ID: 1092218836

View in Genome Browser
Species Human (GRCh38)
Location 12:6699854-6699876
Sequence ATGGGGGCATGGTGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 0, 2: 15, 3: 85, 4: 837}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092218821_1092218836 20 Left 1092218821 12:6699811-6699833 CCCCCAAATGTAAAGGGATGTGG 0: 1
1: 0
2: 1
3: 14
4: 132
Right 1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG 0: 1
1: 0
2: 15
3: 85
4: 837
1092218825_1092218836 17 Left 1092218825 12:6699814-6699836 CCAAATGTAAAGGGATGTGGAGA 0: 1
1: 0
2: 1
3: 51
4: 424
Right 1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG 0: 1
1: 0
2: 15
3: 85
4: 837
1092218823_1092218836 19 Left 1092218823 12:6699812-6699834 CCCCAAATGTAAAGGGATGTGGA 0: 1
1: 0
2: 1
3: 11
4: 187
Right 1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG 0: 1
1: 0
2: 15
3: 85
4: 837
1092218832_1092218836 -8 Left 1092218832 12:6699839-6699861 CCGAAAGACATAGGGATGGGGGC 0: 1
1: 0
2: 1
3: 8
4: 129
Right 1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG 0: 1
1: 0
2: 15
3: 85
4: 837
1092218824_1092218836 18 Left 1092218824 12:6699813-6699835 CCCAAATGTAAAGGGATGTGGAG 0: 1
1: 0
2: 1
3: 17
4: 267
Right 1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG 0: 1
1: 0
2: 15
3: 85
4: 837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092218836 Original CRISPR ATGGGGGCATGGTGGGAAGA AGG Intronic
900141546 1:1141182-1141204 ATCGGGGGATGGTGTGAGGAAGG - Intergenic
900267901 1:1768824-1768846 ATGATGGCAAGGTGGGCAGAAGG + Intronic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
900771518 1:4548389-4548411 ATGAGGGCATGGGTGGAAGGTGG + Intergenic
900797822 1:4719910-4719932 CTGGGGGCCTGGTGGGACCATGG + Intronic
900993178 1:6107155-6107177 ATGGAGGGATGGAGGGAAGGTGG + Intronic
900993191 1:6107192-6107214 ATGGAGGGATGGAGGGATGATGG + Intronic
900993197 1:6107211-6107233 ATGGAGGGATGGAGGGATGATGG + Intronic
900993245 1:6107409-6107431 ATGGAGGGATGGAGGGATGATGG + Intronic
900993327 1:6107765-6107787 ATGGAGGGATGGAGGGATGATGG + Intronic
900993346 1:6107851-6107873 ATGGAGGGATGGAGGGATGATGG + Intronic
900993409 1:6108055-6108077 ATGGAGGGATGGAGGGATGATGG + Intronic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
900993608 1:6108871-6108893 ACGGAGGCATGGAGGGATGATGG + Intronic
900993620 1:6108906-6108928 ATGGAGGCATGGAGGGATGGAGG + Intronic
900993622 1:6108914-6108936 ATGGAGGGATGGAGGGATGAAGG + Intronic
901071848 1:6524300-6524322 ATGTGATCATGCTGGGAAGATGG + Exonic
901128696 1:6948584-6948606 ATGTTGGCATGGTGGGGACAGGG + Intronic
901739607 1:11333739-11333761 AGGGGGGCAGGGAGGGAAGTGGG + Intergenic
901830766 1:11890912-11890934 ATAGGGTGATGGTGGGGAGAGGG - Intergenic
901898523 1:12337029-12337051 AGGGAGGCAGGGAGGGAAGAAGG - Intronic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902850776 1:19154495-19154517 ATGGGGGCATGGTTGGATATGGG - Intronic
902956462 1:19927410-19927432 AGGGGGGCATGTTGGGAAAAGGG - Intergenic
903019978 1:20386991-20387013 ATGGGGGGAGGAGGGGAAGAGGG + Intergenic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
904203474 1:28836921-28836943 ATGGGGGCAGGGTGGGGGAACGG + Intronic
904597408 1:31655571-31655593 CTGGGGGCCTGGTGGGAGGGTGG - Intronic
904771821 1:32885174-32885196 TTGGGGGCAAGGTGGGAGAAGGG - Intergenic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905309393 1:37038625-37038647 ATGGGGCCATGATGAGAGGAAGG + Intergenic
905507099 1:38488761-38488783 ATGAGGACATGGTGAGAACATGG - Intergenic
905628428 1:39504361-39504383 ATAGGGTAATGGTGGGGAGAGGG + Intronic
905628490 1:39504820-39504842 ATAGGGTAATGGTGGGGAGAGGG + Intronic
905809859 1:40904275-40904297 AGTGGGTCAGGGTGGGAAGACGG - Intergenic
906257140 1:44359083-44359105 TGGTGGTCATGGTGGGAAGAGGG - Intergenic
906659376 1:47571700-47571722 ATGGAGGGAGGGAGGGAAGAAGG - Intergenic
906740463 1:48177874-48177896 AGGGGGGCAGGTAGGGAAGAGGG + Intergenic
906933641 1:50193047-50193069 ATGGGGGCAAGATGGAAAGGAGG - Intronic
906996272 1:50797459-50797481 GTGAGGCCATGGTGGGAGGATGG + Intronic
907074501 1:51566179-51566201 AAAGAGGCATGGAGGGAAGAGGG - Intergenic
907383559 1:54110830-54110852 ATCAGGGCATGCTGGGCAGAGGG - Intronic
908232741 1:62121980-62122002 TTGGGGGCAGGGTGGGACAAGGG + Intronic
908395279 1:63719742-63719764 ATGGGGGCATGGGGAGGTGATGG + Intergenic
909065734 1:70932780-70932802 TTGGGGGCATAGTTGAAAGAGGG - Intronic
909273833 1:73659034-73659056 AAGGGTGGAGGGTGGGAAGAGGG - Intergenic
909344666 1:74571702-74571724 ATGAGGGCATGGGAGGAGGAAGG - Exonic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910130700 1:83902058-83902080 ATGGGAATGTGGTGGGAAGATGG - Intronic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911094989 1:94047795-94047817 GAGGGGGCATGGGAGGAAGAAGG - Intronic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
911689623 1:100818208-100818230 AGGGGGGAAGGGTGGGAAGGGGG + Intergenic
911731842 1:101299684-101299706 TGGGGGCCAAGGTGGGAAGATGG - Intergenic
912410740 1:109479320-109479342 AGGGGGTCATTGTGGGAACAGGG - Intronic
913194907 1:116448153-116448175 AAGAGGCCATTGTGGGAAGAAGG - Intergenic
913338344 1:117732115-117732137 ATGAGGAGATGCTGGGAAGAAGG + Intergenic
914454878 1:147826642-147826664 TTGGGGGAAGCGTGGGAAGAGGG - Intergenic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
915167541 1:153956813-153956835 ATAGGAGCAAGGTGGGTAGAAGG + Intronic
915409878 1:155692360-155692382 AGGGGGGCATGTTGGGAAAAAGG - Intronic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
915488939 1:156241006-156241028 ATGGTGACAAGGTGGGCAGAGGG - Intronic
915603668 1:156937908-156937930 ATCGTGGCATGGATGGAAGAGGG - Intronic
915703764 1:157823828-157823850 AAGTGGCCATGGTGGAAAGATGG - Intergenic
915931012 1:160061087-160061109 GTGGGGGCATGGTGAGGGGAAGG - Intronic
916061240 1:161099820-161099842 AGGGGGGGAAGGTGGGAAGATGG + Intronic
916068327 1:161154271-161154293 AAGGAGGGATGGTGGGGAGAGGG + Intronic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
918107401 1:181426437-181426459 ATGGGGCCATGATGGGAATGGGG - Intronic
918146454 1:181760246-181760268 ATGGGGGTAGGGTGGGAAGGAGG - Intronic
918286118 1:183056522-183056544 ACGGGGGGATGGGGGGAGGAGGG - Intronic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
918978903 1:191529007-191529029 ATGGGGGAATGGTTGGTTGATGG - Intergenic
920290954 1:204922945-204922967 ATGGGGCCACTGTGGGAGGATGG - Intronic
920660006 1:207907700-207907722 ATGCGTGCATGTTGGAAAGATGG - Intronic
920852002 1:209634435-209634457 ATGGGGGGAAGGTAGGTAGAGGG - Exonic
921549570 1:216518055-216518077 ATGGGGGCAATTTGGGCAGAAGG + Intronic
921595945 1:217053811-217053833 ATGGGGGCAACATGGGAAGAAGG + Intronic
921800246 1:219394773-219394795 AAGGGTGGAGGGTGGGAAGAGGG - Intergenic
922212661 1:223497635-223497657 ATGGGGGTGTGCTGGGAGGAGGG + Intergenic
922342759 1:224670752-224670774 AGTGGGGCTTGGTGGGAAAATGG - Intronic
922398514 1:225226825-225226847 ATAGGGTCATGGTGGGGAGAGGG + Intronic
922456154 1:225775223-225775245 AAAGGGGGAGGGTGGGAAGATGG + Intergenic
922681963 1:227606254-227606276 ATAGGGTGATGGTGGGGAGAAGG + Intronic
922860256 1:228810398-228810420 ATGGGGGCAGGTAAGGAAGAGGG + Intergenic
923252626 1:232191614-232191636 ATGGGGGCATGGTGGGCCAAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923512670 1:234665975-234665997 ATGGGGGCACTGGGGGATGAGGG - Intergenic
923714064 1:236410237-236410259 AAGGGGGGAGGGTGGGAGGAGGG - Intronic
923802939 1:237228120-237228142 GTGGGGAAAGGGTGGGAAGAGGG - Intronic
923961141 1:239085014-239085036 GTGGGGGCATGGTGGGAGTGAGG - Intergenic
924323528 1:242872734-242872756 AGTGTGGCATGATGGGAAGAAGG + Intergenic
924794719 1:247285060-247285082 ATGGTGGGATGCTGGGGAGAGGG - Intergenic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1064068834 10:12207701-12207723 GTGGGAGCAGGGTGGGAGGAAGG + Intronic
1064191923 10:13214148-13214170 ATGGGGGAATGGTTGGTTGATGG - Intergenic
1065161490 10:22927526-22927548 TGGGGGGCATGGGAGGAAGAAGG + Intergenic
1065777181 10:29131881-29131903 ATGTTGGGATGGTGGGATGAAGG + Intergenic
1066281048 10:33918650-33918672 ATGGGGGCATGGTGGGGGTCAGG + Intergenic
1066795139 10:39111920-39111942 ATGGGGGCATGTTGGGAAAAAGG + Intergenic
1067005529 10:42657339-42657361 AAGGGGGGAGGGTGGGAAGGGGG - Intergenic
1067266325 10:44748446-44748468 ATGGGGGCAGGGTGGGCTGTAGG + Intergenic
1067574130 10:47397074-47397096 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1068656083 10:59577632-59577654 ATGGGGGCGTGGTGGGCCAAAGG + Intergenic
1069240287 10:66129965-66129987 ATGGTGGTGTGGTGGGGAGAAGG - Intronic
1069782487 10:70965520-70965542 ATGGGGGAATAGTGGTAATAGGG + Intergenic
1070597904 10:77845589-77845611 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1070763237 10:79038907-79038929 ATGTGGCCATGGTGGGAGGTGGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071760457 10:88599394-88599416 ATGGGGACATGGTGGTCAAAGGG - Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072872192 10:99132436-99132458 ATGGGGGATTGCTGGCAAGATGG + Intronic
1072881841 10:99235906-99235928 TTGGGGGGGTGGTGGGAGGAAGG - Intergenic
1073214188 10:101827581-101827603 ATGGGGGTGAGGTGGGAAGGTGG + Intronic
1073288604 10:102402558-102402580 ATGTGGGCAGGGTGGGTAGCTGG - Intergenic
1073500765 10:103934801-103934823 AAGGGTGGAGGGTGGGAAGAGGG - Intergenic
1074886633 10:117699205-117699227 ATGGAGGAAAGGTGGGCAGAGGG + Intergenic
1075283037 10:121157584-121157606 ATGGAGGAAGGGTGGAAAGAGGG + Intergenic
1075300890 10:121323172-121323194 ATGGAGGCAGGCTGGGAAGGAGG + Intergenic
1075893388 10:125973778-125973800 ATGGGGGCATGATGGGCAGGAGG - Intronic
1076218993 10:128717985-128718007 TTGGGGGCTTAGTGGGAAGGAGG + Intergenic
1076555277 10:131317517-131317539 ATAGGGGCATGGAGGGTGGAGGG - Intergenic
1076672543 10:132131189-132131211 ATGGGGGCGTTGTGGGGAGACGG + Intronic
1077159597 11:1106613-1106635 ATGGGTGGATGGTGGGTGGATGG - Intergenic
1077272194 11:1686659-1686681 AGGGAGGCAGGGAGGGAAGAAGG - Intergenic
1077272285 11:1686934-1686956 AGGGAGGCAGGGAGGGAAGAAGG - Intergenic
1077475437 11:2788147-2788169 TTGGGGGCATGGGGTGGAGAGGG - Intronic
1077959078 11:7053932-7053954 GTGGGGGAATGAGGGGAAGAGGG - Intronic
1078148344 11:8737850-8737872 ATGAGGCTAAGGTGGGAAGATGG - Intronic
1078316541 11:10298020-10298042 ATGGGAGCAGGAAGGGAAGAAGG + Intergenic
1078496051 11:11818110-11818132 ATGTGGTCCTGATGGGAAGATGG + Intergenic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078556318 11:12329467-12329489 GAGGTGGCATGGTGGGAAGTGGG + Intronic
1078565235 11:12408799-12408821 ATAGTGGCTTGGTGGGAAGCGGG + Intronic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079152921 11:17917412-17917434 AGGGGGGAAGGGTGGGAAGTGGG + Intronic
1079545177 11:21625408-21625430 AGGGTGGCATAGTGAGAAGATGG - Intergenic
1080108098 11:28533132-28533154 GGAGGGGCATTGTGGGAAGAAGG - Intergenic
1080864718 11:36183125-36183147 ACGGTGGGATGGTGGGAAGGTGG + Intronic
1081874194 11:46397580-46397602 ATGGGGACAGGGGAGGAAGAGGG + Exonic
1083040615 11:59681888-59681910 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1083141041 11:60722231-60722253 ATTTGGACATTGTGGGAAGAGGG - Intergenic
1083276042 11:61597703-61597725 ATGGGGAAATGGGGGGCAGAGGG - Intergenic
1083467753 11:62860061-62860083 ATAGGGTAATGGTGGGGAGAGGG + Intronic
1083482930 11:62961242-62961264 GTGAGGACATGGTGGGAAGGCGG + Intronic
1083488575 11:62998719-62998741 ATGGGGGCACGTGGGGAAGGAGG - Intronic
1083621613 11:64052040-64052062 AGGGGGGCATTTTGGGAAGGAGG + Intronic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083875704 11:65523526-65523548 ACAGGGTGATGGTGGGAAGAAGG - Intergenic
1084001071 11:66295678-66295700 ATGGTGGAATGGTGGGGAGGGGG - Exonic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084566499 11:69931705-69931727 TGGGGGGCATTGTGGGCAGAGGG - Intergenic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1084801879 11:71549363-71549385 ATGGGGGCATGTGGGAAAGAGGG - Exonic
1085013600 11:73158069-73158091 TGGGGGGGGTGGTGGGAAGATGG + Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085920994 11:80957109-80957131 ATGGGAGAAGGGTGGGATGATGG - Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086418973 11:86619038-86619060 ATGGCGGGTTGGGGGGAAGAAGG - Intronic
1087119178 11:94554709-94554731 ATGGGGGCATGGGGGTGAGCAGG + Intronic
1087181685 11:95148422-95148444 ATGGTGGCTGGGTTGGAAGAGGG + Intergenic
1088820662 11:113453931-113453953 ATGGGGGGCTGGGGGGAGGATGG + Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089261061 11:117224340-117224362 ATGGGGGAAAGATTGGAAGATGG + Intronic
1089441832 11:118524121-118524143 ATGAGGACTTGGTGGGCAGAGGG - Exonic
1089497334 11:118914303-118914325 ATGGGGCCATTGTGGGAGGATGG + Intronic
1090040365 11:123285348-123285370 AGGGTGGCATGGGAGGAAGAGGG - Intergenic
1090215762 11:124962794-124962816 GTCGTGGCATGGTGGGAAGCGGG - Intronic
1090513522 11:127400165-127400187 GTGGGGGCAGGGTGGGGACAGGG - Intergenic
1090691463 11:129187376-129187398 GTGGGGGCATAGTGGGAGGCTGG + Intronic
1091043125 11:132300954-132300976 AGGGGGACCTGGTGTGAAGAAGG + Intronic
1091405212 12:204504-204526 ATGGGGGGATGCAGGCAAGATGG + Intronic
1091712936 12:2754558-2754580 ATAGGAGCAGGGTAGGAAGAAGG + Intergenic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1092128388 12:6091281-6091303 ATGGGGGGTGGGTGGGAGGAGGG + Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1093959845 12:25260276-25260298 AGGGTGGCAAGGAGGGAAGAAGG - Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095054375 12:37582233-37582255 ATGGAAGCCTGGTGGGTAGAGGG + Intergenic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1095952732 12:47790388-47790410 CGGGGGGCATGATGGGGAGATGG + Intronic
1096262827 12:50103745-50103767 ATGAGACCATGGTGGGAAGCTGG + Intergenic
1096789060 12:54034025-54034047 AGGGGGGGTTGGGGGGAAGAGGG - Intronic
1096814005 12:54190148-54190170 ATGGGGGAATGGTGGGGGAATGG - Intergenic
1096919104 12:55065191-55065213 ATTGGGGTATCTTGGGAAGAGGG + Intergenic
1096976206 12:55700501-55700523 TTGGGGACAGGGTGGGGAGAGGG - Intronic
1097093636 12:56527750-56527772 AAGGGGGCATGGTGGGGGGGTGG - Intronic
1097187315 12:57202783-57202805 GTGGGGGTATGGTGGGAGCACGG - Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097292687 12:57932190-57932212 ATGGGGGCAGTGTGGGCAGTTGG + Intergenic
1097926979 12:65139523-65139545 ATCAGAGCATGGTGGGAGGAGGG - Intergenic
1098434871 12:70457930-70457952 GTGAGGCCAAGGTGGGAAGATGG + Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1098952864 12:76659780-76659802 AGGGGGAAAGGGTGGGAAGAGGG + Intergenic
1099504393 12:83454792-83454814 ATGGGGATATGATGAGAAGATGG + Intergenic
1100243365 12:92731824-92731846 ATGGGGGCGTTCTGGAAAGATGG + Intronic
1100278125 12:93091153-93091175 ATAGGGGCCTAGTGGCAAGAAGG - Intergenic
1100551982 12:95654599-95654621 ATGTGGGGATGATGGGATGATGG + Intergenic
1100552061 12:95654935-95654957 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552124 12:95655191-95655213 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552159 12:95655335-95655357 ATGATGGCATGTTGGGATGATGG + Intergenic
1100552205 12:95655519-95655541 ATGATGGCATGTTGGGATGATGG + Intergenic
1100622262 12:96289344-96289366 ATGGAGTCATGGTGAGAATAGGG - Intronic
1100921335 12:99491530-99491552 GTGGGTGGAGGGTGGGAAGAGGG - Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102228712 12:111247674-111247696 CTGGGGGCAGGATGGGGAGAGGG + Intronic
1102438883 12:112946527-112946549 ATGGGGGAGTGGTGGGAGGGAGG - Intronic
1102640254 12:114360735-114360757 ATGGGTGAATGGTGGGTGGATGG + Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103254263 12:119527263-119527285 GAGGGGGGATGGTGGGAGGAGGG + Intronic
1103974870 12:124695938-124695960 TTGGAGGAATGGTGGTAAGAGGG + Intergenic
1103992802 12:124810404-124810426 ATACTGGCACGGTGGGAAGAGGG + Intronic
1104356279 12:128089795-128089817 ATGTGGGCATGGTGGAGGGAGGG + Intergenic
1104466373 12:128994073-128994095 AAGGGGGCAGGAAGGGAAGATGG - Intergenic
1104488480 12:129172935-129172957 ATGGGGGAATGGTGGGTTGGTGG + Intronic
1104633292 12:130422759-130422781 CTGGGCGCATGGTGGGGTGAGGG + Intronic
1104778571 12:131405275-131405297 ATGGGTAGATGGTGGGTAGATGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105688685 13:22813874-22813896 ATAGGGGAATAGTGGGGAGAGGG + Intergenic
1106149846 13:27088601-27088623 TTGGGGGCATGGTAGGCAGAGGG + Intronic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107410721 13:40156035-40156057 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1108020939 13:46127098-46127120 AGGGAGGCAGGGTAGGAAGAGGG + Exonic
1109586708 13:64413522-64413544 ATTGGGGCATGATAGGAAAAGGG - Intergenic
1109864632 13:68246711-68246733 GTGGGTGGAGGGTGGGAAGAGGG - Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1110704497 13:78589189-78589211 ATGGGGGCATGGTGGGGGCTGGG - Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1112712444 13:102145397-102145419 ATGGTGGCAGAGTGGTAAGATGG + Intronic
1112896574 13:104306579-104306601 ATGGGGACGTGGTGAGAAGATGG + Intergenic
1113126535 13:106985333-106985355 AGGGGGTGGTGGTGGGAAGAAGG - Intergenic
1113288294 13:108878243-108878265 ATGGGGTCATGGTGGGCCAAAGG - Intronic
1113314954 13:109169014-109169036 AGGGTGGCAAGGTGGGAGGATGG - Intronic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1113931464 13:113971179-113971201 AAGGGGGTGTTGTGGGAAGAGGG - Intergenic
1114614032 14:24059014-24059036 ATGGGTGAATGATGGGATGAGGG - Intronic
1114624187 14:24117907-24117929 ATGGTGGAATGGTTGAAAGACGG + Intronic
1115378249 14:32703159-32703181 TTGGAGGCAGAGTGGGAAGAAGG + Intronic
1116330575 14:43592489-43592511 GTGGGGGGAGGGTGGGAAGTGGG - Intergenic
1116680330 14:47960804-47960826 ATGGGGAGATCATGGGAAGAAGG - Intergenic
1116868685 14:50051837-50051859 AAGGGGGCAAGGTGCCAAGATGG - Intergenic
1117114176 14:52492784-52492806 AAGGGGGAATGGTGAGAAGGTGG - Intronic
1117732708 14:58739911-58739933 AGGAGAGGATGGTGGGAAGAAGG + Intergenic
1118916798 14:70114587-70114609 ATGGGGGCAGGGAGGAGAGATGG - Intronic
1119431207 14:74569149-74569171 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1119471697 14:74904427-74904449 TTCGGGCCATGGTGGGAAGAGGG - Exonic
1121515709 14:94548528-94548550 CTGGAGCCATGGTGGGCAGAGGG + Intergenic
1121604862 14:95233316-95233338 ATGGGTGGATGGAGGGATGATGG - Intronic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122672641 14:103384462-103384484 ATGGGTGCAGGGTCCGAAGAGGG - Intergenic
1122877480 14:104675523-104675545 ATGGATGGATGGTGGGTAGATGG + Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1124683178 15:31755122-31755144 ATGAAGGGAAGGTGGGAAGAGGG + Intronic
1124864343 15:33474234-33474256 ATGGATGGATGGTGGGCAGATGG + Intronic
1124884928 15:33676583-33676605 ATGGGGTCAGTGTGGGAACAAGG + Intronic
1125194811 15:37034055-37034077 AAAGGGGCATGTTGTGAAGAAGG + Intronic
1126326469 15:47483124-47483146 TTGGGGGCATGGAGGGAATTTGG + Intronic
1126418986 15:48451496-48451518 ATGAGACCTTGGTGGGAAGAGGG - Intronic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1126691168 15:51289932-51289954 ACAGAGGCATGGTGGGAAGTTGG - Intronic
1126692319 15:51297283-51297305 ATGGGGGCATGTGGAGATGAGGG - Intronic
1126695361 15:51321286-51321308 CTAGGGGCATGGTGGGTGGATGG - Intronic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127679724 15:61281666-61281688 AAGGGTGGATGGTGGGAGGATGG + Intergenic
1127972802 15:63974995-63975017 TTCAGGCCATGGTGGGAAGAGGG - Intronic
1128784806 15:70386958-70386980 AGGGGGGCGTGGAAGGAAGAAGG + Intergenic
1128793522 15:70449539-70449561 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
1128793748 15:70450360-70450382 ATGGGTGGATGGAGGGATGAAGG + Intergenic
1129039908 15:72676807-72676829 ATGGGGAGGTGGTGGGAAGGAGG + Intronic
1129430563 15:75498386-75498408 ATGGGGAGGTGGTGGGAAGGAGG + Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1129889054 15:79059084-79059106 ATGGAGGGAGGGTTGGAAGAGGG - Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130117345 15:81016568-81016590 ATGGGGTCATCCTGGGAAGAGGG + Intronic
1130723325 15:86411594-86411616 ATGGGAGCATGTTTGCAAGAAGG - Intronic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1132242218 15:100266597-100266619 ATGGGGGCACAGTGAGAAGCGGG - Intronic
1132243196 15:100276228-100276250 GTGGGTGCCTGGTGGGAAGGTGG + Intronic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133148228 16:3806755-3806777 AGGGGGCCTTGGAGGGAAGATGG - Intronic
1133326840 16:4947113-4947135 ATGGAGGAATGGAGGGATGAAGG - Intronic
1133696251 16:8265826-8265848 AAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1134219903 16:12345721-12345743 ATGTGGGCACAGTGGGAAGGTGG + Intronic
1134224838 16:12381747-12381769 ATGGGTGCATGGATGGATGATGG - Intronic
1134320347 16:13157145-13157167 ATGGGGGGATGGACGGATGATGG - Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1134754716 16:16656674-16656696 ATGGTGGCATGGTGGCATGGTGG - Intergenic
1134855834 16:17518296-17518318 TTGGGGAAAGGGTGGGAAGAGGG - Intergenic
1134991344 16:18702368-18702390 ATGGTGGCATGGTGGCATGGTGG + Intergenic
1135981713 16:27152812-27152834 ATGGGGGCATAGTGGGGATTTGG - Intergenic
1136285578 16:29238501-29238523 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1136553324 16:30993272-30993294 ATGGGGGCTGGGCTGGAAGAGGG + Intronic
1136578251 16:31136933-31136955 ATGGGGGGATGGGGTGCAGAGGG + Intergenic
1136957762 16:34804308-34804330 GTGGGTGCATGGTGGGAACTGGG + Intergenic
1137012225 16:35333282-35333304 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137016583 16:35382067-35382089 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137018958 16:35403720-35403742 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137042875 16:35629559-35629581 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137561654 16:49506303-49506325 ATGGGGGAATGGATGGTAGACGG + Intronic
1137669677 16:50271932-50271954 AAGGGAGGATGGTGAGAAGAGGG - Intronic
1137679967 16:50332981-50333003 AAGGGGGCAGGGAGGGAAGGGGG + Intronic
1138544093 16:57705970-57705992 ATGGGAGGATGGTGGGAGGATGG - Intronic
1138544102 16:57705997-57706019 ATGGGAGGATGGTGGGAGGATGG - Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139297123 16:65910633-65910655 AAGGTGGCAGGGTGGAAAGAGGG + Intergenic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1139939041 16:70591602-70591624 ACAGGGGCAGGGTGGGAGGACGG - Intronic
1140183098 16:72740215-72740237 ATGAGGCCAAGATGGGAAGATGG + Intergenic
1140802696 16:78503214-78503236 CTGAGAGCATGATGGGAAGATGG + Intronic
1140934256 16:79656105-79656127 ATGGGGGCTTGATGGGATAAAGG + Intergenic
1140961455 16:79916857-79916879 ATGCGGACAGGGTGGGATGAAGG + Intergenic
1141088100 16:81110886-81110908 ATGGGAACATGGTGGGCAGTAGG + Intergenic
1141096804 16:81168600-81168622 ATGGGTGGATGGTGGGTGGATGG + Intergenic
1141358336 16:83370609-83370631 AAGGGTGGAGGGTGGGAAGAGGG - Intronic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141483713 16:84324848-84324870 ATGGATGGATGGTGGGTAGATGG - Intronic
1142090911 16:88208653-88208675 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1142262104 16:89047905-89047927 TTGGGGGCCTGGTGGGGTGATGG + Intergenic
1142341052 16:89522849-89522871 AGGAGGGCATGGTGGGGAAAAGG - Intronic
1143301459 17:5913692-5913714 ATGGGTGGATGGATGGAAGATGG - Intronic
1143315988 17:6033831-6033853 GTGGGAGCATGTTGGGAAGTAGG + Intronic
1143375263 17:6463440-6463462 AGGGAGGCAGGGAGGGAAGAAGG + Intronic
1143459087 17:7089063-7089085 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1143469004 17:7159811-7159833 ATAGGGTGATGGTGGGGAGAGGG - Intergenic
1143543123 17:7581286-7581308 ATGGGGGGATGCTGGGGAGTAGG - Intronic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1143698292 17:8637191-8637213 GTGGGAGCAGGGTGGGAGGAGGG + Intergenic
1143817483 17:9529022-9529044 ACAGGGACATGGAGGGAAGAGGG + Intronic
1144116860 17:12103284-12103306 AGGGGGCCAAGGTGGGAGGATGG - Intronic
1144124957 17:12194631-12194653 ATGGGGAAAGGGTGGGAAGCAGG + Intergenic
1144688677 17:17244333-17244355 AGGAGGGCACAGTGGGAAGATGG + Intergenic
1145208488 17:20996869-20996891 ATGGGGACAATGTGGAAAGAGGG - Intergenic
1145279636 17:21458027-21458049 AAGGGAGCATGGAGGGGAGATGG + Intergenic
1145374916 17:22338296-22338318 ATGGAAGCCTGGTGGGGAGAGGG + Intergenic
1145374923 17:22338315-22338337 AGGGGTGGATGGTGGGAACATGG + Intergenic
1145398242 17:22512455-22512477 AAGGGAGCATGGAGGGGAGATGG - Intergenic
1146166626 17:30594668-30594690 ATAGGGTAATGGTGGGTAGAGGG + Intergenic
1146750463 17:35373824-35373846 ACGGAGGAAGGGTGGGAAGAAGG - Intergenic
1146759513 17:35464410-35464432 AGGGGGGGAGGGTGGGAGGAGGG - Intronic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147388863 17:40097264-40097286 AGTGGGGGATGGTGGGAAGTAGG + Exonic
1147969297 17:44211027-44211049 AAGGGGGCAAGGTGGGCAGAGGG - Exonic
1148105244 17:45115293-45115315 AGGGGGGGAAGGTGGGAGGACGG - Intronic
1148160811 17:45449275-45449297 ATGGGTGGACGGTGGGTAGATGG - Intronic
1148382504 17:47210062-47210084 GTGAGGGCAGGGTGGGAAGGAGG + Intronic
1148455842 17:47810998-47811020 ATAGGGGCCTCATGGGAAGAAGG - Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148737813 17:49874632-49874654 CAGGGGCCATGGTGGGAAGGGGG - Intergenic
1148806442 17:50266416-50266438 ATGGGGGAATGGTGAGCAGGGGG - Intergenic
1150219333 17:63487250-63487272 ATCGGGGCATGGTATGAAGTAGG - Intronic
1150392097 17:64796145-64796167 ATGGGTGGATGGTGGGTAGATGG - Intergenic
1150626091 17:66842089-66842111 GTGAGGGCATGGTGGGCAGTGGG - Intronic
1150875624 17:68967169-68967191 AAGGGGGAAAGGTGGGAAGGGGG - Intergenic
1150883654 17:69059706-69059728 ATGGGGGCAGGGTTGGGGGAAGG + Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151751982 17:76044438-76044460 AAGGGGCCATGGAGTGAAGACGG + Intronic
1151888369 17:76937561-76937583 ATGGATGGATGGTGGGTAGATGG + Intronic
1152473753 17:80504248-80504270 ATGGGTGGATGGAGGGATGATGG + Intergenic
1152565578 17:81098965-81098987 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152565583 17:81098973-81098995 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152565588 17:81098981-81099003 ATGGGGGGATGGGGGGATGGGGG - Intronic
1152962905 18:90438-90460 ATAGGGTAATGGTGGGCAGAGGG + Intergenic
1153556691 18:6322420-6322442 ATGGAGGCAGGGAGGGAGGAAGG + Intronic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1156699510 18:39808763-39808785 AGGGGGGGAGGGTGGGAGGAAGG - Intergenic
1157367708 18:47081071-47081093 ATGGAGGGAAGGAGGGAAGAAGG - Intronic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157470103 18:47982463-47982485 ATGGGGGGATAGTGGGATGGGGG + Intergenic
1157504970 18:48219675-48219697 ATGGTGGCAAGGTGGGCAGGTGG + Intronic
1157777140 18:50404415-50404437 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1157949958 18:52025013-52025035 ATGGGGCTAAGGTGGGAGGAAGG + Intergenic
1158314651 18:56197934-56197956 ATGGGTGGAAGGTGGCAAGAGGG + Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159881082 18:73859122-73859144 AGGGGGGCATGCAGGGAAGAAGG + Intergenic
1160064873 18:75565250-75565272 GTGGGGGCATGGGGGGAATCAGG + Intergenic
1160297316 18:77650364-77650386 ATGGGTGGAGGGTGGGAGGAAGG - Intergenic
1160660785 19:297752-297774 ATAGGGGCAAGGTGAGAAAATGG + Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160804244 19:984787-984809 ATGGGGGCAGTGGGGGAAAATGG + Intronic
1161161818 19:2765836-2765858 AGGAGGGCGTGGGGGGAAGATGG + Intronic
1161191367 19:2958807-2958829 ATGGGGCCATGGGAAGAAGATGG - Intergenic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161328999 19:3677705-3677727 ATGGAGGGATGGTGGGATGGAGG + Intronic
1161329396 19:3678992-3679014 ATGGAGGGATGGTGGGATGGAGG + Intronic
1161447973 19:4328624-4328646 GTGGGAGGAGGGTGGGAAGAGGG - Intronic
1161936110 19:7373090-7373112 AGGGGTGCATTGTGGGAAGCAGG - Intronic
1162203318 19:9037031-9037053 ATGGCTGCATGGATGGAAGAAGG + Intergenic
1162824828 19:13244985-13245007 AGGAGGGCATTGTGGGGAGATGG - Intronic
1162865321 19:13541630-13541652 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
1163234710 19:16023635-16023657 AGGGGGCCATGGTGGAAACAGGG + Intergenic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163609888 19:18295329-18295351 ATGGATGGATGGTGGGTAGATGG - Intergenic
1163674087 19:18646709-18646731 ATGCGGGCATGGCGGGCAGAAGG - Intronic
1163827233 19:19530434-19530456 ATGGGGGCTCTGTGGGCAGAGGG - Intronic
1163919739 19:20277326-20277348 ATAGGGTAATGGTGGGAAGAGGG - Intergenic
1163920757 19:20286460-20286482 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1164229824 19:23277254-23277276 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1164575029 19:29400888-29400910 ATGTGGGCATGGTGGGGACAGGG + Intergenic
1164575273 19:29402104-29402126 GAGGGGTCATGGTGGGAGGAAGG - Intergenic
1165026773 19:32968196-32968218 AGGGGGGCAGGGTGGAAACATGG - Intronic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165317004 19:35062186-35062208 ATGGTGGCAGGGTGGGAGGTGGG + Intronic
1165328833 19:35130101-35130123 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1165652301 19:37501964-37501986 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1165894893 19:39135790-39135812 ATGGGGTCACTGTGGGAAGATGG - Intronic
1166209524 19:41297271-41297293 TTGGGGCCATGGTGGGAATTTGG + Intronic
1166596331 19:44053334-44053356 ATAGGGTAATGGTGGGGAGAGGG + Intronic
1166659866 19:44639795-44639817 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
1166909483 19:46141713-46141735 TTGGAAGCAGGGTGGGAAGATGG - Intergenic
1167213458 19:48148512-48148534 GTGGGGACATGGTGTGCAGAGGG + Intronic
1167336877 19:48891829-48891851 ATAGGGTGATGGTGGGGAGAGGG + Intronic
1167722273 19:51186712-51186734 ATGGGCGCGGGGTGGGGAGAGGG + Intergenic
1167814670 19:51869448-51869470 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1167819087 19:51909734-51909756 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1167820315 19:51921890-51921912 ATAGGGTAATGGTGGGAAGAGGG - Intronic
1167820747 19:51925638-51925660 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1167824335 19:51958530-51958552 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1167824555 19:51960467-51960489 ATAGGGTGATGGTGGGGAGAGGG + Intergenic
1167827078 19:51983699-51983721 ATAGGGTAATGGTGGGGAGAGGG - Intronic
1167933064 19:52884088-52884110 ATTGGGACATGGCAGGAAGATGG + Intronic
1168183379 19:54679282-54679304 AGGGGGGAAGGGTGGGAGGAGGG + Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
1168655621 19:58125513-58125535 ATGGAGGCACGGAGTGAAGAAGG - Intergenic
925368417 2:3326446-3326468 AGGTGGGCATGGTGGGAGCAGGG - Intronic
925449079 2:3953024-3953046 AGGGGGGGATAGTTGGAAGAAGG - Intergenic
925943349 2:8839720-8839742 AGGGGGGGATGGGAGGAAGAGGG - Intergenic
926120750 2:10240068-10240090 ATGGGGGAATGGTTAGAAGGAGG + Intergenic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926245818 2:11121897-11121919 TTGGGGTCAGGGTGGGAAGTGGG - Intergenic
926663164 2:15491172-15491194 ATGGAGGAAGGGTGGGAGGAAGG - Intronic
926774913 2:16412521-16412543 GTGGGGGCTTGGTGGGGAGTTGG - Intergenic
926980448 2:18561761-18561783 ATGGGTGGAGGGTGGGAAGTGGG - Intronic
927220393 2:20702774-20702796 ATGGAGGCAGGATGGGAGGAAGG - Intronic
927486142 2:23489650-23489672 ATGGGGGCATGGTGGTGGCAAGG + Intronic
928122088 2:28590818-28590840 AGAGGTGCATGGTTGGAAGAGGG + Intronic
928204676 2:29275461-29275483 ATGGTCGCATGGTGGGGACAAGG - Exonic
928737447 2:34308662-34308684 ATGGAGGCAGGGTGGGAGAAAGG - Intergenic
931044234 2:58332216-58332238 ATGGTGGCAATGTGTGAAGAAGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931477105 2:62599686-62599708 GTTGGGGCATGGTGGGGTGAGGG - Intergenic
932020288 2:68077771-68077793 AGGAGGACATGGTGGGAAGGTGG - Intronic
932361810 2:71115149-71115171 GTGGGGCCAAGGTGGGAGGATGG + Intronic
932401387 2:71483124-71483146 ATGGGTGCATGGTGTGGGGAGGG + Intronic
932409530 2:71537248-71537270 CGGGGGGCGTGGTGGGAGGATGG + Intronic
932759503 2:74430147-74430169 ATGGGGGCAGGGTGGAGAGGAGG - Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933688718 2:85162888-85162910 AGCGGGGAATGGTGGGAAAAAGG - Intronic
934463371 2:94235820-94235842 ATGAGGCCGAGGTGGGAAGATGG - Intergenic
934733223 2:96672598-96672620 TTGGGGGCATAGTGGGCAGCTGG + Intergenic
935101326 2:99998482-99998504 ATGGGGGAGAGGTGGGCAGAGGG + Intronic
935223055 2:101031422-101031444 ATAGGAGCAAGGCGGGAAGAAGG - Intronic
935326914 2:101945920-101945942 ATGGGGGTAGGGTGGGGAGCTGG - Intergenic
935436742 2:103043840-103043862 TTGGGGACATGGGGGGAAGAGGG + Intergenic
935626249 2:105174492-105174514 ATGGGGGCTGGGAGGGAAGGAGG + Intergenic
936275049 2:111088631-111088653 TAGGGTGCAGGGTGGGAAGAGGG + Intronic
936666085 2:114597265-114597287 ATAGGGGAATGGTGGGAATAAGG + Intronic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
936693346 2:114918794-114918816 AAGGGTGCAGGGTGGGAGGAGGG + Intronic
937227680 2:120379092-120379114 GTGGGGGCACAGTGGGGAGAAGG - Intergenic
937392706 2:121504787-121504809 ATCTGGGCTTGGTGGAAAGATGG - Intronic
938339221 2:130524185-130524207 AAGGGAGCAGGGTGGGAAGTGGG - Intronic
938350616 2:130596565-130596587 AAGGGAGCAGGGTGGGAAGTGGG + Intronic
939035566 2:137126913-137126935 ATGGGGGAATGGTGGGTAAGTGG + Intronic
939403389 2:141724703-141724725 ATGGTGACAAGGTGGGGAGAAGG + Intronic
939875027 2:147568223-147568245 ATGGAGGGATGGAGGGATGAAGG + Intergenic
939875044 2:147568279-147568301 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
940589118 2:155697842-155697864 GAGGGTGAATGGTGGGAAGAGGG - Intergenic
940639382 2:156331442-156331464 ATGGTCACAAGGTGGGAAGAGGG + Intronic
941541396 2:166790142-166790164 GAGGGGGGAAGGTGGGAAGAGGG - Intergenic
941650196 2:168084172-168084194 AGGTGGGCATGGTGGGGGGAAGG + Intronic
941670984 2:168292076-168292098 ACCGGGGCCTGTTGGGAAGAGGG - Intergenic
941677118 2:168355720-168355742 CTGGGTGCAGGGTGAGAAGATGG - Intergenic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
943884404 2:193196610-193196632 AAGGGTGGAGGGTGGGAAGAGGG + Intergenic
944148982 2:196537298-196537320 ATGGGGACAGGGTGGGAGGTGGG + Intronic
944210479 2:197201820-197201842 AAGGGGGCAGGATGGGAGGAGGG - Intronic
945464497 2:210152119-210152141 AAGGGTGCAGGGTGGGAGGAGGG - Intronic
946156184 2:217808225-217808247 ATGGGGGAATGGGGGAATGAGGG - Intronic
946429157 2:219615403-219615425 ATGAGGGCAGGGTGGGAAATGGG + Intronic
946622820 2:221577059-221577081 TTGGGGACTTGGGGGGAAGATGG - Intergenic
946659135 2:221980491-221980513 ATGGGGGCAGGGAATGAAGATGG + Intergenic
946785051 2:223234944-223234966 AGGGGGGAAAGGTGGGGAGAAGG - Intergenic
946975808 2:225148907-225148929 ATGGGGTCAGAGGGGGAAGAGGG - Intergenic
947212695 2:227722436-227722458 ATGGGGTAATGGTGGGGAGAGGG + Intergenic
947582901 2:231332704-231332726 AGGGGGGCCTGGTGGGATGCTGG + Intronic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
1168984538 20:2036765-2036787 ATGGGTGGATGGTGGGTAGATGG + Intergenic
1169109603 20:3023650-3023672 ATAGGGTAATGGTGGGCAGAGGG - Intronic
1169691860 20:8341084-8341106 AGGGGGGCATGGTGGAACAAGGG - Intronic
1169847085 20:10005617-10005639 ATGGTGCCAAGTTGGGAAGAAGG - Intronic
1170135213 20:13066061-13066083 CTGGGGGCATGGTGAAAATAGGG - Intronic
1170195500 20:13685046-13685068 ATGGGGGAAGGGTGAGAAGATGG - Intergenic
1170365323 20:15591826-15591848 AAGGGGCCAGGGTGGGAGGAAGG - Intronic
1171041181 20:21765150-21765172 AGGGGGAAATGGTGGGAAGTGGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171779097 20:29402529-29402551 GAGGGGGGAAGGTGGGAAGAGGG + Intergenic
1172341218 20:34159346-34159368 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1172537963 20:35688791-35688813 AGGGAGGCAGGGAGGGAAGAAGG + Intronic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1172619029 20:36307408-36307430 ATGGAGGGATGGAGGGATGAAGG - Intronic
1172664063 20:36587055-36587077 TTGGGGAGATGGTAGGAAGAAGG - Intronic
1172780795 20:37436085-37436107 ATGGGGACATGGATGGATGATGG - Intergenic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1173529721 20:43760054-43760076 CTGGGATCATGGTGGGATGAGGG + Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173575954 20:44113093-44113115 AGTGGGGCAGGGTGGGAGGAAGG + Exonic
1173823630 20:46033710-46033732 ATGGGTGAATGGTTGGATGATGG - Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174164718 20:48576643-48576665 AGGGTGGCAGGGTGGGAAGCCGG - Intergenic
1174187609 20:48717781-48717803 AGGGGGGTAAAGTGGGAAGAGGG + Intronic
1174433847 20:50491255-50491277 ATGGGGGAGGGGTGGGGAGAGGG - Intergenic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1174882248 20:54292655-54292677 ATGGGGGCAGGGAGGGATGGAGG + Intergenic
1174910789 20:54605484-54605506 TTGGGGAGGTGGTGGGAAGAGGG - Intronic
1175062811 20:56259192-56259214 GTGGAGGGGTGGTGGGAAGATGG - Intergenic
1175203956 20:57296947-57296969 ACGGGGGCAGGGTGGGAGGGGGG + Intergenic
1175222775 20:57426868-57426890 GTGAGAGCATAGTGGGAAGAGGG - Intergenic
1175587681 20:60157834-60157856 AAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1175799041 20:61790594-61790616 ATGGGTGGATGGTGGGTGGATGG - Intronic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1176720277 21:10387153-10387175 AAGGGTGCATGTTGGGAGGAGGG - Intergenic
1177733852 21:25063820-25063842 ATGGGGTCATGGGGAGAAGTTGG - Intergenic
1177813618 21:25951240-25951262 ATGGAGTCATGCTGAGAAGAAGG - Intronic
1177858208 21:26423050-26423072 AGGGGGTCATGGTGGAAAAAAGG + Intergenic
1179628664 21:42663605-42663627 ATGACCGCAGGGTGGGAAGACGG - Intronic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1179905412 21:44420249-44420271 ATGGGGACAGGGTGGGTGGAGGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181006298 22:20015270-20015292 ATGGGGGTAGGGTGGGGACAGGG + Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181151712 22:20888564-20888586 ATGGGAGCACGTGGGGAAGAGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181387998 22:22558631-22558653 GTGGGGGCAGGGTGGAAAAAGGG + Intronic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181488530 22:23246935-23246957 GTGGGTGCATGGTGGTAAGAAGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181954047 22:26575325-26575347 AGGGAGGCATTGTGGGAAGAGGG - Intronic
1182017752 22:27055076-27055098 TTGGGGACATTGTGGGTAGAGGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1183145018 22:35982366-35982388 ATGGGGAGATGGGGGGAGGAGGG - Intronic
1183226152 22:36551283-36551305 ATGGGGGGATGGATGGATGACGG - Intergenic
1183505008 22:38203809-38203831 ATGGCAGGATGGTGGGTAGAAGG + Intronic
1183785590 22:40027450-40027472 ACGGGTGCAGGGTGGGAGGAGGG - Intronic
1183786456 22:40031682-40031704 AAGTTGGCATAGTGGGAAGAGGG + Exonic
1184039645 22:41935270-41935292 ATGCGGGCATGGGGGGGAGGGGG + Intergenic
1184103360 22:42353366-42353388 TTGGGGGAAGGGTGAGAAGAGGG + Intergenic
1184293397 22:43509689-43509711 ATGGAGGGATGGAGGGATGAAGG - Intergenic
1184392387 22:44211983-44212005 ATGAGGGCATCTTGGGCAGAGGG - Intronic
1184971012 22:48019810-48019832 ATGAGGCCAAGGTGGGAAGGTGG + Intergenic
1185053544 22:48566209-48566231 ATGGGTGGATGGTAGGTAGATGG + Intronic
1185053550 22:48566235-48566257 ATGGGTGGATGGTAGGTAGATGG + Intronic
1185195079 22:49464351-49464373 CTGGGGGCAGGGTGGGGAGTGGG - Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949765740 3:7523814-7523836 ATGCGGGGATGGGGAGAAGAAGG + Intronic
950143325 3:10630307-10630329 GTGGGTGGAAGGTGGGAAGAGGG - Intronic
950202947 3:11057639-11057661 ATGGAGGCATGGTAGGTAGGTGG + Intergenic
950762415 3:15243789-15243811 GTGGGGGGAGGGTGGGAGGAGGG + Intronic
950916084 3:16646637-16646659 ATGGGGCCAAGAGGGGAAGAGGG + Intronic
950924152 3:16723383-16723405 ATGAGGGCATAGTGAGAAGGTGG + Intergenic
951129422 3:19024111-19024133 ATGGGGGATTGGTGGTAAAATGG + Intergenic
951487417 3:23229438-23229460 AGGGGGAAAGGGTGGGAAGAGGG - Intronic
953068088 3:39493153-39493175 AAGGAGGAAGGGTGGGAAGAAGG + Intronic
953124837 3:40081815-40081837 ATGGGGGCATGGGGAGATGTTGG - Intronic
953557508 3:43958459-43958481 ACGTGGGAAGGGTGGGAAGACGG - Intergenic
953780538 3:45866131-45866153 GTGGTGGCGTGGTGGGAGGAAGG + Intronic
954499293 3:50995749-50995771 GTAGGGGCATAATGGGAAGAAGG + Intronic
954910186 3:54099060-54099082 ATGGGGGGATGGGGAGAAGCCGG - Intergenic
955103986 3:55878396-55878418 ATGGGGAGATGGTGGGAGGAAGG - Intronic
955363548 3:58293093-58293115 GGGGTGGCATGGTGGGGAGAAGG - Intronic
956036223 3:65095162-65095184 AGGGTATCATGGTGGGAAGAGGG + Intergenic
956305606 3:67821086-67821108 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
956770665 3:72523230-72523252 TTGGGGGCTGGGTGGGAAGCAGG - Intergenic
956859843 3:73311875-73311897 AAGGGTGGAGGGTGGGAAGAGGG - Intergenic
957086046 3:75678138-75678160 AGGGGGGGAAGGTGGGAGGAGGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
959368258 3:105490902-105490924 ATTGGGGCACTGTGAGAAGAGGG - Intronic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
959847373 3:111049576-111049598 ATGGGGGCATGGGGGCAAACTGG + Intergenic
959943407 3:112103210-112103232 AAGGGCGGAGGGTGGGAAGAGGG + Intronic
959956119 3:112239585-112239607 TTGGGGGCATGGTTCCAAGATGG - Intronic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960050687 3:113236514-113236536 AGGGTGGGAGGGTGGGAAGAGGG + Intronic
960510148 3:118540074-118540096 ATAGGGCAATGGTGGGGAGAGGG + Intergenic
960672198 3:120164944-120164966 GTGGTGGCATGCTGGGAGGAAGG + Intronic
961511517 3:127406644-127406666 GTGGGGGAATGTTGGGCAGAGGG + Intergenic
961723027 3:128908618-128908640 AGGGGAGCATGAGGGGAAGAAGG - Intronic
962817434 3:139014945-139014967 ATGGGGACATGTTGGTCAGAGGG - Intronic
963009697 3:140757702-140757724 ATGGGGGCAGCATGGGCAGATGG + Intergenic
963239909 3:142992625-142992647 ATGGGGGCATGGTGGGGCCAAGG + Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964259243 3:154816027-154816049 ATGGGGGTATGTTGGGCAAAGGG + Intergenic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
964314316 3:155427147-155427169 AGGGGGGCAGGATAGGAAGAGGG - Intronic
964924432 3:161938382-161938404 ATGGGGCCATGTTTGGAAAATGG + Intergenic
965874548 3:173300416-173300438 ATGGGTGGATGGAGGTAAGAGGG + Intergenic
966772999 3:183520577-183520599 ATAGGGTAATGGTGGGGAGAGGG + Intronic
967044304 3:185722543-185722565 ATGGTGGGAAGGTGGGAAGGTGG + Intronic
967154291 3:186678399-186678421 ATAGGGGGAGGGTGGGAAGCAGG - Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968106815 3:196007134-196007156 ATGGGGGCATGCTGGGGAGGGGG - Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968237491 3:197043445-197043467 ATGGGGGCATGGTGGTCATGAGG - Exonic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968375201 4:34376-34398 ATGGGGGGAGGGTGGGAGGAGGG - Intergenic
968543250 4:1178933-1178955 ATGGAGGCATGTGGGCAAGAGGG - Intronic
968598745 4:1499190-1499212 ATGGAGGCTTGGTGGGCGGATGG + Intergenic
968626536 4:1628651-1628673 AGGGTGGCATGGTGGGAGGGTGG + Intronic
968647958 4:1749348-1749370 GAGGGGGCATGGTGGGGAGGGGG - Intergenic
968649336 4:1754200-1754222 CTGGGGGCATGTGGGGAGGAGGG + Intergenic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969493342 4:7512363-7512385 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
969510396 4:7614379-7614401 ATGGGTGGATGGTGGAAAGGTGG - Intronic
969860588 4:10032547-10032569 ATGGGGGGATGGTGACAAGGTGG + Intronic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
973096870 4:46213263-46213285 GTGAGGACATGGTGAGAAGATGG + Intergenic
973589361 4:52425067-52425089 ATGGGGGCCTGCTGGGGAGTGGG - Intergenic
974276827 4:59731361-59731383 AGGGGGAAAGGGTGGGAAGAGGG + Intergenic
974475600 4:62375175-62375197 ATGGTGGCTAGGAGGGAAGATGG + Intergenic
974960058 4:68687334-68687356 CTGGGGGCATGGGGGTAAGCAGG + Intergenic
975162780 4:71143096-71143118 ATGGTTGCATGGTGGGGGGATGG - Intergenic
976904892 4:90225313-90225335 AGGAGGCCATGGTGGGCAGAAGG - Intronic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
977896192 4:102368200-102368222 GTGGAGCCAGGGTGGGAAGAGGG + Intronic
977957874 4:103051334-103051356 ATAGGGACAAGGTGAGAAGAGGG - Intronic
979189692 4:117840984-117841006 ATGGGTGCATGTTTGGAGGAGGG - Intergenic
981224959 4:142283276-142283298 TTGGGGACATGGTGGGCAGCAGG + Intronic
981455790 4:144952052-144952074 ACGGGTGCATGTGGGGAAGAGGG - Intergenic
981749039 4:148075919-148075941 ATGGGCACATGGTAGGAAGTGGG + Intergenic
982054684 4:151536444-151536466 ATGGGGGCAGGGAGGGCAGGAGG - Intronic
982131331 4:152231222-152231244 ATGGGGGCAAGGAGGAAAGCAGG - Intergenic
982963611 4:161873512-161873534 ATGGAGGGAGGGTGGGAGGAAGG - Intronic
982983485 4:162172215-162172237 AGGGGGAAATGGTGGGAAGGGGG - Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983565570 4:169147471-169147493 ATGGGGGCAGGGTGGGGGAATGG + Intronic
983929134 4:173434120-173434142 ATGGGGCCAGGGTGGGAAGGTGG + Intergenic
984508698 4:180653356-180653378 GTGGGTGGAGGGTGGGAAGAGGG + Intergenic
984863627 4:184261621-184261643 TTGGGTGGATGGTGGGAAGGGGG + Intergenic
985089438 4:186348416-186348438 AGGGGGGGCAGGTGGGAAGAGGG - Intergenic
985459842 4:190094668-190094690 ATGGGGGGAGGGTGGGAGGAGGG + Intergenic
985571921 5:651581-651603 ATAGGGGGATGGTGAGAAGGGGG + Intronic
985625066 5:981600-981622 GAGGGGGCAGAGTGGGAAGAAGG + Intergenic
985648953 5:1098553-1098575 AAGGGGGCTTGGTGAGCAGAGGG - Intronic
985958042 5:3278986-3279008 ATGGAGGGATGGTGGGAGGGAGG - Intergenic
985976179 5:3420419-3420441 ATGGGGACATGGGGGGATGGTGG + Intergenic
986264810 5:6182461-6182483 ATGGCGGCATGGTCGGAGGCTGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986620899 5:9673141-9673163 AAGGGTGGATGGTGGGAGGAGGG + Intronic
986677139 5:10195998-10196020 GTGAGGACATGGTGAGAAGACGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987317044 5:16733559-16733581 AGGAAGGCCTGGTGGGAAGAGGG + Intronic
987322482 5:16783564-16783586 ATGGTAGAAAGGTGGGAAGAGGG + Intronic
987576778 5:19738734-19738756 ATGGGCAGAGGGTGGGAAGAGGG + Intronic
988703550 5:33700530-33700552 ATGAGGGCATGGTAGGGAGGTGG + Intronic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989011644 5:36877658-36877680 ATGGGGTCACAGGGGGAAGAAGG - Intronic
989304559 5:39938391-39938413 GTGGTGGCATGGTGGGAAGAGGG - Intergenic
990964300 5:61428608-61428630 AGGGGGTCAAGGTGGGAGGATGG - Intronic
991003218 5:61803619-61803641 ATGGGGAATTGGTGGGAACACGG - Intergenic
991146826 5:63316785-63316807 ATGGGGGAAGAGTGGGAGGAGGG + Intergenic
991410836 5:66343918-66343940 ATGAAGCCATGGTGGGAAAAAGG - Intergenic
991591029 5:68251574-68251596 GTGGGGGCGGGGTGGAAAGAGGG + Intronic
992166362 5:74055925-74055947 CTGGGGGCATGGGGGAAGGAGGG - Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992733233 5:79692784-79692806 ATGGATGAATGGTGGGCAGAAGG - Intronic
992862800 5:80929272-80929294 ATGGGGCCATGCTTGGAAAAGGG - Intergenic
993821026 5:92617181-92617203 ATGGGTAGAAGGTGGGAAGAAGG - Intergenic
993975654 5:94476468-94476490 AAGGCTGCATGGTGGGAACAGGG + Intronic
994305522 5:98199269-98199291 ATGGGGGCAGGGTGGGGGGCAGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
996021385 5:118594468-118594490 ATGGAGGAAACGTGGGAAGAGGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996920078 5:128757798-128757820 ATGGGATTATGGTGGCAAGATGG - Intronic
997376873 5:133403678-133403700 ATGGAGGTATGAGGGGAAGATGG + Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998153232 5:139769173-139769195 GAAGGAGCATGGTGGGAAGAGGG + Intergenic
998402045 5:141853208-141853230 CTGGGGCCATGGTGGGATGGGGG - Exonic
998495040 5:142581343-142581365 ATGGCAGCATGCTGGGAATAAGG - Intergenic
998535885 5:142930349-142930371 ATGGGCTGATGGTGGGAAGTGGG + Intronic
998589975 5:143466802-143466824 AGGGCAGCAGGGTGGGAAGAGGG - Intergenic
998629051 5:143878304-143878326 ATTGGGGTGTGGTGGGGAGATGG - Intergenic
999299486 5:150482335-150482357 ATGGGATCAGGGTGGGGAGATGG - Intergenic
999419065 5:151425299-151425321 ATGTGGGCATCTTGGTAAGAGGG - Intergenic
999491613 5:152056723-152056745 CTTGGGGCAAGGTGGCAAGATGG + Intergenic
999672981 5:153973917-153973939 ATGAGGACATGGAAGGAAGAGGG - Intergenic
999989245 5:157034226-157034248 ATAGGGTAATGGTGGGGAGAGGG + Intronic
1000834648 5:166138825-166138847 AGGAGGTCAAGGTGGGAAGATGG - Intergenic
1001190956 5:169630762-169630784 AAGGGGAAATGGTGGGAAGAGGG - Intergenic
1001332669 5:170773212-170773234 ATGGGGGCACGGATGGGAGAAGG + Intronic
1001498244 5:172205922-172205944 ATGGGGGCAGGGAGAAAAGATGG + Intergenic
1001640720 5:173242422-173242444 AAGGTGGCAAAGTGGGAAGATGG + Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002272271 5:178080332-178080354 ATGCGGGCAGGGGAGGAAGAAGG - Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002832381 6:834432-834454 AAGGGAGGAAGGTGGGAAGAAGG - Intergenic
1003683211 6:8276142-8276164 ATGGGTATATGGCGGGAAGAGGG + Intergenic
1003772337 6:9319297-9319319 ATGGAGGCCTGGGGGGAAGTGGG + Intergenic
1003867034 6:10372608-10372630 ATGAGTGCATGGTTGGAAAAGGG + Intergenic
1004176520 6:13344806-13344828 AAGGTGGGATGGTGGCAAGATGG - Intergenic
1004314002 6:14570581-14570603 CTGGCTCCATGGTGGGAAGAGGG + Intergenic
1005730042 6:28688105-28688127 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1006289292 6:33122162-33122184 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1006651549 6:35555852-35555874 ATGGTGGCGTCGTGGGAAGATGG - Intergenic
1007091274 6:39186208-39186230 ATGGGGCCATGATGGATAGACGG + Intergenic
1007208614 6:40172974-40172996 GTGGGGGGATGGTGGTGAGAGGG - Intergenic
1007379077 6:41475190-41475212 ATGGGGTCATGGGGAAAAGAAGG - Intergenic
1007395161 6:41573539-41573561 ATGGGGGCTGGGCTGGAAGAGGG + Intronic
1007408358 6:41647583-41647605 ATCGGGGGAGGGTGGGAAGCAGG - Intronic
1007691308 6:43703166-43703188 ATGGGGGCACGTTGGGATGAGGG + Intergenic
1007761324 6:44135223-44135245 ATGTGGGCATGGGGGCATGAGGG + Intronic
1008291686 6:49723552-49723574 ATCAGGCCATGGTGGGAAGTGGG + Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1009428681 6:63542269-63542291 AGGGGGAAAGGGTGGGAAGAGGG + Intronic
1010819872 6:80401062-80401084 AAGGGTGAAGGGTGGGAAGAGGG + Intergenic
1010878413 6:81138188-81138210 AGTGGGGCATGATGGGAAGTGGG - Intergenic
1011093005 6:83628000-83628022 AGGGGGAAAGGGTGGGAAGAGGG - Intronic
1011196756 6:84788478-84788500 ATGGGGAAAGGGTGGGAAGGGGG + Intergenic
1011319487 6:86074952-86074974 AGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1011913366 6:92470065-92470087 ATTGGGGAATGCAGGGAAGATGG + Intergenic
1011914750 6:92489273-92489295 GTGGGGGCATGGGGGGCAGGTGG + Intergenic
1012355330 6:98307546-98307568 AGGGGGGGAGGGTGGGAGGAGGG - Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1012515048 6:100049512-100049534 ATGGATGGATGGAGGGAAGAGGG + Intergenic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014087335 6:117362545-117362567 ATAGCGGCATTGTGGGGAGAGGG - Intronic
1014526266 6:122505382-122505404 AGGGGGACATGTTGGGAAAAGGG - Intronic
1014622688 6:123688582-123688604 GTGGGTGAAGGGTGGGAAGAGGG + Intergenic
1015285265 6:131479398-131479420 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1015395154 6:132725603-132725625 GAGGGGGGATGGTGGGAGGAGGG - Intronic
1015558120 6:134483544-134483566 ATGGTGGCATGGTGGCATGGTGG + Intergenic
1016292171 6:142538036-142538058 GTTGGGGCATGGGCGGAAGATGG - Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1017117753 6:150995153-150995175 ATGGGGGAGGGGTGGGGAGATGG + Intronic
1017831304 6:158132534-158132556 AAGGGTACAAGGTGGGAAGAGGG - Intronic
1018502742 6:164429242-164429264 ATGGGTGCATAGTAGGTAGATGG - Intergenic
1018559606 6:165087976-165087998 ATGGTGCCATGGTGGCAAGGGGG - Intergenic
1018559707 6:165089042-165089064 ATGGGGCCATGGTGGTGAGCAGG - Intergenic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018871929 6:167790267-167790289 ATGGGTGGATGGTGGGGAGATGG - Intronic
1019059047 6:169242688-169242710 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019059075 6:169242770-169242792 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019059120 6:169242903-169242925 GTGGTGGGAAGGTGGGAAGATGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019498486 7:1352523-1352545 CTGGGGGCATGGTGTGGAGCTGG - Intergenic
1019660159 7:2219660-2219682 AAGGGGGCAAGGGGGGCAGAGGG + Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020279779 7:6644274-6644296 GGGGGGGCTTGGTGGGAGGAGGG + Intronic
1020558823 7:9703008-9703030 AGGGGGACAGGGTGGGAGGAGGG + Intergenic
1020607199 7:10354413-10354435 ATGGGGGAGTGGTAGGAAGGTGG - Intergenic
1021572284 7:22078282-22078304 ATGGGGCCGTGGTGGGAAGGAGG + Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022677548 7:32513832-32513854 ATAGGGTGATGGTGGGGAGAGGG + Intronic
1023329241 7:39096603-39096625 ATGGGGGCATAATTTGAAGAAGG + Intronic
1023331262 7:39119481-39119503 ATGGAAGGATGGTTGGAAGAGGG + Intronic
1023712697 7:43011883-43011905 AAGGGTGGATGGTGGGAGGAGGG - Intergenic
1023715728 7:43042354-43042376 AAGGGGCCCTGGTGGGTAGAGGG - Intergenic
1023864924 7:44234025-44234047 GTGGGGTCCTGGTGGGGAGAGGG + Intronic
1024044967 7:45579955-45579977 ATGGGGGCGAGGGGGGAAGGGGG - Intronic
1024954802 7:54906157-54906179 ATTGGGGTGTGGTGGGAACAGGG + Intergenic
1025794323 7:64723828-64723850 AGGGGGAAAGGGTGGGAAGAAGG - Intergenic
1026275122 7:68869949-68869971 ATGGATGGATGGTGGGTAGATGG + Intergenic
1026275161 7:68870078-68870100 ATGGGTGGGTGGTGGGAAGGGGG + Intergenic
1026312159 7:69195825-69195847 AAGGTGGGAGGGTGGGAAGAGGG + Intergenic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1027175390 7:75899858-75899880 ATGGCTGCAGGGTGGGATGAGGG - Intronic
1027899513 7:84092739-84092761 AAGGAGGCATGGAGGGAAGGAGG - Intronic
1028830654 7:95323858-95323880 GTGGGGGCAGGCGGGGAAGAGGG - Intronic
1029058832 7:97776247-97776269 ATCTGGGCATGGTAAGAAGAAGG - Intergenic
1029201430 7:98841863-98841885 CGGGGGGCATGGCGGGCAGAGGG - Intergenic
1029538062 7:101167275-101167297 ATGGGGGCAGGGGAGGAGGAAGG + Intergenic
1030107545 7:105999616-105999638 AAGGAGGGATGATGGGAAGAAGG + Intronic
1030777171 7:113548474-113548496 ATGGGGGCTTGATGGGGAGAGGG + Intergenic
1031779141 7:125940445-125940467 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031945619 7:127836754-127836776 ATGGATGGATGGTGGGTAGATGG - Intronic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032491930 7:132330236-132330258 GTAGGGACATGGTGGGAAGAAGG + Intronic
1033314139 7:140283737-140283759 ATGGGGGTATCTGGGGAAGAGGG - Intergenic
1033423922 7:141226219-141226241 TTGGGGGGAGGGTGTGAAGAAGG + Intronic
1034049201 7:147964165-147964187 ATGAGGACACGGTGGGAAGGTGG + Intronic
1034255244 7:149721216-149721238 ATGGGGCCATGGTGGGTGGAGGG - Intronic
1035334916 7:158121627-158121649 ATTGGAGCATGGAGGGCAGAGGG - Intronic
1035695287 8:1591321-1591343 ATGTGGGCCAGGTGGGAAGGAGG + Intronic
1036636652 8:10555211-10555233 TTCGGGGCATGATGGGAAGAGGG + Intergenic
1036684680 8:10901645-10901667 ATGGGAGCTGGGTGGGAAGAAGG + Intronic
1037240973 8:16777012-16777034 AGGGTGGCAGGGTGGGAAGGAGG + Intergenic
1038027483 8:23605052-23605074 AGGGGGAAATGGTAGGAAGAGGG + Intergenic
1038480222 8:27896702-27896724 TTGGGGCCATGGTGGCAGGAGGG - Intronic
1039436237 8:37561256-37561278 ATGGGGCCTTGATGGGGAGAGGG + Intergenic
1039885422 8:41651440-41651462 GTGGGAGCCTGCTGGGAAGAGGG + Intergenic
1040079440 8:43272445-43272467 AGAGGGGCATGGTGGGATCAAGG - Intergenic
1040392290 8:46960618-46960640 ATGGGGAAAGGGTGGGAAGGGGG - Intergenic
1040435513 8:47387239-47387261 ATGGAGGCCTGGTGGGAGCAGGG + Intronic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1041172389 8:55157665-55157687 GAGGGTGCAGGGTGGGAAGAGGG - Intronic
1042089644 8:65144841-65144863 AAGGGGGCAAGGAAGGAAGAAGG - Intergenic
1042803967 8:72751892-72751914 ATGGAGGCCAGGAGGGAAGAAGG + Intronic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043637721 8:82407367-82407389 ATTTGGGCATGGTGTGATGAGGG + Intergenic
1043877136 8:85498258-85498280 AGGGGGAAAGGGTGGGAAGAGGG + Intergenic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1047317475 8:123747827-123747849 ATGGGGGCAGGTTTGGAAGTGGG + Intergenic
1047588112 8:126296797-126296819 ATGGGGGAGTGGTGGGGTGAGGG - Intergenic
1047870659 8:129078092-129078114 AGTGGGGGAGGGTGGGAAGAGGG + Intergenic
1048045082 8:130765425-130765447 ATGGGGGAAAGATGGGATGAGGG + Intergenic
1048257599 8:132917010-132917032 AGGGAGGCATGGAGGGAGGAAGG - Intronic
1048345647 8:133572453-133572475 TCGGGGGCACGGTGGGGAGAAGG + Intergenic
1048376280 8:133825398-133825420 TTGGTTGGATGGTGGGAAGAAGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1048899646 8:139025021-139025043 ATGGGGACATGGAGGTTAGAGGG + Intergenic
1049232361 8:141491073-141491095 ATGGGGGCTTCTTGTGAAGATGG + Intergenic
1049273031 8:141706167-141706189 ATGGGGAGATGATGGGTAGATGG + Intergenic
1049320549 8:141993919-141993941 ATGGGGACATTTTGGGGAGAAGG - Intergenic
1049359808 8:142207109-142207131 ATGGGTGAATGGGGGAAAGATGG + Intergenic
1049464646 8:142745202-142745224 ATGGGGGCAAGATGGGTGGATGG + Intergenic
1049554165 8:143274028-143274050 GTGGGGGCAGGGTGGGGGGATGG - Intronic
1050636041 9:7614256-7614278 CTGGAGCCATAGTGGGAAGAGGG - Intergenic
1052075962 9:24140914-24140936 ATGGGTGAATGGTAGGATGACGG - Intergenic
1052597012 9:30574537-30574559 CTGGGAGCATGGTGGGAGCATGG - Intergenic
1053442636 9:38128607-38128629 ATGGGGGTATGTTGAAAAGAAGG + Intergenic
1055501517 9:76906462-76906484 AGCGGGGGAAGGTGGGAAGAGGG + Intergenic
1056075258 9:83031854-83031876 ATGGGGGCAGGGATGGAAGGTGG - Intronic
1056303621 9:85268192-85268214 AAGGGGTCAGGGTGGGAGGAGGG - Intergenic
1056567270 9:87785167-87785189 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1056920111 9:90780058-90780080 GTAGGGGTTTGGTGGGAAGAGGG - Intergenic
1057085255 9:92204083-92204105 ATGTGGACATAGTGAGAAGATGG + Intergenic
1057561363 9:96130470-96130492 ATGGGGTCTGGGTAGGAAGACGG + Intergenic
1059326689 9:113507988-113508010 ATGATTGCATGGTGGGATGATGG + Intronic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1060407281 9:123379149-123379171 GTGGGGGCATGGTCAGATGATGG + Intronic
1060975363 9:127762042-127762064 ATGGGGGTGGGGTGGGAGGAGGG - Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061938457 9:133871506-133871528 ATGGATGGATGGTGGGTAGATGG + Intronic
1061954939 9:133956387-133956409 CTGGGGGCCTGGTGGGGAAAGGG + Intronic
1062107519 9:134764014-134764036 CTGGGGGCATTGTGGGGAGTCGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062281248 9:135752711-135752733 GTGGATGCATGGTGGGTAGATGG + Intronic
1062307751 9:135919362-135919384 ATGGGGACAGAGTGGGCAGATGG + Intergenic
1062433351 9:136535552-136535574 ATGGGTGCATGGTGGGTGGAGGG + Intronic
1062433445 9:136535814-136535836 ATGGGTGCAGGGTGGGTGGAGGG + Intronic
1062433503 9:136535974-136535996 ATGGGTGCATGGTGGGTGGGGGG + Intronic
1062486706 9:136780537-136780559 ATAGGGTAATGGTGGGCAGAGGG + Intergenic
1062487770 9:136789017-136789039 ATAGGGTAATGGTGGGGAGAAGG + Intergenic
1062505232 9:136870681-136870703 TTGGGAACATGGTGGGCAGAGGG - Intronic
1062735238 9:138133690-138133712 ATAGGGTAATGGTGGGCAGAGGG - Intergenic
1203574023 Un_KI270744v1:159774-159796 ATGGGGGGAGGGTGGGAGGAGGG + Intergenic
1186002028 X:5023553-5023575 ATGGATGGATGGTGGGTAGATGG - Intergenic
1186303382 X:8226688-8226710 AGGGGGAAATGGTGGGAAGGGGG - Intergenic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186920364 X:14271965-14271987 ATGAGGGCACGGTAGGGAGAAGG + Intergenic
1187431844 X:19232235-19232257 GTGAGGGCACGGTGAGAAGACGG + Intergenic
1188139028 X:26525691-26525713 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1188433131 X:30129552-30129574 TTGGGGACTTGGGGGGAAGAGGG + Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188947288 X:36321386-36321408 GTGGGGCCATGAGGGGAAGAGGG + Intronic
1189263363 X:39694091-39694113 ATGGGGACAGGGTGTGATGAGGG - Intergenic
1189709653 X:43796306-43796328 AAGGGGACATGGTGGGAGGCAGG - Intronic
1190139573 X:47830822-47830844 ATGGGGGGCTGGTGGGGAGGTGG + Intergenic
1190915504 X:54808663-54808685 AGGGGGGCGTGTTAGGAAGAAGG + Intronic
1190943966 X:55072908-55072930 ATCGGAGCTTGGTGGGAGGAGGG - Intergenic
1191046242 X:56140602-56140624 GAGGGTGGATGGTGGGAAGAGGG + Intergenic
1191227971 X:58065548-58065570 ATAGGGTAATGGTGGGGAGAGGG + Intergenic
1192078890 X:68028898-68028920 ATGGAGGCTTAGTGGGAAGGAGG - Intergenic
1192102648 X:68280650-68280672 TTAGGGGCATGATGGTAAGATGG - Intronic
1192129794 X:68538740-68538762 ATGGGAACATGGTGGGAAATTGG + Intergenic
1192231711 X:69269736-69269758 AGGGGAGCAGGGTGGGAGGAGGG + Intergenic
1192488036 X:71547802-71547824 TTGGGGGGAGGGGGGGAAGAAGG - Intronic
1192491380 X:71579399-71579421 ATGGGGGCGTTGAGGGAAGTGGG + Intronic
1193161537 X:78233897-78233919 ATGGTGGCATGGAGGGATGGAGG + Intergenic
1193203611 X:78721672-78721694 AAGGGGGAATGGTGGGAGGCGGG + Intergenic
1193320912 X:80120049-80120071 AGGAGGGCAAGGTGGGAAGCAGG + Intergenic
1193702552 X:84780460-84780482 ATGGGGGCATGGCGGGGCCAAGG + Intergenic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1193964842 X:87972796-87972818 ATAGGGTAATGGTGGGGAGAGGG - Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194527878 X:95001983-95002005 AGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1194701522 X:97119879-97119901 GTGGGGGCATGGTGGGAGTGGGG - Intronic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1195067206 X:101248398-101248420 CTTGGGGCATGGTTGGAACAGGG + Intronic
1195109012 X:101626733-101626755 AGGGGGGCATGGTGTGAGAAAGG + Exonic
1195198333 X:102520706-102520728 ATGGGGTAATGGTAGGTAGAAGG - Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1196031313 X:111097299-111097321 GGTGGGGGATGGTGGGAAGAGGG + Intronic
1196535677 X:116840833-116840855 ATGAAGGCATGGTGGCAGGAGGG + Intergenic
1196554455 X:117070503-117070525 ATGGTGGTGTGGTGGGAGGAGGG - Intergenic
1197239024 X:124103563-124103585 TTGGGGGCAGGGTGGGAAGGGGG - Intronic
1197275432 X:124473732-124473754 ATGGGGGCCTGGAGGGAATGGGG - Intronic
1198028072 X:132728505-132728527 ACGCGGGCATGTTGGCAAGATGG + Intronic
1198316449 X:135471525-135471547 ATATGTTCATGGTGGGAAGAAGG - Intergenic
1199766509 X:150945490-150945512 ATGAAGGCAGGGTGGGAAGTAGG - Intergenic
1199827625 X:151515820-151515842 ATGGGGGAGGGGTGGGAACAGGG - Intergenic
1200036301 X:153334052-153334074 AAGGGGGCGTGGCGGGAAGGGGG - Intergenic
1201346891 Y:12994416-12994438 GGGGGGGCATGTTGGGAAAAAGG - Intergenic
1201901215 Y:19047173-19047195 ATGGAGGGATGGTTGTAAGAGGG + Intergenic
1202018562 Y:20437865-20437887 AGTGGGGGATGGTGGGGAGATGG + Intergenic
1202163345 Y:21958584-21958606 ATGGGGGCCTGGTAGGGAGATGG + Intergenic
1202228011 Y:22627784-22627806 ATGGGGGCCTGGTAGGGAGATGG - Intergenic
1202315146 Y:23568392-23568414 ATGGGGGCCTGGTAGGGAGATGG + Intergenic
1202555655 Y:26102201-26102223 ATGGGGGCCTGGTAGGGAGATGG - Intergenic