ID: 1092216810

View in Genome Browser
Species Human (GRCh38)
Location 12:6689232-6689254
Sequence AGCGCGCGGGCACGCACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092216806_1092216810 15 Left 1092216806 12:6689194-6689216 CCAGGAAGGGGCGAGGGAGGGGA 0: 1
1: 0
2: 2
3: 78
4: 657
Right 1092216810 12:6689232-6689254 AGCGCGCGGGCACGCACTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092216810 Original CRISPR AGCGCGCGGGCACGCACTTC TGG Intronic
900759974 1:4463846-4463868 AGGGCGGGGGCAGGCACTGCAGG - Intergenic
922739789 1:228008493-228008515 AGGCCGCGGGGACGCGCTTCGGG + Intronic
923576216 1:235161256-235161278 TGCGCGCCAGCTCGCACTTCCGG + Exonic
1071727875 10:88218145-88218167 AGTGCGCGGGCACCCATTCCAGG - Intergenic
1074722225 10:116272965-116272987 AGCGCGCCGGCCCGCAGTCCCGG + Intronic
1081836927 11:46163375-46163397 AGAGCGAGGGCACGCTCATCTGG + Intergenic
1083741341 11:64713069-64713091 TGCGCGCGGGCGCGCACAGCGGG + Exonic
1092216810 12:6689232-6689254 AGCGCGCGGGCACGCACTTCTGG + Intronic
1113933816 13:113982604-113982626 AGCGCCTGGGCACGCACTCCCGG + Intronic
1131061497 15:89407437-89407459 ACCGCGCGGGCACGCGGCTCTGG - Intergenic
1136272207 16:29155035-29155057 CGCGCGCGTGCACTCACTTCAGG - Intergenic
1136705938 16:32188111-32188133 CCCGCGCGGGCACGCCCCTCGGG - Intergenic
1136761974 16:32741294-32741316 CCCGCGCGGGCACGCCCCTCGGG + Intergenic
1136806126 16:33129094-33129116 CCCGCGCGGGCACGCCCCTCGGG - Intergenic
1139896868 16:70294706-70294728 AGCGCTCGGGCACGCGCCCCAGG - Intronic
1141682610 16:85553340-85553362 AGCGCGCCGCCACGCAGCTCCGG + Intergenic
1203064133 16_KI270728v1_random:1001610-1001632 CCCGCGCGGGCACGCCCCTCGGG + Intergenic
1145911848 17:28547655-28547677 AGTGCGCGGGCAGGGTCTTCTGG - Exonic
1152759332 17:82099743-82099765 GGCGTGCGGGCACGCAGCTCCGG + Intergenic
1153451758 18:5238054-5238076 CCCGCGCCGACACGCACTTCCGG + Intergenic
945470769 2:210225387-210225409 AGCGCTCGCGCGCGCCCTTCCGG + Exonic
1168795945 20:610287-610309 AGCGCGCGGGAGCGCACGGCGGG - Exonic
1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG + Exonic
1185351765 22:50343301-50343323 GGCGCACGGGCACGCGCTCCGGG - Exonic
968584067 4:1407809-1407831 AGCGCGCGCGCTCGCACTGCCGG - Intergenic
969873150 4:10116873-10116895 CGCGCGCGGGACCGCGCTTCCGG - Intronic
990699621 5:58460598-58460620 ACAGCGCGGGCAGGCACTGCGGG - Intergenic
992004005 5:72460636-72460658 CGCACGCGTGCACGCACTGCGGG - Exonic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1011112439 6:83853490-83853512 GGCGCGCGGGCGCGGACTCCGGG + Exonic
1011740919 6:90359865-90359887 TGCGCGCGCGCACGCAATGCTGG + Intergenic
1018690785 6:166342572-166342594 AGCGGGCGGGACCGGACTTCCGG - Exonic
1018702390 6:166437215-166437237 AGTGCGCTGGCAGGCACTTGGGG - Intronic
1022923440 7:35037753-35037775 AGCGCGCACGCGCGGACTTCCGG + Intronic
1035153161 7:156892485-156892507 AGCGCGGGGGCGCGCACTGGCGG + Intronic
1055945859 9:81690023-81690045 AGCGCGCGGGCGCGCGCTAGCGG + Intergenic
1056896915 9:90559638-90559660 AGAGCTCGGGCATGGACTTCAGG + Intergenic
1198296674 X:135293982-135294004 AGAGCGCTTGCAGGCACTTCTGG - Exonic
1200086559 X:153610076-153610098 AGCGCGTGTGCACGCACGGCGGG + Intergenic