ID: 1092204706

View in Genome Browser
Species Human (GRCh38)
Location 12:6607634-6607656
Sequence TGGCCATCCCATAATACACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092204694_1092204706 26 Left 1092204694 12:6607585-6607607 CCCCTTCGCAGCGGGCGCGCGCG 0: 1
1: 0
2: 2
3: 5
4: 47
Right 1092204706 12:6607634-6607656 TGGCCATCCCATAATACACACGG 0: 1
1: 0
2: 0
3: 6
4: 120
1092204696_1092204706 24 Left 1092204696 12:6607587-6607609 CCTTCGCAGCGGGCGCGCGCGCG 0: 1
1: 1
2: 0
3: 15
4: 116
Right 1092204706 12:6607634-6607656 TGGCCATCCCATAATACACACGG 0: 1
1: 0
2: 0
3: 6
4: 120
1092204699_1092204706 -2 Left 1092204699 12:6607613-6607635 CCTGGGCAACCGCCCACCTCCTG 0: 1
1: 0
2: 1
3: 26
4: 281
Right 1092204706 12:6607634-6607656 TGGCCATCCCATAATACACACGG 0: 1
1: 0
2: 0
3: 6
4: 120
1092204693_1092204706 27 Left 1092204693 12:6607584-6607606 CCCCCTTCGCAGCGGGCGCGCGC 0: 1
1: 0
2: 2
3: 3
4: 57
Right 1092204706 12:6607634-6607656 TGGCCATCCCATAATACACACGG 0: 1
1: 0
2: 0
3: 6
4: 120
1092204695_1092204706 25 Left 1092204695 12:6607586-6607608 CCCTTCGCAGCGGGCGCGCGCGC 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1092204706 12:6607634-6607656 TGGCCATCCCATAATACACACGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092204706 Original CRISPR TGGCCATCCCATAATACACA CGG Intergenic
901216986 1:7560484-7560506 TGGCCATCCCATCTTCTACATGG - Intronic
901679965 1:10907311-10907333 TGGCTACCCCAACATACACACGG + Intergenic
902714648 1:18264176-18264198 GGGCCATCCCCTCATACAGAAGG - Intronic
904456480 1:30651287-30651309 TGAGCATCCCATAGCACACAGGG - Intergenic
905193411 1:36254877-36254899 TTGCCATCCCATATTACAGAAGG + Intronic
911555207 1:99335938-99335960 TGGGCATCCCAAAATGAACAAGG - Intergenic
915232982 1:154459497-154459519 TGGCCATCCCATGGTAACCATGG - Intronic
915795035 1:158721163-158721185 AGGCCATTTCATAATAAACATGG + Intergenic
916460566 1:165020106-165020128 AGGCCATCACATAATACTAAAGG - Intergenic
1066195507 10:33095244-33095266 AGGCAATTCCATAATATACAGGG + Intergenic
1067580702 10:47443772-47443794 TGGCCATCCCCTAACCCATAAGG - Intergenic
1068550726 10:58404936-58404958 TTGCCATACAATAATACTCATGG + Intergenic
1068787394 10:60991167-60991189 TTGCCAACCCATATTCCACACGG + Intronic
1068973404 10:62982579-62982601 TAGCCATACCATAACACACTGGG + Intergenic
1069063615 10:63919839-63919861 TGGCCATCGCAGAACACAAAGGG - Intergenic
1071409672 10:85376675-85376697 TGGCCATGACCTAAAACACAAGG + Intergenic
1072415212 10:95241546-95241568 TGAACATCCCAAAATACACAGGG + Intronic
1073920225 10:108449989-108450011 TGGCCATCCCATAATATCTGGGG + Intergenic
1076293000 10:129361891-129361913 AGGCCAGCCAATAAAACACAGGG + Intergenic
1078914863 11:15769702-15769724 ATGCCATCCCATGCTACACAGGG - Intergenic
1079502489 11:21117015-21117037 TGGCCATGTCATAATGGACAAGG - Intronic
1079522091 11:21340097-21340119 TAGCCAGCTCATCATACACAAGG + Intronic
1079851851 11:25544874-25544896 TTCCCATCCCACAATTCACAAGG - Intergenic
1083758795 11:64804887-64804909 TGGCCATCCCATCCCACCCAGGG + Intronic
1083774224 11:64885528-64885550 TGACCATCCTACAACACACAGGG + Intronic
1085839293 11:79992680-79992702 TGGCCATGGCATAAGACACTGGG - Intergenic
1089896694 11:121937136-121937158 GGGCCAGCCCAAAATACACCGGG - Intergenic
1090745697 11:129703157-129703179 TGGCAATCTCATCAAACACAGGG + Intergenic
1092075741 12:5671904-5671926 TGGCCAAACCAGAATACACCAGG + Intronic
1092204706 12:6607634-6607656 TGGCCATCCCATAATACACACGG + Intergenic
1092800362 12:12158985-12159007 TGTCCATCACATAATCCAAATGG + Exonic
1095326422 12:40899420-40899442 TTGCCATATCATAATAAACAAGG - Intronic
1097134069 12:56836821-56836843 AGGCCATTTCAGAATACACATGG + Intergenic
1099556734 12:84118242-84118264 TGGCCAGCCCAAAATAGATATGG - Intergenic
1106460429 13:29963270-29963292 TGGCTGTCCCATTAGACACAGGG - Intergenic
1110856283 13:80300457-80300479 TGGCTATCTGAAAATACACAAGG - Intergenic
1118712016 14:68527392-68527414 TGGCCAGCCCAGAAAACAGAAGG - Intronic
1118728986 14:68653530-68653552 TAGACATCCTACAATACACAGGG - Intronic
1120224271 14:81773086-81773108 TATCCTTCACATAATACACAAGG - Intergenic
1123586431 15:21764601-21764623 TGGCCAAACCAGAATACACCAGG - Intergenic
1123623070 15:22207181-22207203 TGGCCAAACCAGAATACACCAGG - Intergenic
1124345323 15:28918296-28918318 TGGCCATTCCAAAATAAAGAAGG - Intronic
1125875917 15:43144463-43144485 TGGCAATCCCACAATAAAAAAGG + Intronic
1126798312 15:52278334-52278356 AGGCCATCCCAGATGACACATGG + Intronic
1126926025 15:53587300-53587322 TGGCCATTCCTTAATATACAAGG - Intronic
1127356450 15:58205328-58205350 TGGCCCTCCCATATTTTACACGG - Intronic
1128831917 15:70777277-70777299 TAGACATCTCATAATAAACATGG - Intergenic
1131343291 15:91623012-91623034 TAAACATCCTATAATACACAAGG - Intergenic
1134229828 16:12420086-12420108 TCAACATCCCATAATGCACAGGG - Intronic
1136096572 16:27961359-27961381 TGTGCATCCCATAATTCCCAAGG - Intronic
1140771802 16:78212346-78212368 TGGCCATCCCCAAATTCAAAAGG + Intronic
1140881745 16:79204723-79204745 TGGCCTTCCCAGAACAAACATGG + Intronic
1143165135 17:4893756-4893778 AGGCCACCCCACAACACACAGGG - Intronic
1149888213 17:60362009-60362031 TGGCTTTACCACAATACACATGG + Intronic
1150510469 17:65747267-65747289 GGGCCAACCCAGAATGCACAAGG - Intronic
1153238381 18:3010075-3010097 TGGCCATTCCCCACTACACATGG + Intronic
1168716864 19:58533996-58534018 TTGCCTACCCATAAAACACATGG - Intronic
928392764 2:30921881-30921903 TAGACTTCCCACAATACACAGGG + Intronic
930016865 2:46976686-46976708 TGAACATCCTATAATATACACGG - Intronic
937405678 2:121626163-121626185 TGGCCATCCCAAATTTCCCAAGG + Intronic
939683035 2:145162234-145162256 GGTCCCTCCCATGATACACAGGG + Intergenic
943503590 2:188724068-188724090 TGACCATCCAATCATACACCTGG - Intergenic
1170358047 20:15513736-15513758 TGGCCTACCCATAATACCCCAGG + Intronic
1172716724 20:36969790-36969812 AGGCCATTTCAGAATACACACGG + Intergenic
1172815456 20:37682643-37682665 TGGCCATCCCAGGAAACACTTGG + Intergenic
1173037222 20:39423932-39423954 TCACCATCCCATTATACATATGG - Intergenic
1173124329 20:40322655-40322677 AGGCCATCGCATAAGACACATGG + Intergenic
1173325785 20:42032278-42032300 TGGTCATCCCAAAACATACATGG + Intergenic
1174222154 20:48964479-48964501 TGGACATCCCCTAATCTACAAGG - Intronic
1174281319 20:49441567-49441589 TGAACATCCCAGAATGCACAAGG - Intronic
1178871008 21:36375677-36375699 GGGCTATGCCATAATACAAATGG + Exonic
1179597456 21:42452382-42452404 TGGACATCCCACAATGCACAGGG - Intergenic
1180711913 22:17844991-17845013 CGGCCACCCCATAATGAACAGGG + Intronic
1181402113 22:22656240-22656262 AGGCCCTCCCATAGAACACAGGG + Intergenic
950828119 3:15846936-15846958 TGGCCATCCCCAAACACAAAAGG + Intronic
951605943 3:24435183-24435205 TGGCCATGCCATGAAAAACAAGG + Intronic
951650387 3:24945335-24945357 TGGCCATCACATGATCCTCAGGG + Intergenic
955398967 3:58577684-58577706 TGACCCTCCCATAAGAAACAAGG - Intronic
957964103 3:87299789-87299811 TGGATATCCCATGAGACACAGGG + Intergenic
958960630 3:100506162-100506184 TGGGAAACCCATAATCCACAGGG + Intronic
962183213 3:133230452-133230474 TGGCAGTCCCATAGAACACATGG - Intronic
963910491 3:150813366-150813388 TCTCCATCCCAAAATAAACATGG - Intergenic
965829842 3:172773366-172773388 TGGCAAGGCCATAAGACACAAGG - Intronic
968644941 4:1735676-1735698 CTGCCATCCCCTAACACACACGG - Intronic
974224187 4:59018018-59018040 TGGCCTTCCCTTAATAGCCAAGG + Intergenic
975844215 4:78507849-78507871 TAAACATCCCATAATGCACAGGG + Intronic
978342617 4:107734410-107734432 TCTCCCTCCCATAATAGACAAGG + Intergenic
978759989 4:112346559-112346581 TGGCCATCATATAAAACAGATGG + Intronic
980619917 4:135287582-135287604 TGGACATCTCATAAGCCACAGGG + Intergenic
982721390 4:158863575-158863597 TGGCGATCACATTGTACACAGGG - Intronic
983259968 4:165444792-165444814 CGGCCATCCTGTAATTCACACGG - Intronic
988297643 5:29387051-29387073 GGGGCATTCCAGAATACACATGG - Intergenic
989025898 5:37067840-37067862 TGTTCATACCAAAATACACATGG + Intergenic
989558831 5:42827984-42828006 TGGACTACCCATGATACACATGG - Intronic
991100507 5:62787163-62787185 TGGTCATCCCATAATAACAATGG - Intergenic
991271459 5:64787138-64787160 GGTCCCTCCCATAAAACACATGG + Intronic
991419964 5:66430629-66430651 TGGGTATACAATAATACACAAGG - Intergenic
994501913 5:100589735-100589757 TGGCCATCCCATCATTTTCAAGG + Intergenic
1004098269 6:12581095-12581117 TGGAGATCCCATACAACACATGG + Intergenic
1005008801 6:21315877-21315899 TCTTCATTCCATAATACACATGG - Intergenic
1008415781 6:51238605-51238627 TGGGCATCCTATAAAACCCAAGG + Intergenic
1018841890 6:167523438-167523460 TGGCCATCCCATTGCACACCTGG + Intergenic
1019532549 7:1511018-1511040 TGGCCTTCCCGTTACACACAGGG + Intergenic
1024966807 7:55030435-55030457 TGCCCATTCCATAAGATACAGGG + Intronic
1027441339 7:78222221-78222243 TTGCTATCCCATAAAACACGTGG - Intronic
1028631289 7:92936894-92936916 TGGCCATCCCTTATTAAATAAGG - Intergenic
1031668469 7:124514866-124514888 TGACCATCCCATCATATTCATGG + Intergenic
1033434223 7:141318119-141318141 TGGTCATCCAATAATACCCCAGG - Intronic
1033570548 7:142624383-142624405 TGGCAAACCCATAACACAAATGG + Intergenic
1034404309 7:150892068-150892090 GGGCCATCCCATAATATTTAAGG + Intergenic
1035530878 8:349981-350003 AGGCCATCCCTAAATCCACATGG - Intergenic
1036014793 8:4770847-4770869 TGAAAATCCCAGAATACACAGGG + Intronic
1037992470 8:23330765-23330787 TGGCCATCAAATCATACACAGGG + Intronic
1039370407 8:36978620-36978642 TGGCCAACCTATCCTACACAAGG - Intergenic
1040441871 8:47451757-47451779 TGGTACTCCTATAATACACAGGG - Intronic
1040920433 8:52610784-52610806 TGTCCATCTCAGAATACACCTGG + Intergenic
1042092620 8:65175303-65175325 TCTCCATTCCATAAGACACAGGG - Intergenic
1050052001 9:1612271-1612293 TGGACATTACACAATACACAAGG - Intergenic
1051069651 9:13149627-13149649 TGGGCATCCCACAGTAAACAAGG - Intronic
1052882863 9:33615497-33615519 TGGCAAACCCATAACACAAATGG + Intergenic
1056622748 9:88227711-88227733 TGGCAAACCCAAAATCCACAGGG - Intergenic
1058833578 9:108840813-108840835 AGGCAATCCCATAAAACCCAGGG - Intergenic
1060640454 9:125233751-125233773 TGGCCATGGAATGATACACATGG - Exonic
1186036395 X:5428421-5428443 TGGACCAGCCATAATACACAAGG + Intergenic
1189933639 X:46041372-46041394 TGACCTAACCATAATACACATGG - Intergenic
1198768421 X:140102461-140102483 TGTCTATGCCCTAATACACATGG - Intergenic
1199055552 X:143289674-143289696 TGGCCAGCCCAAAATGGACATGG - Intergenic