ID: 1092204144

View in Genome Browser
Species Human (GRCh38)
Location 12:6605640-6605662
Sequence ATGTAATAGCCTAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092204144 Original CRISPR ATGTAATAGCCTAGTGAAGA GGG (reversed) Intronic
901515970 1:9746336-9746358 GAGTAATAGCTTAGTCAAGAAGG - Intronic
904774757 1:32899993-32900015 CTGGAATAGCATTGTGAAGATGG + Intronic
907356170 1:53875876-53875898 ATTTAATAGCAGAGAGAAGAAGG - Intronic
911513307 1:98835222-98835244 ATGTTTAAGCTTAGTGAAGAAGG - Intergenic
911757381 1:101574784-101574806 ATATAGTAACCTAGTGGAGATGG - Intergenic
912158799 1:106955358-106955380 ATGAAATAGCCTAGTCCACAGGG + Intergenic
912182190 1:107232791-107232813 ATATAATAGTCTAGTCAAAATGG + Intronic
912318689 1:108690296-108690318 AGAAAATAGCATAGTGAAGAGGG + Intergenic
913558065 1:119989141-119989163 ATGCAATAGCTGAGTGAATATGG + Intronic
917768685 1:178251826-178251848 ATGAATTAGCCTTGTAAAGATGG + Intronic
918160551 1:181894905-181894927 ATGAAACAGCCTTGTGAAGATGG - Intergenic
918337381 1:183531706-183531728 AGGCAATATCCTACTGAAGAGGG - Intronic
919422094 1:197382382-197382404 ATGTGATAAACTAGTGATGAAGG + Intronic
1063896395 10:10686634-10686656 AAGCAAGAGCCAAGTGAAGAGGG - Intergenic
1063908476 10:10805122-10805144 TTGTAATAGCCCTGTGAAGTAGG + Intergenic
1064284873 10:13983561-13983583 ATATAATTCCCTAGAGAAGAAGG + Intronic
1066038143 10:31515218-31515240 ATGGAATAGACAGGTGAAGATGG - Intronic
1066296585 10:34059224-34059246 CTGGAACAGTCTAGTGAAGAGGG + Intergenic
1068401518 10:56534012-56534034 ATGTAATATGGTGGTGAAGAAGG + Intergenic
1071345787 10:84691117-84691139 GTGAAATAGCCAAGTGGAGATGG + Intergenic
1073850705 10:107614292-107614314 ATGTATTAGTCTAGAGGAGAGGG - Intergenic
1074898812 10:117799487-117799509 ATGCCTTAGCCTATTGAAGAAGG - Intergenic
1080342806 11:31286919-31286941 ATGTACTAGCCAAGTGGAGAAGG - Intronic
1081540141 11:44028797-44028819 ATGTCATAGGCTTGTGATGAGGG + Intergenic
1082130814 11:48487186-48487208 ATGTAAAAGCCCAGTAAATAAGG + Intergenic
1082564316 11:54658058-54658080 ATGTAAAAGCCCAGTAAATAAGG + Intergenic
1083470257 11:62879624-62879646 AAGTAATAGCATAGAGAAAAGGG - Intronic
1084337975 11:68472292-68472314 ATGTAACAGAGAAGTGAAGAAGG - Intronic
1086745511 11:90421972-90421994 ATTTAAAAACCTAGTGAAGATGG - Intergenic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087863994 11:103200770-103200792 TTGTAATATCCAACTGAAGAAGG - Intronic
1087973332 11:104513044-104513066 ATGTAATAACCAAGACAAGAAGG + Intergenic
1089066969 11:115669618-115669640 CTGTAATAGTCTAGGAAAGAGGG + Intergenic
1092204144 12:6605640-6605662 ATGTAATAGCCTAGTGAAGAGGG - Intronic
1093532162 12:20179216-20179238 TTGTAATAGCCATCTGAAGATGG - Intergenic
1095196650 12:39326965-39326987 CTGTAGTAGACTAGTGAAAAGGG + Intronic
1095421915 12:42032868-42032890 ATGTACTAGAATATTGAAGATGG - Intergenic
1096017146 12:48286921-48286943 TTGTAATAGCTTAGAGAAGAGGG - Intergenic
1097358029 12:58623983-58624005 ATGTAAAAGCTAAGTGAACAAGG - Intronic
1099405622 12:82258492-82258514 TTGTAATATCCTAGGGATGAGGG + Intronic
1101551728 12:105769224-105769246 TTGCAATAACTTAGTGAAGAAGG + Intergenic
1102417572 12:112777648-112777670 AGTTAATTGCCTAGTGAAGTTGG + Intronic
1104037983 12:125111519-125111541 ATGCAAGAGCCCAGTGAAGATGG - Intronic
1104621970 12:130321053-130321075 GTGTAATACCATAATGAAGAAGG - Intergenic
1106482573 13:30147944-30147966 ATGAAAATGCCTTGTGAAGATGG + Intergenic
1107130471 13:36888847-36888869 ATATAATAGCTTAGAGAGGAAGG + Intronic
1108374516 13:49801587-49801609 AAGTCATAGTCTGGTGAAGATGG + Intergenic
1108977709 13:56469450-56469472 ATGTAATGGGTTAGTGAATATGG + Intergenic
1109657838 13:65417624-65417646 ATGTAATATACTAGTGTATAGGG - Intergenic
1113020123 13:105875805-105875827 CTGTATGTGCCTAGTGAAGAAGG + Intergenic
1116902640 14:50376576-50376598 ATGTTATTGCTGAGTGAAGAAGG + Intronic
1118019681 14:61697185-61697207 ATTTAATATTCTATTGAAGAAGG - Intronic
1118364426 14:65082327-65082349 ATGGAAGACCCTAGTGAAGGTGG + Intronic
1126400183 15:48260493-48260515 ACACAATAGCCTAGTGAAGCAGG + Intronic
1127178640 15:56389970-56389992 ATTTAATAACTTACTGAAGATGG - Intronic
1129191576 15:73940881-73940903 ATGAAATAGCCTAGATAGGAAGG + Intronic
1130419703 15:83732645-83732667 ATGTAATCAACTAGTTAAGACGG - Intronic
1130639819 15:85661790-85661812 ACGTAACAGCCTAGTGAGTAGGG + Intronic
1131105642 15:89732368-89732390 AAGTGATAGCCAAGTGAGGAAGG - Intronic
1131906787 15:97151662-97151684 ATATAAAAGCCAATTGAAGAGGG + Intergenic
1132182202 15:99765077-99765099 ATTCACTAGCCTAATGAAGATGG - Intergenic
1140640103 16:76961533-76961555 ATATAATAGCCTAGTCAAGATGG - Intergenic
1145719056 17:27050827-27050849 ATGAAATAGCCTTCTTAAGAAGG + Intergenic
1146205347 17:30900316-30900338 ATGTAATAAAATAGTAAAGATGG - Intronic
1146539162 17:33679933-33679955 GTGTAATAGCCTGGTGAGGACGG + Intronic
1148977772 17:51544611-51544633 ATGGAACATCCAAGTGAAGATGG - Intergenic
1151927025 17:77205476-77205498 ATGTAATATGCCAGTGACGAGGG + Intronic
1154131607 18:11741524-11741546 ATTTAATAGTCTAGTTGAGAGGG - Intronic
1154177933 18:12099260-12099282 TTATAATAACCTAGTGAATAAGG + Intronic
1156633787 18:39002047-39002069 ATTTAATAGCCTATTAAACACGG - Intergenic
1158908544 18:62037479-62037501 ACGTAAAGGCCTAGTGAAGCTGG + Intergenic
1168190801 19:54737512-54737534 ATGAAATGGCATAGTGAAGCTGG - Intronic
926998942 2:18772043-18772065 ATGTAAGATCCTTGTGAACATGG - Intergenic
927079496 2:19613529-19613551 ATGTTACAGCCAGGTGAAGAAGG - Intergenic
928308778 2:30193175-30193197 AAGTCACAGCCCAGTGAAGAGGG - Intergenic
928638467 2:33272764-33272786 GTCTAATGGCCTAGTGAAGGTGG - Intronic
928657248 2:33465047-33465069 ATGATAAAGCCTAGTGAGGAAGG + Intronic
928893919 2:36239578-36239600 ATGTATTAGCAATGTGAAGATGG - Intergenic
928922217 2:36537859-36537881 TTGGACTAGCCTAGAGAAGATGG + Intronic
929265682 2:39916502-39916524 ATGTAAAAATCAAGTGAAGATGG - Intergenic
932092417 2:68818121-68818143 ATGCAATAGCCTTGTGAGGTAGG + Intronic
933611146 2:84436796-84436818 AAATTATAGTCTAGTGAAGAAGG - Intronic
934476564 2:94597466-94597488 ATGCAATAGCCCTGTGAAGTAGG + Intronic
937590420 2:123606823-123606845 ATGTAATACCCCAGAGATGAGGG - Intergenic
939944122 2:148388010-148388032 ATGGAATAGCCAAGAGACGAGGG + Intronic
941347743 2:164391010-164391032 CTGTTAAAGACTAGTGAAGATGG + Intergenic
942670566 2:178371096-178371118 ATGTCAGTGCCTAGTAAAGAGGG - Intronic
943175675 2:184470385-184470407 TTGTAATAGCCAAGAAAAGAAGG + Intergenic
944810930 2:203327499-203327521 ATGTAACAGCCCTGTGAAGAAGG + Intergenic
948029559 2:234805914-234805936 ATGACAAAGCCTATTGAAGAGGG + Intergenic
1171362905 20:24602505-24602527 ATTTCAGAGCCCAGTGAAGAGGG - Intronic
1172824696 20:37771413-37771435 GGGTAATAGCATAGTGAAAATGG - Intronic
1173662644 20:44745241-44745263 AAGTGATATCCTAGTGAGGAGGG - Intergenic
1176804416 21:13465346-13465368 ATGAAATAGCCTTCTTAAGAAGG + Intergenic
1178862503 21:36300907-36300929 ATGGACAAGCCTAGTGAAGACGG - Intergenic
1181543600 22:23587812-23587834 AGGTCAAAGCCTAGTGGAGAAGG - Intergenic
1182432556 22:30308836-30308858 CTCTAATAGCCCAGTGAAGTGGG + Intronic
949688839 3:6610783-6610805 ATGTATTACCCTGATGAAGATGG - Intergenic
951111007 3:18804262-18804284 ATGTAAAAGCCTAATGACAAAGG - Intergenic
952144299 3:30514934-30514956 AGGTATTAGCCTTGTGAAGATGG - Intergenic
953774787 3:45807190-45807212 TTGGAATAGCTCAGTGAAGAAGG - Intergenic
954975154 3:54686737-54686759 ATGTCATAGCTCTGTGAAGATGG + Intronic
959302295 3:104618737-104618759 CTGTAACAGCCCAGTAAAGAAGG - Intergenic
960043746 3:113176137-113176159 ATGAAATATTCAAGTGAAGATGG + Intergenic
963195240 3:142520369-142520391 ATGACTAAGCCTAGTGAAGAAGG + Intronic
964178118 3:153850541-153850563 ATGTAAGAGCCAAATGAAAAAGG - Intergenic
965005406 3:163016449-163016471 ATGATTTAGCTTAGTGAAGAGGG + Intergenic
965568307 3:170145060-170145082 ATGTAATAACTAAGTCAAGATGG - Intronic
967614651 3:191550231-191550253 TTTTAATAGTCTAGTGAAGTTGG - Intergenic
967711497 3:192713193-192713215 ATGTAACAGCCTTGGAAAGATGG + Intronic
970438526 4:16059139-16059161 ATGTAATAGCCTAGTCTAAGAGG + Intronic
973241026 4:47955787-47955809 AGGTTGTAGCCTTGTGAAGATGG - Intronic
974672321 4:65048285-65048307 AAGTGATAGTCTAGTGAAAAAGG - Intergenic
975056287 4:69934921-69934943 ATTTACTGGCCTGGTGAAGAAGG + Intronic
977507636 4:97922750-97922772 ATGTAGAAGCCTATTGAAAAGGG - Intronic
978303004 4:107292381-107292403 ATGTAATAGCATGGTGGTGAAGG + Intergenic
980494535 4:133574663-133574685 ATGTCATAGCCCTGGGAAGAAGG + Intergenic
987001659 5:13666325-13666347 AGGTCATTGCCTAGTGAATAGGG - Intergenic
990020223 5:51117371-51117393 ATTTAATAGCACAGGGAAGATGG - Intergenic
991654001 5:68884699-68884721 ATGAAACATCCTAATGAAGAAGG + Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
994625939 5:102219099-102219121 ATGTTTGAGCTTAGTGAAGAAGG - Intergenic
995007052 5:107211924-107211946 AAGCAAAAGCCTAGTGAAGCAGG - Intergenic
996991146 5:129633920-129633942 ATCTTATAGACTCGTGAAGACGG - Intronic
998024954 5:138808156-138808178 ATTAAATAGCCTTGTGAACAAGG - Intronic
999185607 5:149706065-149706087 ATGTAAAATCTTGGTGAAGAAGG + Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1008740544 6:54602362-54602384 ATTTAATAGCCTCGTGAAGCTGG - Intergenic
1009452750 6:63820516-63820538 TTGGAATAGCCTAGAGATGAAGG - Intronic
1009737756 6:67700271-67700293 ATGTAGCTGACTAGTGAAGAAGG - Intergenic
1010213769 6:73383810-73383832 ATGTAAGAGCCTGGTGCAGTGGG + Intronic
1012459476 6:99444570-99444592 GTGTAAGAGCCCAGTGAAGGAGG - Intronic
1012970657 6:105726829-105726851 AGGTAATAACCTAGTGTAAAGGG + Intergenic
1013480126 6:110545744-110545766 ATGTGATAGCTAAGTGAAGGAGG - Intergenic
1013764353 6:113557410-113557432 ATTTAATGGACTAGTGAATATGG - Intergenic
1014243624 6:119043661-119043683 ATGTGATAACCTAGTGAGGCTGG + Intronic
1015936619 6:138411326-138411348 ATATAATAGACTGGTGAGGAAGG - Intronic
1015973630 6:138767848-138767870 AAGTTATAGCCTAGTGATGAAGG + Intronic
1019208458 6:170383673-170383695 ATGTAAGAGGCTAGTGTATAAGG - Intronic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1022899747 7:34794428-34794450 ATTTTATAACCTAGTTAAGATGG + Intronic
1026585921 7:71656173-71656195 AGGTAACAGCCTAGTAAAGAAGG + Intronic
1027753074 7:82176398-82176420 TTGTTATATCCTAGTGAACAAGG + Intronic
1030975989 7:116123771-116123793 ATGTAAGAACTTAGAGAAGAAGG - Intronic
1033151749 7:138920629-138920651 ATGACATAGCCTAGAGAAAAAGG + Intronic
1033481033 7:141740826-141740848 TTGCAATAGCCTTGTGAAGTAGG + Intronic
1037144085 8:15552528-15552550 AGGAAATAACCCAGTGAAGAGGG + Intronic
1038592310 8:28851060-28851082 AAGTAAAAGCTTAATGAAGAAGG + Intronic
1040420259 8:47232800-47232822 ATTTGATAACCTAGTGAAAATGG + Intergenic
1044921512 8:97174374-97174396 ATGAAATAGCCTAGGGAGGCAGG - Intergenic
1046298152 8:112248888-112248910 ATGTAACAGCCTAGAGAAAATGG - Intronic
1046318867 8:112544412-112544434 ATTTTATAGGCTAGTGAAGAGGG - Intronic
1046799894 8:118414596-118414618 TTGTAATAGACTTGTGATGAAGG + Intronic
1052034789 9:23668287-23668309 ATGTAATAGTCTCATGAAAATGG - Intergenic
1052251902 9:26408486-26408508 CTGTAGTAGCCTGGTGAAGTGGG - Intergenic
1059052711 9:110944265-110944287 GTTTCATAGCCTAGTGTAGAGGG - Intronic
1188532831 X:31161658-31161680 ATGTCTTAGGCAAGTGAAGAAGG - Intronic
1188957598 X:36452024-36452046 ATGTAATAACCTAATAAAAATGG + Intergenic
1190438531 X:50452422-50452444 AGGTAGAAGCCTAGTGAAGAAGG - Intronic
1190444358 X:50508339-50508361 TTGTAATAGCCTAGCCAAGGTGG - Intergenic
1194036118 X:88874533-88874555 AAGGAATACCCTAGAGAAGATGG - Intergenic
1200383436 X:155864781-155864803 ATGTAATTTCCCAGTGAAAAAGG + Intergenic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic
1202585004 Y:26413945-26413967 ATGTAATTTTCTTGTGAAGAAGG - Intergenic