ID: 1092223834

View in Genome Browser
Species Human (GRCh38)
Location 12:6733528-6733550
Sequence CACTTCAACCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145283
Summary {0: 6, 1: 484, 2: 9491, 3: 42040, 4: 93262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092223834_1092223839 8 Left 1092223834 12:6733528-6733550 CCTCCGTCTCCTGGGTTGAAGTG 0: 6
1: 484
2: 9491
3: 42040
4: 93262
Right 1092223839 12:6733559-6733581 GCCTCAGCCTCCCGAGTAGCGGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1092223834_1092223838 7 Left 1092223834 12:6733528-6733550 CCTCCGTCTCCTGGGTTGAAGTG 0: 6
1: 484
2: 9491
3: 42040
4: 93262
Right 1092223838 12:6733558-6733580 TGCCTCAGCCTCCCGAGTAGCGG 0: 409
1: 1460
2: 1622
3: 1665
4: 2532
1092223834_1092223841 9 Left 1092223834 12:6733528-6733550 CCTCCGTCTCCTGGGTTGAAGTG 0: 6
1: 484
2: 9491
3: 42040
4: 93262
Right 1092223841 12:6733560-6733582 CCTCAGCCTCCCGAGTAGCGGGG 0: 241
1: 102394
2: 288971
3: 226877
4: 124331
1092223834_1092223843 17 Left 1092223834 12:6733528-6733550 CCTCCGTCTCCTGGGTTGAAGTG 0: 6
1: 484
2: 9491
3: 42040
4: 93262
Right 1092223843 12:6733568-6733590 TCCCGAGTAGCGGGGATTACAGG 0: 121
1: 45308
2: 209287
3: 255544
4: 186118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092223834 Original CRISPR CACTTCAACCCAGGAGACGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr