ID: 1092204695

View in Genome Browser
Species Human (GRCh38)
Location 12:6607586-6607608
Sequence GCGCGCGCGCCCGCTGCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092204695_1092204706 25 Left 1092204695 12:6607586-6607608 CCCTTCGCAGCGGGCGCGCGCGC 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1092204706 12:6607634-6607656 TGGCCATCCCATAATACACACGG 0: 1
1: 0
2: 0
3: 6
4: 120
1092204695_1092204700 5 Left 1092204695 12:6607586-6607608 CCCTTCGCAGCGGGCGCGCGCGC 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1092204700 12:6607614-6607636 CTGGGCAACCGCCCACCTCCTGG 0: 1
1: 0
2: 3
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092204695 Original CRISPR GCGCGCGCGCCCGCTGCGAA GGG (reversed) Intergenic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
906556623 1:46719116-46719138 GCGCAGGCGGCCGCTGCCAAAGG - Intergenic
908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG + Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
1065216799 10:23457012-23457034 GCGCGCGCGCGCACAGAGAATGG + Intergenic
1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG + Intronic
1071529279 10:86376915-86376937 GCGCGCGCGGCCTCTGGGGAGGG - Intergenic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1087297044 11:96389776-96389798 GCTCGCGCTCCCGGTGCTAATGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1097019148 12:56007699-56007721 GCGCGCGCGCAGGCTGTGAGGGG - Exonic
1100540000 12:95548734-95548756 GGGCGCGCGGCCGCGGCGATTGG - Intronic
1103562689 12:121800537-121800559 GCGCGGGCGCCCGCAGCCGAGGG - Intronic
1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG + Exonic
1113724520 13:112588182-112588204 GCACGCGCGGCCGCGGCGCAGGG - Intergenic
1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG + Intronic
1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG + Intergenic
1132483972 16:180831-180853 GCACGCGTGCCAGCTGCGAGTGG + Exonic
1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG + Intronic
1134131027 16:11650369-11650391 GCGCGCGCGCGCGCTGTCCATGG - Intergenic
1137268084 16:46884831-46884853 GCGCTCGCGCCGGCTGCGCTCGG - Exonic
1137855751 16:51792927-51792949 GCGCGCGCGCGCCCTAGGAAGGG - Intergenic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1142742050 17:1937015-1937037 GCGCGCGCTCCCTGTGGGAATGG - Exonic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1149936691 17:60814307-60814329 GCGCGCGTGCCCATTGCAAATGG + Intronic
1156171559 18:34493247-34493269 GCGTGCGCGCCCGCGGAGAGAGG + Intergenic
1162393649 19:10404142-10404164 GCGCGAGTCCTCGCTGCGAATGG - Intronic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
1167157092 19:47745496-47745518 CTGCGCGCGCACGCTGCAAAGGG + Intergenic
925730706 2:6917886-6917908 GCGCGGGCGCCGCCTGCGAGAGG - Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
931614570 2:64143773-64143795 CCGCGCGCTCCGGCTGCGAGAGG - Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG + Intronic
947669372 2:231926623-231926645 GGGCGCGCGCTCGCTGCAAATGG - Intergenic
947693901 2:232166342-232166364 GTGCGCGCGCGCCCTGTGAAAGG + Intronic
1176178521 20:63739484-63739506 GCGAGCGCGCCCGTGGGGAACGG + Intronic
1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176569036 21:8400268-8400290 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176576950 21:8444503-8444525 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1180796832 22:18610000-18610022 GCGCGCTCGCCTGCTCCGACAGG + Exonic
1181224892 22:21385271-21385293 GCGCGCTCGCCTGCTCCGACAGG - Exonic
1181253740 22:21549542-21549564 GCGCGCTCGCCTGCTCCGACAGG + Exonic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG + Intergenic
1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
954199865 3:49017857-49017879 GCGCACGCACACCCTGCGAAGGG + Exonic
960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG + Intronic
968775483 4:2537117-2537139 GCGCTCGCGCCCGCGCCGAGAGG - Intronic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
980130035 4:128809865-128809887 GCGCGCGTACCTGCTGCGGAGGG - Exonic
985537939 5:475016-475038 GCGTGCGGGCCCTCTGCGAGGGG + Exonic
987082808 5:14440993-14441015 GCGCGCGCGCGCGCTGCAGTTGG - Intronic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1002559738 5:180072910-180072932 GCGCGCGCGCGCGTTTCGGAAGG - Intergenic
1007673525 6:43576155-43576177 GACAGCGCGCCCGCTGCGAAGGG - Exonic
1011666354 6:89638547-89638569 GCGTGCGCGCCCTCTGAGATTGG - Intronic
1034129283 7:148699817-148699839 GCGCGCGCTCCCGTTGGGACCGG - Intronic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1203471401 Un_GL000220v1:116705-116727 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic