAGAAGAGAGTGGG - Intergenic
1068755354 10:60646745-60646767 CAGTTACTGCTGGAAAAGGAAGG + Intronic
1069243550 10:66172312-66172334 CATTTACTGCAGGAAAACAAAGG - Intronic
1069308882 10:67008095-67008117 TCTCTACTGCAGGATAAAGATGG - Intronic
1070750658 10:78962263-78962285 CATTTACTCCAGGAGATGGCTGG - Intergenic
1072035052 10:91555472-91555494 ACTTTACTGCCTTAGAAGGAGGG - Intergenic
1072686077 10:97537748-97537770 CTTCTACTGCAGGGGATGGAGGG - Intronic
1073273360 10:102286615-102286637 CCTTTACAACAGGAAAAAGAGGG - Intronic
1073525436 10:104177377-104177399 CCATAAATGTAGGAGAAGGATGG + Intronic
1075888866 10:125928024-125928046 CCTTTCCTACAACAGAAGGATGG - Intronic
1076772689 10:132675210-132675232 CCATTTCTGCAGGAACAGGAAGG - Intronic
1077155807 11:1090316-1090338 CCCTTGCTGCAGGATCAGGAGGG + Intergenic
1078508623 11:11969291-11969313 GCTTTACAGCAGGGGAAGGAGGG + Intronic
1079294463 11:19219941-19219963 CTTTTCCTGCAGGAGAGGGATGG + Intergenic
1079870566 11:25793797-25793819 CCTTTCCTGTAGGAGGAGGGTGG + Intergenic
1080845035 11:36019634-36019656 CCTTTACTACTGGAGAGGTAAGG - Intronic
1081559988 11:44204789-44204811 CCATGACTGTAGGGGAAGGAGGG - Intronic
1082232288 11:49782129-49782151 CTTTTAATTCTGGAGAAGGAGGG + Intergenic
1082970169 11:59012187-59012209 CCATTCCTCCAGCAGAAGGAAGG - Intronic
1085770350 11:79320007-79320029 CCTCCACTGCAGTAGAAGGTAGG - Intronic
1086618341 11:88851820-88851842 CTTTTAATTCTGGAGAAGGAGGG - Intronic
1087215178 11:95485983-95486005 CCATTACTGGATGAGAGGGAAGG + Intergenic
1089654171 11:119935076-119935098 CCCCTCCTGCAGGAGAAGGCAGG - Intergenic
1089794220 11:120967340-120967362 CCTCTAGGGCAGGAGGAGGATGG - Intronic
1090452647 11:126820352-126820374 CTTTTCCTGCAGGAAAAGGTTGG - Intronic
1090569444 11:128030746-128030768 CCCTTACTCCAGGAGAAAGAGGG + Intergenic
1091273577 11:134334263-134334285 CCTTTCCTGTAGCAGAAGGCAGG + Intronic
1091521817 12:1253192-1253214 CTTTTTCTGCAGCAGAAAGAAGG - Intronic
1092203196 12:6600002-6600024 CCTTTACTGCAGGAGAAGGAAGG - Exonic
1094236754 12:28177011-28177033 CATTTCCTGCAGGAGGAGGCTGG + Intronic
1095100323 12:38175300-38175322 CCTTTCCTCCTGGAGAAGGTAGG - Intergenic
1095669948 12:44847252-44847274 CCCTTACTTCACGAGAATGAGGG - Intronic
1095806322 12:46324405-46324427 CCTTTCCTGAAGGTCAAGGACGG + Intergenic
1095854345 12:46843855-46843877 CTTTTATGGCAGGAGGAGGAAGG - Intergenic
1099025243 12:77457315-77457337 CATATACTGCATGAGAATGATGG - Intergenic
1102528458 12:113528805-113528827 CCTTTCCTGCTGGAGAGAGAGGG - Intergenic
1103805474 12:123569143-123569165 CATTTACTGAAGGTAAAGGAAGG - Intergenic
1104573393 12:129945013-129945035 CCTATGCTGCATGAGATGGAAGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107667577 13:42707632-42707654 CCTTTGATGCATGAGAACGATGG + Intergenic
1108572749 13:51767268-51767290 CCTTTTCTGCAGGAGGATGATGG - Exonic
1109344429 13:61098348-61098370 CTTGCACTGCAGGAGAAAGAGGG - Intergenic
1110881943 13:80582759-80582781 CCATTACTGCAGGAGTAAGGTGG - Intergenic
1110900821 13:80821980-80822002 ACTTTACTCCAGGAAAAGGCTGG + Intergenic
1110916798 13:81030932-81030954 CCTTTCCTCAAGCAGAAGGAAGG + Intergenic
1112379879 13:98878775-98878797 GCTTTACGGGAGGAAAAGGAGGG + Intronic
1112693164 13:101917701-101917723 CCCTTCCTGCAGCAGAAGGGAGG - Intronic
1112743595 13:102502895-102502917 CCTTGACTGCAAGAAAAGAAAGG - Intergenic
1113292913 13:108925725-108925747 CCTGTACTGCAGCAGAGAGATGG - Intronic
1114248013 14:20933066-20933088 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1114250847 14:20959165-20959187 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1114279809 14:21181936-21181958 CCATTACTGCAGGAGTAAGGTGG + Intergenic
1114530499 14:23392647-23392669 TCCTTCCTGCAGGAGAAGGGTGG + Exonic
1117066259 14:52015373-52015395 CCTGGACAGTAGGAGAAGGAAGG - Intronic
1117581615 14:57157203-57157225 CCTTAACTGGGAGAGAAGGAGGG - Intergenic
1117607044 14:57440576-57440598 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1119529845 14:75352431-75352453 CCTTTGCAGCAGGTGAGGGAGGG + Intergenic
1120445120 14:84585811-84585833 AGTTCACTGCAGGAGAAGGGAGG - Intergenic
1121709137 14:96024275-96024297 CCTTTACTGCTGGATCATGAAGG + Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1124824119 15:33076345-33076367 GCTTTACTGCATGAGAAGAAGGG - Intronic
1125072869 15:35576632-35576654 CACTTAATGCTGGAGAAGGAAGG + Intergenic
1126244561 15:46489156-46489178 CCTTCAGTGTAGGAGAAGCAAGG - Intergenic
1126517675 15:49554203-49554225 CCTTTCCTCTAGCAGAAGGAAGG + Intronic
1126901970 15:53323641-53323663 CCTCAACTGCAGGCAAAGGAAGG - Intergenic
1129615726 15:77097712-77097734 TCTATCCTGCAGGAGAGGGAAGG + Intergenic
1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG + Intronic
1133612886 16:7449943-7449965 CTCTGACTGCAGTAGAAGGATGG + Intronic
1135286612 16:21199002-21199024 CCTTTACTGTAGAAGTGGGATGG + Intronic
1137400706 16:48152208-48152230 CATTTACTTCAGGAGACAGAGGG + Intronic
1137523479 16:49213331-49213353 GCCTTCCTGCAGGAGAAGGTAGG + Intergenic
1138239009 16:55411447-55411469 CCTCTCCTGCAGGGGAAGGACGG + Intronic
1140070695 16:71647481-71647503 CCTATGCTGGAGGAGAGGGATGG - Exonic
1140467035 16:75190854-75190876 CCTTTAAAGCAGGAGAATGTAGG - Intergenic
1141057594 16:80833004-80833026 GCTTGGCTGCAGGAGAAGAAGGG - Intergenic
1142767667 17:2074835-2074857 CCTTTCCTGATGGAGAGGGAGGG + Intronic
1143265345 17:5632685-5632707 CCCTTTCAGCAGGTGAAGGACGG + Intergenic
1143309881 17:5979267-5979289 TCTTTAGTGCAGGATAAGGTGGG - Intronic
1143642877 17:8209511-8209533 TCTTGGCTGCAGAAGAAGGAAGG - Intronic
1143711176 17:8736316-8736338 CATTTACTGAGGGAGAAGCAGGG + Intronic
1144622223 17:16824817-16824839 CCTTGACTGCAGGGGAAGAGAGG - Intergenic
1144884201 17:18447896-18447918 CCTTGACTGCAGGGGAAGAGAGG + Intergenic
1145148028 17:20496481-20496503 CCTTGACTGCAGGGGAAGAGAGG - Intergenic
1149296430 17:55265767-55265789 CCTTTCATGGAGGAGGAGGAAGG - Intronic
1149508337 17:57214920-57214942 CATTTACTGCAAGTGAGGGATGG - Intergenic
1151201760 17:72473025-72473047 CCATTCCTGCAGGAGTAGGGTGG - Intergenic
1152024585 17:77800514-77800536 CCTCTACCCCAGGAGAAGGGAGG + Intergenic
1154172781 18:12063231-12063253 CGGTCACTGCAGGGGAAGGACGG + Intergenic
1155182689 18:23361696-23361718 CCCATCCTGCAGGAGACGGAAGG + Intronic
1155257104 18:24008355-24008377 CCCTGACTGCAGGAGGAAGAAGG - Intronic
1155280119 18:24230592-24230614 TTTTTAATGCAGCAGAAGGAAGG + Intronic
1156964504 18:43074418-43074440 CATTTACTGAAGTAGAAAGATGG - Intronic
1159133030 18:64302826-64302848 CATTTACTGCAAGCAAAGGATGG + Intergenic
1159479195 18:68965958-68965980 CTGTTACTGCTGGAGAGGGATGG + Intronic
1160442787 18:78905040-78905062 CCATTACAGATGGAGAAGGAGGG - Intergenic
1160819707 19:1052338-1052360 CCTTAACTTGAGGAGGAGGAGGG + Intronic
1161648522 19:5469602-5469624 CCTTTGCCCCAGCAGAAGGAAGG + Intergenic
1161669701 19:5599325-5599347 CCTTTATTGCTGGAGATGAATGG - Intronic
1161679046 19:5669868-5669890 GCTATCCAGCAGGAGAAGGAAGG + Intergenic
1161925388 19:7295192-7295214 ACCTTACTGCAGGAGAGGAAGGG + Intergenic
1162967618 19:14163548-14163570 CCGTGACTGCAGCAGCAGGAGGG - Intronic
1165401465 19:35603391-35603413 CCTGCACTGGAGGAGAAAGATGG + Intergenic
1165777015 19:38410753-38410775 CCTTGACTGCTGGGGTAGGAGGG - Intronic
1168182316 19:54670721-54670743 CCCTTTCTGTAGGAGGAGGATGG - Intronic
924984657 2:259042-259064 CCTAAACTGCAGGACAAGGAGGG - Intronic
927248593 2:20978353-20978375 CTGTTTCTGCAGGAGAATGAGGG - Intergenic
927440752 2:23115246-23115268 CCTTTACTTCAGGGGCAGGGTGG + Intergenic
927694286 2:25229870-25229892 CTTCTACTGCTGGAGAAGGTGGG + Exonic
928327677 2:30333111-30333133 CATTTCCTGCTGGAGGAGGAGGG + Intergenic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
928630861 2:33190450-33190472 CCTTTCTTCTAGGAGAAGGAGGG + Intronic
928767920 2:34670404-34670426 CCTTTCCTGGAGGGGAAGAAAGG - Intergenic
929437121 2:41937526-41937548 CCATTACACCAGGAGGAGGAGGG + Exonic
929456455 2:42069471-42069493 CCTCTGCTGCTGGACAAGGAGGG + Intergenic
929748447 2:44684141-44684163 TCTTTACTGCTGGAGAGAGAAGG + Intronic
931046275 2:58357513-58357535 CCTTTTGTGCATGTGAAGGAGGG + Intergenic
931269023 2:60685642-60685664 GCTTTACAGGAGGAGAACGAAGG + Intergenic
933893586 2:86791236-86791258 CCTTTAGTGAAGGCAAAGGAAGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
936241791 2:110794184-110794206 CCTGCACGGCAGGAGAAGGATGG - Intronic
938150057 2:128874802-128874824 CCTGTACCGCAAGAGAAGGAAGG - Intergenic
938173252 2:129101725-129101747 CCTTTCCTGCAGGAGAAAATTGG - Intergenic
941595388 2:167470596-167470618 TCTTTCCTGAAGCAGAAGGAGGG + Intergenic
943191242 2:184681751-184681773 CCTTTAATTCAGTAGAAGGTGGG - Intronic
943623112 2:190171276-190171298 ATTTTACTGAAGGTGAAGGAAGG + Intronic
944108110 2:196101360-196101382 CCTTTATTGTGGGAGAGGGAGGG + Intergenic
944527374 2:200633866-200633888 CTTTTACTGATGGAGAAGAAGGG + Intronic
944541983 2:200762823-200762845 ACTGTCCTGTAGGAGAAGGAAGG - Intergenic
945134068 2:206607101-206607123 CCTTGAATCCAGGAGAAAGAAGG - Intronic
945335507 2:208588331-208588353 TCTTTTCTGAGGGAGAAGGAGGG - Intronic
946891882 2:224285138-224285160 CATTTATTCCTGGAGAAGGAGGG - Intergenic
947454105 2:230237416-230237438 CATTTACTACAGAAGAAGGGAGG - Intronic
947989215 2:234473697-234473719 TCTTTACAGCAGCACAAGGATGG - Intergenic
949031654 2:241799970-241799992 CCTTCACACCAGGAAAAGGAAGG - Intronic
1168782933 20:510033-510055 CCCATACTGCAGGAGGTGGAGGG + Intronic
1170006828 20:11678459-11678481 CCTTGAGTGGAGGTGAAGGAGGG - Intergenic
1170447001 20:16438745-16438767 CATTTCCTGGAGGAGAATGAAGG - Intronic
1170656051 20:18288644-18288666 CCTTTTCTGCGCGAAAAGGAAGG + Intronic
1177265271 21:18775119-18775141 CCATTGCTCCAGGAGCAGGAGGG - Intergenic
1177989344 21:28019153-28019175 CTTGAACAGCAGGAGAAGGATGG - Intergenic
1178117519 21:29432617-29432639 TCTTTCCTGCAGAAGAAGGATGG + Intronic
1179553139 21:42156065-42156087 CCTTTTCTCCAGGGGAAGGCTGG - Intergenic
1180016170 21:45085999-45086021 CCCTTGCTGTAGGAAAAGGAAGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181573027 22:23778127-23778149 CCTGCACTGAAGGAGAGGGATGG - Intronic
1182320986 22:29478608-29478630 CTTTTACTTTAGGGGAAGGAAGG - Intergenic
1184225838 22:43128444-43128466 CCATTACTGCAGGAGCAGGTAGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949141515 3:639147-639169 CCTCCACTGCTGGAGAAAGATGG + Intergenic
949383394 3:3470555-3470577 GCTTTAGTGCAGGAAAAAGATGG - Intergenic
950818817 3:15736036-15736058 CCTTAACTGCAGTAGAGGCAAGG + Intronic
954808942 3:53236212-53236234 CTTTTCCTGCAGGAGCAGGAGGG - Intronic
954816015 3:53281301-53281323 CATTTACTGCAAGAAAGGGATGG - Intergenic
955794536 3:62621938-62621960 CCATTACTGCTGGAGAAGGCAGG - Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
956490516 3:69766745-69766767 ACCGTACTGCAGCAGAAGGAGGG - Intronic
959215708 3:103448030-103448052 CCTTTGCTCAAGCAGAAGGAAGG - Intergenic
960036502 3:113107725-113107747 TCCTTACTGTGGGAGAAGGAAGG - Intergenic
960778653 3:121292343-121292365 CCATTCTTGCAGGAGAAAGATGG - Intronic
961728014 3:128945516-128945538 CCAGGACAGCAGGAGAAGGAAGG - Exonic
963260442 3:143186697-143186719 CATCCACTGCAGCAGAAGGAAGG + Intergenic
965358647 3:167709820-167709842 CCTATCCTGAAGCAGAAGGAAGG - Intronic
965844463 3:172945981-172946003 CCCTTTCTGAAGCAGAAGGAAGG - Intronic
966989191 3:185211452-185211474 CCATTACAGCAGAAGAAGAAGGG - Intronic
967266119 3:187693769-187693791 GCTTAACTGCAGTAGCAGGATGG + Intergenic
967956470 3:194881194-194881216 CCTTTAATAAAGGAGAAGAAAGG - Intergenic
968017966 3:195356574-195356596 CCTCTTCTCAAGGAGAAGGACGG - Intronic
968049215 3:195642618-195642640 CCTTGACTCCAGGCTAAGGATGG - Intergenic
968098185 3:195947012-195947034 CCTTGACTCCAGGCTAAGGATGG + Intergenic
968106692 3:196006524-196006546 CCTTGACTCCAGGCTAAGGATGG + Intergenic
968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG + Exonic
969222940 4:5773199-5773221 CCTGGACAGCAGGAGATGGAGGG - Intronic
977937879 4:102827256-102827278 CCTCTCCTGCTGGAGGAGGAGGG - Intronic
978540097 4:109807207-109807229 CAATGACTGCAGGAGAAGGGTGG - Intergenic
979413415 4:120406531-120406553 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
979691755 4:123566450-123566472 CCATTCTTGCAGGAGTAGGATGG + Intergenic
980755439 4:137153265-137153287 CTTTTAATGCAAGAGAATGAAGG + Intergenic
981190877 4:141861092-141861114 TCATTGCTGCAGGAAAAGGATGG - Intergenic
983391793 4:167141157-167141179 CAATTACACCAGGAGAAGGATGG + Intronic
988001688 5:25358127-25358149 CCTCTTCTGAAGCAGAAGGAAGG - Intergenic
988536441 5:32073383-32073405 CCCTTTCTGCAGATGAAGGAAGG + Intronic
989384023 5:40836854-40836876 CCTTAAAAGTAGGAGAAGGATGG - Intergenic
991675166 5:69083575-69083597 CCTTTACAGCAGGAGGAGCCTGG + Intergenic
992457047 5:76925439-76925461 CCTCTACTCCAGGAGAAACAGGG + Intergenic
993298821 5:86181398-86181420 CCATTCTTGCAGGAGAAAGATGG - Intergenic
994142116 5:96353393-96353415 CCATCACAGCAGGATAAGGAAGG - Intergenic
994226111 5:97253570-97253592 CCTTTTCTCAAGCAGAAGGAAGG - Intergenic
994274764 5:97822408-97822430 CCTTTCCTTAAGCAGAAGGAAGG + Intergenic
994536898 5:101042627-101042649 CAGTTACTCCAGGGGAAGGAGGG + Intergenic
995411118 5:111858284-111858306 ACCTTACTGCAGGGGAGGGAGGG - Intronic
995770558 5:115664954-115664976 CCTCTACTCAAGCAGAAGGATGG - Intergenic
995956439 5:117782569-117782591 CCTTTGATACAGGAGAATGAAGG + Intergenic
995995335 5:118291659-118291681 CCTTTCCAGCAGGAAAGGGAAGG - Intergenic
996062849 5:119051070-119051092 CCTTTTCTTCAGGTGATGGAAGG + Intronic
996865588 5:128118018-128118040 CCATTCCTGCAGGAGTAAGATGG - Intronic
998227586 5:140338874-140338896 CCTTTACCCCAGGAGGTGGAGGG + Intronic
999128064 5:149261316-149261338 CCTTTACTGCAGCAGGATCATGG - Intergenic
999197804 5:149794644-149794666 CCTTTGAGGCAGGAGAAGGGTGG + Intronic
1000026284 5:157361873-157361895 GGTTTACTGCAGGAGAAAGGAGG + Intronic
1001040179 5:168328965-168328987 GCTTTACTGCAGGTGGATGAGGG - Intronic
1002719700 5:181250815-181250837 CCTTTGCTGTAGGAGTAGAAGGG + Intergenic
1003125267 6:3351032-3351054 CATTTCCTCCAGGAGAAGCAAGG + Intronic
1004400075 6:15280410-15280432 TTTTTAATGCAGGAGGAGGAAGG - Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1006569745 6:34992402-34992424 CCTCTGCTGCATGAGAAGAAAGG + Intronic
1007098147 6:39227195-39227217 CCAACACTGCAGGGGAAGGAAGG - Intronic
1007836531 6:44678293-44678315 CCTTCACTCCAGGAGAATGAAGG - Intergenic
1008157700 6:48037014-48037036 CATTTACTGCAAGTAAAGGATGG + Intronic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1008936670 6:56999644-56999666 GCTTAGCTGCAGGGGAAGGAGGG - Intronic
1009883150 6:69594661-69594683 CCCTTATTGCAGCTGAAGGATGG - Intergenic
1010458746 6:76088601-76088623 CCATTCTTGCAGGAGAAAGATGG + Intergenic
1013016249 6:106163258-106163280 CCGTTACTGCAGGAGTAGGTTGG - Intergenic
1013355101 6:109339567-109339589 CTGGTGCTGCAGGAGAAGGATGG + Intergenic
1015473313 6:133631410-133631432 TCTTTCCTGGTGGAGAAGGAGGG - Intergenic
1018154783 6:160975506-160975528 CCTTTCTGGGAGGAGAAGGAAGG - Intergenic
1018488185 6:164263668-164263690 CCTTTTTGGGAGGAGAAGGAAGG + Intergenic
1018619475 6:165715991-165716013 ACTTTAGTGCAGGAGCCGGAGGG - Intronic
1018894761 6:168006022-168006044 CCTTCAGTGCAGGAGGAAGAGGG + Intronic
1019830081 7:3319262-3319284 CCTTTTCCACAGGAGAGGGATGG + Intronic
1019888681 7:3927449-3927471 CCTTTACTACAGGAGAAAAGGGG - Intronic
1020763048 7:12291073-12291095 CCTTAAATGCAGGGGAGGGAAGG - Intergenic
1023579849 7:41670168-41670190 CCTTCACTGCATGAGATGTAAGG - Intergenic
1023740598 7:43277750-43277772 ACTTTACTGAGGGAGTAGGAAGG - Intronic
1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG + Intronic
1028163294 7:87509893-87509915 TCTTAACTGAAGAAGAAGGAGGG + Intronic
1028295516 7:89124990-89125012 CCTTTTCTTCAGGAGAGTGACGG - Intronic
1029000107 7:97144024-97144046 CCATTCCTGCAGGAGCAAGATGG + Intronic
1030394386 7:108967187-108967209 TCTTCACTGAAAGAGAAGGAAGG - Intergenic
1030656068 7:112169312-112169334 CCTTTACAGCAGTACAAGAATGG + Intronic
1031231674 7:119114888-119114910 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1031626812 7:124001509-124001531 CCTCTACTACAGGAGTATGAAGG - Intergenic
1031998240 7:128246865-128246887 CCTTGATTAAAGGAGAAGGAAGG + Intronic
1032418474 7:131757793-131757815 CCTTTACAGCAGCTGAAGAAGGG - Intergenic
1032835142 7:135665706-135665728 CTTTTACTGCAGTAAAAGAAAGG - Intronic
1034536294 7:151727926-151727948 GCATGACTGCAGGAGGAGGAAGG - Intronic
1034746446 7:153527825-153527847 GCTTGACTACAGGAAAAGGAAGG - Intergenic
1034904216 7:154929705-154929727 TCTTCACTGCTGGAGAAGGGAGG - Intronic
1035341492 7:158165421-158165443 CCTCTCTTGGAGGAGAAGGACGG - Intronic
1035346875 7:158206169-158206191 CCTCTCCTCAAGGAGAAGGAAGG - Intronic
1035620197 8:1030839-1030861 TCTTTCCTCCAGGAGAGGGAAGG - Intergenic
1036493843 8:9251747-9251769 CCTTCACTGGAGGAAGAGGAGGG + Intergenic
1036600579 8:10256875-10256897 CATTTGGGGCAGGAGAAGGAGGG - Intronic
1036916225 8:12806576-12806598 CCTGTGCTGCAGGAAAAGTACGG - Intergenic
1037353557 8:17992436-17992458 CCATTCTTGCAGGAGTAGGATGG + Intronic
1037819229 8:22127684-22127706 CCTTCACTGCACCAGAGGGATGG - Exonic
1038072418 8:24031723-24031745 CCTAAAATGCAGGAGAATGAGGG - Intergenic
1038521516 8:28236245-28236267 CCCTTCCAGCAGGAGAAGGGAGG - Intergenic
1039293106 8:36120538-36120560 CACTGACTGCAGGTGAAGGATGG + Intergenic
1039576226 8:38626077-38626099 CCTTTCCTGCAGGAGGAGCCTGG - Intergenic
1039741454 8:40386709-40386731 CCTTGACTGCACCTGAAGGAGGG + Intergenic
1043642103 8:82467134-82467156 CCATTATTGCAGGAGTAAGATGG + Intergenic
1044241415 8:89892850-89892872 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1044668341 8:94653731-94653753 CCTTTACAGCAGGGCAGGGAAGG - Intronic
1044840672 8:96334127-96334149 CCTTTTCTGCTCTAGAAGGAAGG - Exonic
1045288997 8:100815853-100815875 CCTTTACAGTAGGAGACTGAGGG + Intergenic
1046840595 8:118852136-118852158 CCCTAACTGCAAGAGAAGCAAGG - Intergenic
1048662270 8:136618337-136618359 GCTTGCCTGCCGGAGAAGGAGGG - Intergenic
1048857855 8:138699236-138699258 AAATCACTGCAGGAGAAGGAAGG - Intronic
1049429116 8:142551007-142551029 GCTTTATTGGAGGAGAGGGATGG + Intergenic
1050133208 9:2434353-2434375 CCATTCCTGCAGGAGTAAGATGG + Intergenic
1050238871 9:3613234-3613256 CCTTTCCTCAAGCAGAAGGAAGG + Intergenic
1051371094 9:16359857-16359879 CCAGGACTGCAGCAGAAGGAAGG + Intergenic
1055276388 9:74622155-74622177 CCTTCACTGAAGGACAGGGATGG - Intronic
1055656830 9:78459018-78459040 CCATTCTTGCAGGAGTAGGATGG - Intergenic
1057339864 9:94190615-94190637 CCGTTATTGCAGGAGTAGGGTGG + Intergenic
1059666191 9:116448425-116448447 CCCTCACTGCAGGAGATGGGAGG - Intronic
1060157736 9:121331674-121331696 CCTCTGTTCCAGGAGAAGGAAGG + Intronic
1061191513 9:129085285-129085307 CCTTAAATACAGGAAAAGGAAGG - Exonic
1061573944 9:131494689-131494711 CCTTCTCTGCAGGACAAGGAAGG - Intronic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1062119936 9:134829068-134829090 CATTTACTGCAGGCGAGGGGTGG - Intronic
1062228954 9:135470498-135470520 CCGCAACTTCAGGAGAAGGATGG - Intergenic
1187627357 X:21130854-21130876 CCTTTACTGAAGCAGAATCAGGG - Intergenic
1187641516 X:21295835-21295857 CTTTGACTGCAGCAGGAGGATGG - Intergenic
1188661379 X:32763030-32763052 CCATTAATGCAGGAGAAATAAGG - Intronic
1188943111 X:36264168-36264190 CCTTTCCTCAAGGGGAAGGAAGG + Intronic
1189190446 X:39097369-39097391 CCCTTATTCCAGGAGCAGGAAGG - Intergenic
1191770851 X:64756668-64756690 CCTCTACTCGAGCAGAAGGAAGG + Intergenic
1192045945 X:67674534-67674556 CCTTTGCTTGAGGACAAGGAAGG - Intronic
1193297181 X:79846924-79846946 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1194125973 X:90017268-90017290 CCTTTCCTGCAGGAGTAAGGTGG - Intergenic
1194340706 X:92701349-92701371 CCTCTCCTCAAGGAGAAGGAAGG + Intergenic
1194795815 X:98210342-98210364 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1196659303 X:118253110-118253132 CCAGTACTGCAGGAAAAGGGAGG + Intergenic
1196768937 X:119273785-119273807 CCTTTGCAGCAGGAGAGGGGCGG - Intergenic
1197096625 X:122604221-122604243 CCTTTACTCAAGTAGAAAGAAGG - Intergenic
1197581320 X:128287989-128288011 CCTCTCCTGAAGCAGAAGGAAGG - Intergenic
1200649061 Y:5818087-5818109 CCTCTCCTCAAGGAGAAGGAAGG + Intergenic
1201537433 Y:15066379-15066401 GCTTTGCAGCAGGAGAAAGAAGG + Intergenic