ID: 1092215421

View in Genome Browser
Species Human (GRCh38)
Location 12:6678530-6678552
Sequence GGGTTAATTAGACAATGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092215421_1092215432 13 Left 1092215421 12:6678530-6678552 CCAGATCATTGTCTAATTAACCC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1092215432 12:6678566-6678588 CGACCCAACCCAGAGTACACAGG 0: 1
1: 0
2: 1
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092215421 Original CRISPR GGGTTAATTAGACAATGATC TGG (reversed) Intronic
901398424 1:8999510-8999532 GAGTAAAATAGAAAATGATCTGG - Intergenic
919178612 1:194052846-194052868 GGGTTCTTTAGAGAATGCTCTGG + Intergenic
919683050 1:200454995-200455017 GGGTTTAGTAGACCATGTTCAGG - Intergenic
922502468 1:226107599-226107621 GGGTTAAGTAGACACTGGTTAGG - Intergenic
1065190082 10:23199991-23200013 GGGTGGATTAGACAAAGATGAGG + Intergenic
1065991459 10:31013930-31013952 GGGTTAAGTAGGAAATGATGTGG - Intronic
1068410689 10:56650308-56650330 GGAATAATTAGAAAAAGATCAGG + Intergenic
1069265318 10:66450140-66450162 GGATTTTTTAGACAATTATCTGG - Intronic
1077817187 11:5697365-5697387 GGGATAATTAGACAGGAATCTGG + Intronic
1079395006 11:20054446-20054468 GGGCTAATCAGACACTGAGCGGG - Intronic
1080298749 11:30760038-30760060 GGGTTAATTAGAAATAGAGCAGG - Intergenic
1080341229 11:31267593-31267615 GGGTTATTTAGAGAATCACCAGG - Intronic
1081385982 11:42474111-42474133 GGGTTAATTTTACAATGATTTGG - Intergenic
1085027140 11:73242856-73242878 GGGGTGATAAGAAAATGATCCGG + Intergenic
1091008635 11:131977555-131977577 GAGTAAATTAGTCAATGAGCTGG - Intronic
1092215421 12:6678530-6678552 GGGTTAATTAGACAATGATCTGG - Intronic
1092760597 12:11807471-11807493 GGGCTCATTAGACAGTGAGCAGG + Intronic
1093667149 12:21828251-21828273 GGGTTCATAAGCCAATGAGCTGG - Intronic
1095478066 12:42606080-42606102 GAGATAATTTGACAATGATCTGG - Intergenic
1105828186 13:24141307-24141329 GGGTTAATTAATTAATTATCTGG - Intronic
1106776389 13:33014316-33014338 GGGTTAAATGAACAATCATCTGG + Intergenic
1109455030 13:62575262-62575284 AGGGTTATTAGACAATGATTAGG + Intergenic
1111956838 13:94768523-94768545 AGGCTAATTTGGCAATGATCTGG + Intergenic
1113921588 13:113916220-113916242 GGGTGAGTTACACAATGATGGGG + Intergenic
1113921607 13:113916402-113916424 GGGTGAGTTATACAATGATGGGG + Intergenic
1113921610 13:113916422-113916444 GGGTAAGTTATACAATGATGGGG + Intergenic
1113921641 13:113916639-113916661 GGGTGAGTTACACAATGATGGGG + Intergenic
1113921652 13:113916710-113916732 GGGTGAGTTACACAATGATGGGG + Intergenic
1115155966 14:30339559-30339581 GGTTTAGATGGACAATGATCTGG - Intergenic
1116492749 14:45525968-45525990 GGGTCAATTAGAAAATCAACTGG - Intergenic
1117950827 14:61081259-61081281 AGGTAAATTGGACAAGGATCTGG + Intronic
1118515513 14:66524333-66524355 AGGTTAAATAAACAATGATTTGG + Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1127104469 15:55598199-55598221 GAGTTAATTAGACTAAGAGCAGG - Intergenic
1132070177 15:98769673-98769695 GGTTTAATTAGACCAGGATATGG + Intronic
1146603743 17:34240407-34240429 GGGATAAGTAGACATTGGTCTGG + Intergenic
1149307995 17:55367801-55367823 GGGATAATTAGAGAAAGATAAGG - Intergenic
1151931512 17:77234976-77234998 GGGACAATTAGACAATTATGAGG + Intergenic
1156851189 18:41728487-41728509 GTGTTAATTAGAGAATGAATAGG - Intergenic
1158185591 18:54767931-54767953 GGGAAAATTAAATAATGATCAGG + Intronic
1160020224 18:75174629-75174651 GGTTTAATCTGACAATGCTCAGG + Intergenic
930349306 2:50229360-50229382 GGGTCATTTGCACAATGATCAGG - Intronic
932168419 2:69530502-69530524 GGGGTAAGTAGACCATGATATGG + Intronic
939965403 2:148605748-148605770 GGGTTAAATGGACAATGTACAGG - Intergenic
942510922 2:176699653-176699675 GGGTTAATTATACAATGTACAGG + Intergenic
945809219 2:214527729-214527751 GGTTTATTTAGACAATAAACAGG - Intronic
947861994 2:233367009-233367031 GGGGAAATTTGAAAATGATCTGG - Intronic
1174064583 20:47855248-47855270 GGGTTATTTAAAAAATAATCAGG + Intergenic
1175368286 20:58470203-58470225 GGGTTCTTTAGAGAGTGATCAGG - Intronic
1183307705 22:37091615-37091637 GACTTAATCAGACAATGATTGGG - Intronic
949169568 3:982230-982252 TGGTTCATTAGACAATCTTCAGG - Intergenic
950239180 3:11352728-11352750 GGGATAAGTAGACATTGCTCAGG + Intronic
956065631 3:65394492-65394514 GGGCTAAATACACAATAATCTGG + Intronic
958036685 3:88177798-88177820 GGATTATTTAGACAATCCTCTGG + Intergenic
958821421 3:98977960-98977982 GGTTTTTTTAGACCATGATCTGG + Intergenic
960640682 3:119819963-119819985 GACTTAATTAGACAAAGTTCTGG - Intergenic
964268319 3:154926339-154926361 AGCTTAATCACACAATGATCTGG + Intergenic
966222218 3:177562087-177562109 GGGTTAAAGAGAAAATGGTCTGG - Intergenic
968850830 4:3076435-3076457 AGTTTAATTAGAAAATGATTCGG + Intronic
977403793 4:96569798-96569820 GGGTTAATTCTACAATTATGTGG + Intergenic
988062448 5:26189846-26189868 AGTTTAAAGAGACAATGATCTGG - Intergenic
990718388 5:58664991-58665013 GAGTAAACTAGACTATGATCTGG - Intronic
991675248 5:69084223-69084245 GTGTTAATGAGAAAATGTTCAGG + Intergenic
993714759 5:91265195-91265217 GGATTTATTTGACAATGATTAGG - Intergenic
1000244609 5:159439097-159439119 GGGTCAATTAGACAACCATGTGG + Intergenic
1005480394 6:26249923-26249945 GGGTTACTTATACAAAGGTCAGG - Intergenic
1011582427 6:88884484-88884506 GGGTAAATCAGAAAATGATGAGG + Intronic
1012397632 6:98818333-98818355 AGGTTAATTATACAATAATGTGG - Intergenic
1014085887 6:117343272-117343294 GGGTTAATTAGACAAAATTAAGG + Intronic
1025760916 7:64390576-64390598 GGGTTAATGACACCATGTTCTGG + Intergenic
1025807170 7:64845032-64845054 GGGTTAATTATACACTGCTCAGG - Intergenic
1028302871 7:89224152-89224174 GGGTTAATTGTACAGGGATCTGG - Intronic
1033291134 7:140083782-140083804 ACGTTAATGAAACAATGATCAGG - Intergenic
1037307966 8:17525602-17525624 GTTTTAATTTGACAATGAACTGG + Intronic
1040801195 8:51342952-51342974 GGGTGATTTAAAGAATGATCAGG + Intronic
1042689690 8:71484343-71484365 GGGTAAATTAGTCAATGAAAGGG + Intronic
1045476966 8:102561357-102561379 GGTTTTACTGGACAATGATCAGG + Intergenic
1046180347 8:110637412-110637434 GGGTTAGTGAGACATTGTTCAGG + Intergenic
1051883819 9:21868985-21869007 TGGTGCATAAGACAATGATCAGG - Intronic
1197834517 X:130680216-130680238 GGATTAATTTGACAATGATGGGG + Intronic
1201193614 Y:11470621-11470643 GGGTTTATTGGACAATGACAGGG + Intergenic