ID: 1092217296

View in Genome Browser
Species Human (GRCh38)
Location 12:6692482-6692504
Sequence TATCCCACCCTCCTTGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092217293_1092217296 13 Left 1092217293 12:6692446-6692468 CCTGTGGGGAAAGAAGGAAAGGT 0: 1
1: 0
2: 2
3: 41
4: 359
Right 1092217296 12:6692482-6692504 TATCCCACCCTCCTTGGATCTGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092217296 Original CRISPR TATCCCACCCTCCTTGGATC TGG Intergenic
905268196 1:36769453-36769475 GATCCCAGCCTCCTGGGATGTGG - Intergenic
907406423 1:54256426-54256448 CATGCCACCCTCCCTGGTTCAGG - Intronic
913650285 1:120907071-120907093 TATCCTACCCTCCTTTGAGGGGG + Intergenic
914170833 1:145222004-145222026 TATCCTACCCTCCTTTGAGGGGG - Intergenic
914241736 1:145857405-145857427 CATCCCAGCCTCCTGGGAACAGG + Intronic
914525948 1:148465972-148465994 TATCCTACCCTCCTTTGAGGGGG - Intergenic
914640454 1:149601151-149601173 TATCCTACCCTCCTTTGAGGGGG + Intergenic
915588238 1:156856670-156856692 GGTCCCACCCTCCTTGGAGGGGG - Intronic
916875448 1:168963797-168963819 TAACCCACGCTCCTTGGCACTGG - Intergenic
918508431 1:185283110-185283132 TATGCCACCCTCCTGGCATATGG + Intronic
923263325 1:232288343-232288365 TTTCCCACCCTCGTTGGAGCTGG - Intergenic
1062834761 10:628480-628502 TGTCCCACCCTCTCTGGACCTGG - Intronic
1069631473 10:69899661-69899683 TATCCAAGCCTCCTTGGGTTAGG - Intronic
1071186492 10:83052166-83052188 AATCACACCCACCTTAGATCAGG + Intergenic
1072061950 10:91821752-91821774 TTTCCCTCCCTCCTTTGTTCTGG - Intronic
1078349061 11:10577567-10577589 TTTCCCCACCTCCTTGGTTCAGG - Intronic
1083302066 11:61744663-61744685 GATCCCAGCCACCTTGGCTCTGG - Exonic
1083324779 11:61867643-61867665 CATGCCACCCTCCTTGGGTAGGG - Intergenic
1083668140 11:64286211-64286233 CATCCCCCCATCCTTGGCTCTGG + Intronic
1083742411 11:64717886-64717908 GAGCCCACCCTCCTCTGATCTGG + Intronic
1085095757 11:73760102-73760124 GATCCCACCCTCCTTGGCCAAGG + Intronic
1085763426 11:79261591-79261613 CTTCCCACCTTCCTTGGGTCTGG + Intronic
1086105700 11:83144574-83144596 TATCCCAACTTCCTTGGGTAAGG - Intergenic
1086591520 11:88520978-88521000 CATCCCACCCTCCTTCCTTCTGG + Intronic
1089502503 11:118940720-118940742 TATCCCATCCTCCTGGGGTTGGG - Intronic
1092217296 12:6692482-6692504 TATCCCACCCTCCTTGGATCTGG + Intergenic
1092969631 12:13680194-13680216 TATCCAACTACCCTTGGATCTGG + Intronic
1093802087 12:23386581-23386603 TATGCCCCCTTCCTTGAATCTGG + Intergenic
1096874942 12:54621404-54621426 TATCTCAGCCTCCTTGTAGCTGG + Intergenic
1101717876 12:107326750-107326772 TATCCCACCCTGCTCAGATGTGG - Intronic
1102632107 12:114290159-114290181 AATTCCTCTCTCCTTGGATCTGG + Intergenic
1104828377 12:131731051-131731073 AGTCCCACCCATCTTGGATCTGG + Intronic
1105865499 13:24455102-24455124 TGTCACACCCTCCATGGAACTGG + Exonic
1105967631 13:25399117-25399139 TATCACATCCTCCTTAGAGCTGG - Intronic
1108435255 13:50396378-50396400 TTTCCCAGCCTTCTTGTATCTGG + Intronic
1110517153 13:76427511-76427533 TATTCCCACCTCCTTGGATATGG + Intergenic
1115555890 14:34544805-34544827 AATTCCCCTCTCCTTGGATCTGG - Intergenic
1115558018 14:34558282-34558304 AATTCCCCTCTCCTTGGATCTGG + Intergenic
1124590637 15:31050294-31050316 TACCCGTCCCTCCTGGGATCAGG + Intronic
1130851386 15:87797646-87797668 TATATCACCCTGTTTGGATCTGG + Intergenic
1132518800 16:378054-378076 CATCCCACCCTCCTGGCATCTGG + Intronic
1132568070 16:632198-632220 CCTCCCACCCTCCTTCCATCCGG + Intronic
1133234231 16:4380378-4380400 TGTCCCGCCCTCCTTGGAGGAGG - Intronic
1141255550 16:82398754-82398776 TTTCCCAGCCTCCTTGCATTAGG - Intergenic
1143700533 17:8656566-8656588 TGTCCCAACCCCCTTGAATCTGG + Intergenic
1144411956 17:15010265-15010287 TATCCCAGCATCCTGTGATCTGG - Intergenic
1145990675 17:29077632-29077654 AATCCAATCCTCCTTGGAGCGGG + Exonic
1148197967 17:45728513-45728535 TAAACCACCCTCCTGGGCTCTGG - Intergenic
1153932182 18:9887759-9887781 GATGTCACCCTCCTTGGATGGGG - Exonic
1156163807 18:34393665-34393687 TATCAGACCCTCTTTGGTTCAGG + Intergenic
1158128605 18:54128328-54128350 TTTCCCACCGTCCTTGTATTGGG - Intergenic
1158433568 18:57416045-57416067 TGTCCCCTCCTCCTTGAATCTGG + Intergenic
1158908415 18:62036386-62036408 TATGCCACCCTGCCTGGCTCTGG + Intergenic
1159847566 18:73483002-73483024 TCTCCCACCCTCCTTCCATATGG + Intergenic
1161322191 19:3646444-3646466 TTTCCCAGCCTCCTTGGGTGAGG + Intronic
1161650933 19:5484481-5484503 AATCCCAGCATCCTTGGACCCGG + Intergenic
1165008105 19:32823067-32823089 TATCCCGCCCTCCTGGGAAGCGG - Intronic
1168162195 19:54518478-54518500 TATCCCAGCCTTCCTGGCTCCGG - Intergenic
927094212 2:19735420-19735442 TCTCCCACCCACTTTGCATCAGG + Intergenic
927709095 2:25314196-25314218 CACCCCACCCTCCCTGGGTCAGG + Intronic
929535853 2:42783755-42783777 TTCCCCACCCTGCTGGGATCCGG + Intronic
929890185 2:45912369-45912391 TCTCTCACCCTCCTTGTACCTGG - Intronic
930871527 2:56175890-56175912 AATCCCACCCCCATAGGATCTGG - Intergenic
932909699 2:75792630-75792652 TTTCACAACCTCCTTGAATCTGG - Intergenic
934527213 2:95059371-95059393 ACTCCCACCCTCCTGGGACCTGG - Intergenic
935635172 2:105244239-105244261 TTTCCCACCCTCTTCAGATCTGG - Intergenic
937162138 2:119774623-119774645 TATCAAACCATCCTTGGATTGGG - Intronic
937985682 2:127637122-127637144 TCTCCCTCCCTCCTTGGAATGGG - Intronic
938262516 2:129905844-129905866 TATCCAACCCTCCTTGCTCCAGG + Intergenic
938302188 2:130224217-130224239 TAGCCCCCCATCCTTGGATGAGG + Intergenic
941207006 2:162586193-162586215 AATCCCACTCTCCTTGAATCTGG + Intronic
941318311 2:164022629-164022651 TAGCACACCTTCCTTGGAACAGG + Intergenic
943795318 2:191985874-191985896 TAACAGACCCTCCTTGGAACAGG - Intronic
1169697064 20:8401826-8401848 TGTCCCAGCCTCCTTGAATTGGG - Intronic
1169863948 20:10180050-10180072 ATTTCCACACTCCTTGGATCTGG - Intergenic
1170023538 20:11863609-11863631 TATGCCACCCTCCTGGCATATGG + Intergenic
1172197137 20:33099653-33099675 TCTCCCACCCTCTTTTCATCTGG + Intronic
1175492702 20:59389906-59389928 ACTCCCACCATCCTTGGCTCAGG + Intergenic
1178200750 21:30401885-30401907 AATCCCAAGATCCTTGGATCTGG - Intronic
1179359190 21:40689680-40689702 CATCCCAGCCTGCTGGGATCTGG - Intronic
1179424107 21:41259911-41259933 TAGCCCAACCTCCCTGGTTCAGG + Intronic
1181673232 22:24435789-24435811 CATCCCAACTTCCTTGGAGCTGG + Intronic
1182419471 22:30241951-30241973 TACCCCACCTTCCTGGGGTCTGG + Exonic
1182800885 22:33031289-33031311 TCTCCCACCCTCCTTATCTCAGG + Intronic
957252668 3:77793879-77793901 TATCCCACTCCTCTTGAATCTGG + Intergenic
959802267 3:110509473-110509495 TATACAACCCTCCTTAAATCAGG - Intergenic
960754530 3:120996614-120996636 TTTCCCAGCCTCCTTGGCACTGG + Intronic
961826211 3:129600465-129600487 TATGCCTCCCTCCTAGGATGTGG - Intronic
967469273 3:189843381-189843403 GCTCCCAGCCTCCTTGGCTCAGG + Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
980975630 4:139607475-139607497 CATCCCAGCCTCCTGGGACCAGG - Intergenic
984701179 4:182819645-182819667 CTCCCCACCCTCCGTGGATCTGG - Intergenic
985521932 5:377804-377826 TATCCCACGCTGCTGGGAGCAGG - Intronic
985815561 5:2125474-2125496 TATCCCACCCACCTTCCATCAGG - Intergenic
989981388 5:50649617-50649639 TATCCTACCCTCCTTTGAGGGGG + Intergenic
990085320 5:51969327-51969349 TAGGCCCCTCTCCTTGGATCTGG - Intergenic
994906504 5:105846148-105846170 TTTCCCACCCACACTGGATCAGG - Intergenic
995239158 5:109866103-109866125 TACCCTACCCTGCTTGGAGCTGG + Intronic
999549662 5:152672567-152672589 ACTCCCTCCCTCCTTGGATCCGG + Intergenic
1000125849 5:158243192-158243214 TATCTCAGCCTCCATGCATCTGG - Intergenic
1019641035 7:2103737-2103759 TATGCCACACTGCTGGGATCTGG - Intronic
1026482699 7:70791865-70791887 AATCCCACCCTCCCTGGCACTGG - Exonic
1026499892 7:70935379-70935401 TACCCCACCTTCCAGGGATCAGG - Intergenic
1031322067 7:120343191-120343213 TTTCCCAGCCTCTTTGCATCTGG - Intronic
1032139069 7:129309904-129309926 CATACAACCCACCTTGGATCTGG + Intronic
1032425030 7:131815642-131815664 TCTCACACCCTCCCTGGATTTGG + Intergenic
1034823388 7:154237561-154237583 TGTCCCACCTTCCCTGGACCAGG + Intronic
1040695383 8:49991325-49991347 AATCCCACCAGCCTTGCATCGGG - Intronic
1042760845 8:72269961-72269983 GTTCCCACCCTCATTGGATCAGG - Intergenic
1043179030 8:77060344-77060366 TATCCCACCCTTCTAAGATGAGG - Intergenic
1049305078 8:141898427-141898449 TATCCCACCTGCCATGTATCGGG - Intergenic
1049445427 8:142628433-142628455 TCTCCCACCCTCCTTTCTTCAGG + Intergenic
1050310551 9:4348541-4348563 TCTCCCAGCCTCCTTGGAGTAGG - Intergenic
1056438421 9:86596012-86596034 TGTCTCATCCTCCTTGGACCAGG + Intergenic
1058915552 9:109560978-109561000 TATCCCTCCCTCTTTAGAACTGG - Intergenic
1060759692 9:126236825-126236847 TGTCCTCCCCTCCTTGAATCGGG + Intergenic
1061007319 9:127935517-127935539 TATCCCTCCCTCCTAGCTTCTGG + Exonic
1203608469 Un_KI270748v1:75529-75551 ACTCGGACCCTCCTTGGATCTGG + Intergenic
1195422824 X:104694598-104694620 TAGCCCGCCCTCCTGGGCTCTGG - Intronic
1196258023 X:113545654-113545676 TGTCCAACCCTCCTTTGATGAGG - Intergenic
1200069359 X:153520066-153520088 ACCCCCACCCTCCCTGGATCTGG - Intronic