ID: 1092223873

View in Genome Browser
Species Human (GRCh38)
Location 12:6733778-6733800
Sequence GGTAAGCTTGTTGTCTTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092223869_1092223873 10 Left 1092223869 12:6733745-6733767 CCAGATCCTAGGTTTTTGATTAC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1092223873 12:6733778-6733800 GGTAAGCTTGTTGTCTTGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 81
1092223866_1092223873 23 Left 1092223866 12:6733732-6733754 CCACGACGTCCGGCCAGATCCTA 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1092223873 12:6733778-6733800 GGTAAGCTTGTTGTCTTGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 81
1092223870_1092223873 4 Left 1092223870 12:6733751-6733773 CCTAGGTTTTTGATTACAAATTG 0: 1
1: 0
2: 1
3: 14
4: 292
Right 1092223873 12:6733778-6733800 GGTAAGCTTGTTGTCTTGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 81
1092223868_1092223873 14 Left 1092223868 12:6733741-6733763 CCGGCCAGATCCTAGGTTTTTGA 0: 1
1: 0
2: 1
3: 14
4: 237
Right 1092223873 12:6733778-6733800 GGTAAGCTTGTTGTCTTGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092223873 Original CRISPR GGTAAGCTTGTTGTCTTGAG CGG Intergenic
900514721 1:3076120-3076142 GGGAAGCCTGTTATCCTGAGAGG - Intronic
904997406 1:34641726-34641748 AGTAAGCCTGTAGTTTTGAGTGG - Intergenic
906474831 1:46162189-46162211 GCTAAGCATGGTGGCTTGAGTGG + Intronic
918048775 1:180956550-180956572 GGTGAGCTTGGGGTCTTGGGGGG - Intergenic
921673801 1:217955036-217955058 GCCAAGCTTGTTTGCTTGAGGGG - Intergenic
922495602 1:226055040-226055062 GGAAAGCTTATTGTCTTAATAGG + Intergenic
1069083158 10:64109852-64109874 GTTAAGTTTGTTTTATTGAGAGG + Intergenic
1075193077 10:120329311-120329333 GGTAAGCTTGTTGCTGTGAGAGG - Intergenic
1076325064 10:129614725-129614747 GGCAATCTAGTTGGCTTGAGTGG + Intronic
1077022786 11:426667-426689 CGAAAGCCTGATGTCTTGAGTGG - Intronic
1077139136 11:1015889-1015911 GGTAAGGTTGGTGACTGGAGAGG + Exonic
1078514598 11:12010598-12010620 GGGACGCTTGTTTTCTTGTGTGG + Intergenic
1084611437 11:70205659-70205681 GGTAAGCTGAGGGTCTTGAGAGG - Intronic
1086768997 11:90737286-90737308 CTAAACCTTGTTGTCTTGAGGGG + Intergenic
1087999689 11:104862360-104862382 GGAAAGGTTTTTGTCATGAGTGG + Intergenic
1088937842 11:114421549-114421571 GTTAACCTTGTTTTCTTGTGTGG + Intronic
1092223873 12:6733778-6733800 GGTAAGCTTGTTGTCTTGAGCGG + Intergenic
1093350169 12:18090109-18090131 GTGAAGCTTGCTGTCTTGGGTGG - Exonic
1094806390 12:34097962-34097984 GGTGAACTTGTTATCCTGAGGGG + Intergenic
1096557379 12:52411695-52411717 GGGAAGCTTGAGGGCTTGAGGGG + Intergenic
1097627311 12:62016408-62016430 GTTAAGCTTTTTAACTTGAGGGG - Intronic
1105960164 13:25327026-25327048 AGTAAGCATGTTACCTTGAGGGG - Exonic
1109350261 13:61170984-61171006 GGTTAGCTTGTTTTCTAGACTGG + Intergenic
1109810022 13:67500461-67500483 GTTAAGTTTGTTGTCTTGTATGG - Intergenic
1110781210 13:79467107-79467129 GATAAGATTGTTGTCTTTACAGG - Intergenic
1112004578 13:95243439-95243461 GGGAAGCTTGTGGTCTTGCATGG - Intronic
1112251807 13:97788256-97788278 GCTGAGCTTGTTGCCTTGTGTGG + Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1121565936 14:94908973-94908995 TGCAAGCTTGGTGTCTTGATGGG - Intergenic
1126264741 15:46740873-46740895 GGTAAGCTTTTTGTATTTATAGG + Intergenic
1127459704 15:59187026-59187048 TTTAAGCTTATTGTCTTAAGTGG + Intronic
1128605091 15:69031113-69031135 GTTTATCATGTTGTCTTGAGAGG - Intronic
1131409348 15:92193361-92193383 GTTGATCTTGCTGTCTTGAGTGG - Intergenic
1132033294 15:98456977-98456999 AGAAAGCTTGTTTTCTTTAGAGG - Intronic
1140778512 16:78272884-78272906 GTTAAGGATGTTGTCTTGTGGGG - Intronic
1159355721 18:67335740-67335762 GTAAAGCTTGTAGTCTGGAGTGG - Intergenic
1162793135 19:13073230-13073252 GCTTAGCTTGCTGTCCTGAGGGG + Intronic
1164790646 19:30975809-30975831 GGTAGGTTTGTTGTCTTGCTTGG + Intergenic
1166164164 19:40975222-40975244 AGAAAGCTGGTTTTCTTGAGAGG + Intergenic
1166186674 19:41144153-41144175 AGAAAGCTGGTTTTCTTGAGAGG - Intergenic
930712371 2:54560627-54560649 GGTAAGCTTCGTGTTTTGTGTGG + Intronic
935334253 2:102000590-102000612 GGTAAGCTTGTCTTCTATAGAGG + Intronic
938625846 2:133108235-133108257 GGAATGCCTGTTGTCTTGACAGG - Intronic
1175210726 20:57352396-57352418 GATGAGCTTGTTGTGTTCAGCGG + Intronic
1183188888 22:36308942-36308964 GGTAGGCTGGTTGCTTTGAGTGG - Intronic
949947527 3:9202382-9202404 GGAAAGCTTGGTGTCTGGATAGG - Intronic
953784746 3:45902714-45902736 TGTAGGCTTGTTCTGTTGAGTGG + Exonic
955948324 3:64216909-64216931 GGCAAGCTTCTAGTCTTGACAGG + Intronic
961512404 3:127411117-127411139 AGTAAGGTTGTCATCTTGAGAGG - Intergenic
962627982 3:137246258-137246280 GAGGAGCTTGTTGCCTTGAGGGG + Intergenic
978181306 4:105799604-105799626 ATTAAGTTTGTTGTCTTAAGTGG + Intronic
981955689 4:150470315-150470337 GGTAAGTCAGATGTCTTGAGAGG - Intronic
984007760 4:174334018-174334040 AATAAGCTTTTTGTCTTGTGTGG - Intergenic
989480991 5:41929853-41929875 GTTGAGCTTGATGTCTTCAGAGG + Exonic
990252739 5:53933138-53933160 GGTAGGGTTGTTGTTTTGTGGGG - Intronic
991464769 5:66899220-66899242 GGTTGGCTTGTTTTCTTGGGTGG + Intronic
994140430 5:96335106-96335128 AGTAAGCTTGTAGTCTGAAGAGG - Intergenic
994853801 5:105090883-105090905 GGGAAACTTGTTGCCTTGAAGGG + Intergenic
995929807 5:117426252-117426274 TGTAATCTTGTTGCCTTGGGAGG - Intergenic
996515955 5:124369389-124369411 TGGAAGCTTGCTGTATTGAGAGG - Intergenic
997790933 5:136761429-136761451 GGTCAAATTGTTGTCTTGGGAGG + Intergenic
999751464 5:154631125-154631147 GACAAACTTGTTGTCTTGACCGG + Intergenic
1000250404 5:159489324-159489346 GATAAGCTTGTTGACTTAATTGG - Intergenic
1002112018 5:176922869-176922891 GATAAGCCTGTTCTCTTAAGAGG - Intronic
1003266646 6:4570869-4570891 GCTGAGATTCTTGTCTTGAGAGG - Intergenic
1003972333 6:11311389-11311411 GGTAGGGTTGGTGGCTTGAGAGG - Intronic
1005188222 6:23186755-23186777 GGTAGGCTTGGTGTCATGAGAGG - Intergenic
1012033342 6:94100852-94100874 GAAAAGCTGGTTGTTTTGAGTGG + Intergenic
1020102398 7:5401567-5401589 GAAAAGCTTGCTGTCTTCAGTGG - Intronic
1020424911 7:8053919-8053941 TGTAGGCTTTTTGTCTTCAGGGG + Intronic
1022668459 7:32432530-32432552 GGTCAGCCTGTTCTCTGGAGGGG - Intergenic
1032876844 7:136047021-136047043 GGCAGGCTTGTTGTCTGGCGAGG + Intergenic
1033259578 7:139831209-139831231 GGTGAGCTGGATGTCTAGAGAGG + Intronic
1044058215 8:87599286-87599308 GCTAAGCCTGATGTCTTCAGCGG - Intronic
1046814446 8:118568743-118568765 GGAAAGCTTATTGACTTGGGGGG + Intronic
1052037132 9:23695406-23695428 CGTATGCTTGGTGTCCTGAGTGG - Intronic
1059709556 9:116855058-116855080 GGTAAGCTGGTTTTATTGTGTGG - Intronic
1186847376 X:13544116-13544138 GGCCAGCTTGTTCTCTGGAGTGG + Intergenic
1189738200 X:44092662-44092684 GGAAGGCTTGTTGTCTGGATGGG - Intergenic
1190887164 X:54540242-54540264 GGTAAGCTTTTTGCCTTGGTGGG + Exonic
1192717660 X:73660866-73660888 GGTGGGCTTTATGTCTTGAGAGG + Intronic
1194177597 X:90670071-90670093 GCTAAGCTTGTATTCCTGAGAGG - Intergenic
1197558940 X:127993021-127993043 GGGAAACTTGGTGTCTTGAAGGG + Intergenic
1200524267 Y:4252220-4252242 GCTAAGCTTGTATTCCTGAGAGG - Intergenic