ID: 1092206563

View in Genome Browser
Species Human (GRCh38)
Location 12:6618152-6618174
Sequence ACAGCTCCTTCAGTAATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092206563 Original CRISPR ACAGCTCCTTCAGTAATGCC AGG Intergenic
901659060 1:10787426-10787448 ACAGCTCCTTCGGGAATTTCGGG - Intronic
903649281 1:24913252-24913274 ACAGCTCCTCCAGCATGGCCTGG + Intronic
904174042 1:28613188-28613210 ACTGCTTCTTCAGGACTGCCAGG - Intronic
906666757 1:47627502-47627524 ACAGCACCATCAGCAAGGCCTGG + Intergenic
910446917 1:87308114-87308136 ACAGCTCAAGCATTAATGCCGGG + Intergenic
911511652 1:98814459-98814481 ACAGCTTCTTCAGTACTGGAAGG + Intergenic
913331272 1:117670052-117670074 GCAGCTCTTTCTGTAATGCCTGG - Intergenic
917155088 1:171988460-171988482 ACAGCTGATTCAGTAAACCCAGG + Intronic
917451576 1:175151720-175151742 TCAGCTCCTTCAGCATTTCCTGG - Intergenic
917536275 1:175876852-175876874 ACATCTCCCTCAGGAATCCCTGG + Intergenic
917971623 1:180211620-180211642 ACAGATCCTACAGTCCTGCCTGG - Intergenic
918676131 1:187288311-187288333 CCAGCACCTAGAGTAATGCCAGG - Intergenic
922129208 1:222760037-222760059 ACAGGTCCATCAGTAAAGCCCGG - Intergenic
1062865133 10:846212-846234 ACAGAGCCTGCAGTAGTGCCTGG - Intronic
1068435863 10:56990327-56990349 GCAGCTCCTTCAGTGATGGCAGG + Intergenic
1071773276 10:88754314-88754336 ACAGCCCCTTTATTTATGCCAGG - Intergenic
1072699399 10:97629598-97629620 AAGGCTCCTTCACTGATGCCTGG - Intronic
1075679004 10:124319064-124319086 ACAGCTCCTGCTGAGATGCCAGG + Intergenic
1078445793 11:11404030-11404052 ACAGCTCCCTCAGAAGAGCCAGG - Intronic
1080614017 11:33930439-33930461 ACAGCTCCTTCAGTGGGGGCTGG - Intergenic
1087006875 11:93479835-93479857 TCAGCTCCTTGAGTAATGCTTGG - Intronic
1089173375 11:116531642-116531664 ACAGCAGCATCAGTATTGCCGGG - Intergenic
1090736280 11:129614469-129614491 AGAGCCCCTTCAGTAAGACCTGG + Intergenic
1092183804 12:6464014-6464036 GCAGCTCACTCAGTACTGCCTGG - Exonic
1092206563 12:6618152-6618174 ACAGCTCCTTCAGTAATGCCAGG + Intergenic
1100599592 12:96101731-96101753 ACAGCTCTTAAAGTAATGCCTGG - Intergenic
1105896736 13:24722924-24722946 ACAGCAGCTTAACTAATGCCTGG + Intergenic
1106356708 13:28990194-28990216 ACAGCTCCTTCCGAAGTCCCAGG - Intronic
1106423896 13:29607361-29607383 AAAGCTCCTTAAGAAGTGCCTGG + Intergenic
1106530007 13:30581933-30581955 ACACTTCCTTCAGTAAGTCCTGG - Intronic
1112251099 13:97781341-97781363 ACAGCTCCTCCAGAAATGTCAGG - Intergenic
1115846235 14:37538879-37538901 ACAGCTACTTGAGTGATTCCAGG + Intronic
1116140547 14:40988183-40988205 TCAGCTCCTTCTGTATGGCCTGG + Intergenic
1118619461 14:67601203-67601225 AGAGCTCCTTCAGTCCTGTCTGG - Intergenic
1119257050 14:73207922-73207944 AAAGCTGCTTAGGTAATGCCTGG - Intronic
1124019054 15:25903232-25903254 ACAGCCCCCTCAGTAACTCCAGG - Intergenic
1127288039 15:57547515-57547537 GCAGCTCCTGCAGGAATGACAGG - Exonic
1130484256 15:84389759-84389781 TTAGCTCCTTCTGGAATGCCAGG - Intergenic
1130797349 15:87224040-87224062 TCAGCTCTTTAAGCAATGCCTGG - Intergenic
1131663678 15:94546326-94546348 AAGGCTCCTTCATTTATGCCTGG - Intergenic
1136154950 16:28376281-28376303 ACTGTTCCTCCAGTTATGCCTGG - Intergenic
1136208141 16:28738977-28738999 ACTGTTCCTCCAGTTATGCCTGG + Intergenic
1137338934 16:47579426-47579448 GCAGCACCTTCAGTATTACCTGG - Intronic
1137614866 16:49840020-49840042 ACAGCACCTTGAATACTGCCTGG + Intronic
1142803449 17:2359386-2359408 AGAGCTGAGTCAGTAATGCCTGG + Intronic
1144501202 17:15787496-15787518 ACAACTGGTTCATTAATGCCCGG + Intergenic
1144663726 17:17088146-17088168 ACAGCTCTTTCAGTGATGGAAGG + Intronic
1144822934 17:18088155-18088177 ACAACTCCAGCAGTAATGCTGGG + Intronic
1145163370 17:20590170-20590192 ACAACTGGTTCATTAATGCCCGG + Intergenic
1145889427 17:28404709-28404731 GAAGCTCCTGCAGTACTGCCTGG - Exonic
1147793682 17:43028138-43028160 ACAGCTCCCTCAGTGTGGCCAGG - Exonic
1148428586 17:47622793-47622815 ATAACTCCTTCAGAAAGGCCTGG - Exonic
1149470044 17:56909064-56909086 ACAGCTGCTTCGGTAATGGCAGG + Intronic
1150214967 17:63462281-63462303 ACAGTGCCTTCAGTGATTCCCGG - Intergenic
1150383161 17:64736622-64736644 ACAGCTCCTTCAGAGAAACCAGG - Intergenic
1150773077 17:68058151-68058173 ACAGCTCCTTCAGAGAAACCAGG + Intergenic
1155441910 18:25870840-25870862 ACAGCTCCTTCAGATATGCAAGG - Intergenic
1155905997 18:31452094-31452116 GTTGCTCCTTGAGTAATGCCAGG - Intronic
1156900263 18:42292598-42292620 ACATTTCCATCAGTAATGCACGG - Intergenic
1157834089 18:50883165-50883187 AGAGATCATTCAGGAATGCCTGG + Intronic
1164531787 19:29054029-29054051 ACTGCTCCTTCAGTCCTGCGAGG + Intergenic
1164594401 19:29524495-29524517 CCAGCTCCTTCTGTCATGGCAGG - Intergenic
1164742593 19:30587537-30587559 CCAGGCCCTTCAGTATTGCCTGG - Intronic
1165023879 19:32945402-32945424 GCAGCTCCTGCAGTGATGCCTGG - Intronic
1168282792 19:55314491-55314513 GCAGCTCCTTCTGCAAGGCCAGG + Intronic
925387187 2:3470179-3470201 ACAGTTCTTGCAGTAGTGCCAGG - Intronic
925759408 2:7169710-7169732 ACAGCTGCTTCTGAACTGCCAGG - Intergenic
926616384 2:15000869-15000891 ACAGCACCTTCAGAAGGGCCTGG + Intergenic
927711091 2:25326776-25326798 CCAGCTCCTGCAGGAGTGCCAGG + Intronic
927878734 2:26675828-26675850 ACAGCTCCTTCCCAAAGGCCAGG + Intergenic
929658244 2:43755692-43755714 AAGGCTCCTTCAGTCATGTCTGG + Intronic
933280034 2:80322934-80322956 ACATACCCTTCAGTGATGCCTGG - Intronic
933670857 2:85006010-85006032 ACTTCCTCTTCAGTAATGCCTGG + Intronic
934046225 2:88174778-88174800 ACAGTTCCTGCAGTACTTCCTGG + Exonic
935801344 2:106699691-106699713 AGGGCTCCTTGAGAAATGCCTGG - Intergenic
935870982 2:107449575-107449597 AGAGCTCCGGCGGTAATGCCAGG + Intergenic
936093679 2:109516295-109516317 ACAGCACCATCAGTGACGCCAGG - Intergenic
936136601 2:109899914-109899936 TCAGCTTCATCAGTCATGCCTGG + Intergenic
936208096 2:110471571-110471593 TCAGCTTCATCAGTCATGCCTGG - Intronic
936239438 2:110774203-110774225 ACTGCCCCTTGAGCAATGCCTGG - Intronic
937026936 2:118706610-118706632 ACAACTCATTCACTAATGCAAGG + Intergenic
940431665 2:153598611-153598633 ACAGCTCCTGCAACAGTGCCTGG + Intergenic
942393059 2:175516506-175516528 CCAGCTCCTCCAGTAATGGAGGG - Intergenic
943164439 2:184301774-184301796 ACAGCAGCTTCAGTACTGACTGG - Intergenic
1169240171 20:3970299-3970321 AATGCTGCTTCATTAATGCCAGG - Intronic
1170134314 20:13056019-13056041 ACAGCTCCATGAGGATTGCCTGG - Intronic
1172460174 20:35112017-35112039 ACAGTTCATTCAGGAAAGCCAGG - Intergenic
1173861959 20:46289741-46289763 CCAGGTCCTTCAGAAATGGCAGG - Intronic
1176004239 20:62851014-62851036 CCAGCACCTTCAGCAGTGCCTGG + Intronic
1179537020 21:42059366-42059388 ACAGCTCCTCCAGCACTGGCCGG + Intergenic
1183446624 22:37860749-37860771 GCAGCTCCTGCAGTAATTCAGGG - Intronic
1184676836 22:46047998-46048020 ACAGCCCATTTAGCAATGCCAGG + Intergenic
1184819786 22:46901297-46901319 ACTGATTCTTCAGTTATGCCCGG + Intronic
950436533 3:12983637-12983659 TCAGCTCCTTCAGGGACGCCTGG + Intronic
951026571 3:17837263-17837285 AAAGCTTCTTCAGCCATGCCAGG + Intronic
951363785 3:21755823-21755845 CCAGCACCTGGAGTAATGCCTGG - Intronic
952126903 3:30311559-30311581 ACAGCACCTTAAAAAATGCCAGG - Intergenic
953426716 3:42801203-42801225 ACATCACCTTGAGTAATTCCTGG + Intronic
954442770 3:50530747-50530769 GCAATTCCTTTAGTAATGCCTGG + Intergenic
954967585 3:54625006-54625028 GCAGGTCCTCCAGGAATGCCTGG - Intronic
958437070 3:94109712-94109734 ACAGCTCCTCCAGGAATCACAGG - Intronic
959664125 3:108902616-108902638 GCTGCTCCTTCAGTGAAGCCTGG - Intergenic
961509394 3:127391770-127391792 ACAGCTCCTGCAGCAGAGCCTGG - Intergenic
961577417 3:127849258-127849280 CCAGCTCCTTCAGCCATCCCAGG + Intergenic
961934171 3:130565532-130565554 GCAGCTTCTTCAGAAATGTCTGG - Exonic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
965716692 3:171612333-171612355 ACTGTTCCTTCAGTAATGGATGG - Exonic
968192484 3:196679791-196679813 ACACCTTGCTCAGTAATGCCAGG + Intronic
971873266 4:32272568-32272590 ACAGCTGCTTCAGCACTGGCAGG + Intergenic
979356207 4:119708741-119708763 CCTGCTCCTTCAGTGATCCCTGG + Intergenic
980093781 4:128468665-128468687 ACAGCTCCTGAAATCATGCCAGG - Intergenic
981043314 4:140243096-140243118 AGAGCTCCAACACTAATGCCTGG - Intergenic
982652562 4:158104818-158104840 AAAACTCCTTCAGTAAAGTCCGG - Intergenic
986127272 5:4894594-4894616 AGAGCTCCTTCACTATTGCTTGG - Intergenic
986792958 5:11181241-11181263 AAAGCTCTTTCTGTAATGCCTGG + Intronic
992058196 5:73014107-73014129 ATAGATCCTCCAGTACTGCCTGG - Intronic
997662092 5:135597170-135597192 ACAGCTCATAGAGTAGTGCCAGG + Intergenic
1001999331 5:176188799-176188821 ACAGCACCTGCAGCCATGCCAGG - Intergenic
1003121173 6:3320026-3320048 TGAGCTCCTTCAGTCAAGCCAGG - Intronic
1006258163 6:32847557-32847579 ACAGCTGCTGCAGTAAAGTCTGG - Exonic
1007549189 6:42716040-42716062 ACAGAGCCTGCAGAAATGCCTGG + Intronic
1007724369 6:43906029-43906051 GAAGCTCTTTGAGTAATGCCTGG + Intergenic
1013791620 6:113843855-113843877 CTAGCGCCTTCAGTAATCCCTGG + Intergenic
1014645025 6:123962562-123962584 TCATCTCCTTCATTAATGGCTGG + Intronic
1019412791 7:913942-913964 AAAACTCCTTCAGAAAAGCCCGG + Intronic
1033267806 7:139901005-139901027 AGAGCTCCTTCAGAACTGCATGG + Intronic
1035855582 8:2973048-2973070 ACAGCTCGTTCTAAAATGCCTGG - Intronic
1036165239 8:6426462-6426484 ACATCACCTTCAGTGATGTCAGG - Intronic
1037067235 8:14597191-14597213 GCAGCTGCTTCAATAAAGCCAGG - Intronic
1037359935 8:18062493-18062515 AAAGCTCCTAGTGTAATGCCTGG - Intronic
1037436820 8:18871746-18871768 AAAGCTCCTTCAGAGAGGCCTGG - Exonic
1039917432 8:41870545-41870567 ACAGCTCCTTCCGTGATCCATGG - Intronic
1040982302 8:53256170-53256192 ACAGCTGCTCCAGTGCTGCCAGG + Intergenic
1048067652 8:130986788-130986810 ACAGCACTTTGAATAATGCCTGG + Intronic
1049484343 8:142845639-142845661 ACACCTCCTTCAAGAATCCCAGG - Intronic
1050508005 9:6367384-6367406 ACATCTACTTAAGAAATGCCTGG + Intergenic
1056276322 9:84997739-84997761 GCAGCTGCTTAAGTAATGCTGGG + Intronic
1057262643 9:93594096-93594118 ACAGCTCCTTCAGGGAGGCCTGG - Intronic
1058838055 9:108877103-108877125 CCAGCTCCCTCAGAAATGCCAGG + Intronic
1059692334 9:116698065-116698087 ACAGCTCCGGCAGAATTGCCGGG - Exonic
1059806387 9:117805563-117805585 ACAGAACCTGCAGTAATACCTGG + Intergenic
1059901246 9:118928613-118928635 ACAACTCCTTCAGCTATTCCTGG + Intergenic
1061133302 9:128720199-128720221 CCAGCTCCTCCAGAAGTGCCCGG + Exonic
1187105749 X:16239695-16239717 AGCTCTCATTCAGTAATGCCAGG - Intergenic
1190100390 X:47518293-47518315 CCAGCTCCTTGATCAATGCCAGG - Intergenic
1192429376 X:71102073-71102095 ACAGATCCCTGAGTCATGCCTGG + Exonic
1198650379 X:138857166-138857188 ACTGCTGCTTCAGGAATGCAAGG + Intronic
1199053375 X:143263609-143263631 ACAGCTCCTGCTGTAATGAAGGG + Intergenic
1202366573 Y:24169941-24169963 TTAGCTCCTTCTGGAATGCCAGG - Intergenic
1202504209 Y:25500182-25500204 TTAGCTCCTTCTGGAATGCCAGG + Intergenic