ID: 1092226604

View in Genome Browser
Species Human (GRCh38)
Location 12:6752373-6752395
Sequence ATGGAAGCTCAGATACTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092226598_1092226604 15 Left 1092226598 12:6752335-6752357 CCTGATCTCAGCTCCAGGGGGCT 0: 1
1: 0
2: 3
3: 27
4: 242
Right 1092226604 12:6752373-6752395 ATGGAAGCTCAGATACTTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 364
1092226600_1092226604 2 Left 1092226600 12:6752348-6752370 CCAGGGGGCTCCACACTGGAAAG 0: 1
1: 0
2: 1
3: 19
4: 191
Right 1092226604 12:6752373-6752395 ATGGAAGCTCAGATACTTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 364
1092226602_1092226604 -8 Left 1092226602 12:6752358-6752380 CCACACTGGAAAGATATGGAAGC 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1092226604 12:6752373-6752395 ATGGAAGCTCAGATACTTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092226604 Original CRISPR ATGGAAGCTCAGATACTTGG AGG Intronic
900640590 1:3686373-3686395 ATGGAGGCTCAGAGAATTGTGGG - Intronic
901132209 1:6969094-6969116 ATGGCAGCTGAGATACATAGGGG + Intronic
901214154 1:7545286-7545308 ATAGATGCTAAAATACTTGGGGG - Intronic
902829228 1:18999147-18999169 CTGTAATCTCAGCTACTTGGAGG + Intergenic
903332797 1:22604739-22604761 TTAGAAGCTCAGAGACTAGGTGG + Intergenic
903950024 1:26991348-26991370 ATGGGAACTCAGAGAGTTGGAGG - Intergenic
904002841 1:27348583-27348605 CTGGAATCTCAGCTACTGGGAGG + Intronic
904145012 1:28383147-28383169 ATCAAAGATCAGATACTTGTAGG + Intronic
904346162 1:29871359-29871381 ATGTAAGCTCAAATCCTTGCTGG - Intergenic
905134590 1:35788660-35788682 CTGTAATCCCAGATACTTGGGGG + Intergenic
905907472 1:41628479-41628501 ATGGAAACTGAGGTACTGGGAGG + Intronic
907097612 1:51796000-51796022 CTGTAATCTCAGCTACTTGGGGG - Intronic
907567281 1:55447102-55447124 CTGTAATCTCAGCTACTTGGAGG + Intergenic
907949240 1:59165026-59165048 AGGGAACCTCAGATGTTTGGGGG - Intergenic
908026632 1:59958758-59958780 ATAGAAGATCAGATTCTTGACGG - Intergenic
908465001 1:64384997-64385019 ATGTAATCCCAGCTACTTGGGGG - Intergenic
908581624 1:65523431-65523453 CTGTAATCTCAGCTACTTGGGGG - Intronic
909230345 1:73081287-73081309 GTTGAAGATCAGATACTTGCAGG - Intergenic
909621059 1:77667885-77667907 ATGTAATCCCAGCTACTTGGAGG - Intronic
910964675 1:92796522-92796544 CTGTAGTCTCAGATACTTGGGGG - Intergenic
911646437 1:100342099-100342121 TTGTAATCCCAGATACTTGGAGG - Intergenic
911833741 1:102589034-102589056 CTGGAAGCTCAGATAATTGTTGG - Intergenic
913001777 1:114587757-114587779 ATGGAAACTCAGATGTTTGCAGG - Exonic
916164746 1:161956014-161956036 ATGTAAGCTCAGATGCTTTGAGG - Intronic
916228322 1:162513062-162513084 CTGTAATCTCAGCTACTTGGGGG - Intronic
917354521 1:174112234-174112256 CTGTAATCTCAGCTACTTGGTGG - Intergenic
918341971 1:183575345-183575367 CTGTAATCTCAGCTACTTGGAGG + Intronic
919268496 1:195306097-195306119 ATGAAAGATGAGAAACTTGGAGG + Intergenic
919455067 1:197811394-197811416 CTGTAATCTCAGCTACTTGGGGG + Intergenic
920541271 1:206779943-206779965 ATGTAAGCCCAGCCACTTGGAGG - Intergenic
921661697 1:217810497-217810519 CTGTAATCTCAGCTACTTGGGGG + Intronic
922159171 1:223065917-223065939 CTGTAATCTCAGCTACTTGGGGG - Intergenic
924771416 1:247083821-247083843 GTGGAAGATCAGATAGTTGTAGG - Intergenic
1063617440 10:7613120-7613142 CTGTAATCTCAGCTACTTGGGGG + Intronic
1063733907 10:8730774-8730796 CTGAAAGGTGAGATACTTGGTGG + Intergenic
1064318651 10:14281113-14281135 CTGTAATCTCAGCTACTTGGGGG - Intronic
1064370478 10:14748347-14748369 AGGAAAGTTCAGATACTAGGTGG - Intronic
1065137129 10:22682674-22682696 ATGGAAGAACAGATACTCTGAGG - Intronic
1065736638 10:28759073-28759095 CTGGAGTCTCAGCTACTTGGGGG + Intergenic
1066197537 10:33115722-33115744 ATGGAAGCTTAGATTGTTGAGGG - Intergenic
1066660612 10:37735692-37735714 CTGTAATCCCAGATACTTGGAGG + Intergenic
1068800480 10:61134823-61134845 ATTCCAGCTCAGTTACTTGGGGG - Intergenic
1071095887 10:81974198-81974220 ATTGAAGATCAGATAGTTGTAGG + Intronic
1073019738 10:100432987-100433009 CTGTAATCTCAGCTACTTGGGGG + Intergenic
1074159160 10:110822827-110822849 ATGGAAACTCAGATCCGTGCAGG - Intronic
1074268865 10:111932939-111932961 AAGGAACCTCAGATCCTTTGTGG + Intergenic
1074321197 10:112404387-112404409 ATAGAAGCTCAAATCCTTGTTGG + Intronic
1078080628 11:8202199-8202221 ATGGAAGCTCAGAAAAGAGGAGG + Intergenic
1079221994 11:18571222-18571244 CTGTAATCCCAGATACTTGGGGG + Intronic
1080103385 11:28485558-28485580 TTGGAAACTCAGATACATGCTGG + Intergenic
1080317143 11:30963048-30963070 TTGGTATCTCAGATATTTGGTGG + Intronic
1081017774 11:37905548-37905570 ATTGAAGCTTAGATAATTAGTGG + Intergenic
1081392123 11:42541510-42541532 ATGGAGACTCAGAGACTTTGAGG - Intergenic
1082916000 11:58438031-58438053 ATGGAAGAGCAGATTTTTGGAGG - Intergenic
1083207610 11:61161836-61161858 ATGGAAGCCCAGAACCTAGGAGG + Intergenic
1083451918 11:62752026-62752048 ATGGCAGCTCAGAAGGTTGGTGG - Exonic
1086344706 11:85884217-85884239 AAGGAAGCTCACAGACATGGAGG + Intronic
1086834202 11:91600969-91600991 CTGGATGGTCAGAGACTTGGAGG + Intergenic
1088303607 11:108385192-108385214 CTGTAATCTCAGATACTCGGAGG - Intronic
1089192550 11:116663494-116663516 ATGGATTATCAGATACTTGAGGG + Intergenic
1090741295 11:129663295-129663317 ATCGAAGATCAGATAATTGTAGG - Intergenic
1091163765 11:133451718-133451740 CTGTAATCTCAGCTACTTGGAGG + Intronic
1091206713 11:133826474-133826496 ATGGAGGCTCAGAGACTAGAGGG - Intergenic
1091383289 12:76765-76787 CTGGAAGCTCAGGTACGGGGCGG + Intronic
1091783420 12:3228240-3228262 CTGTAATCTCAGCTACTTGGGGG + Intronic
1092219676 12:6704282-6704304 ATGTAGTCCCAGATACTTGGGGG - Intergenic
1092226604 12:6752373-6752395 ATGGAAGCTCAGATACTTGGAGG + Intronic
1092640887 12:10507713-10507735 CTGTAATCTCAGCTACTTGGGGG - Intronic
1092953584 12:13529677-13529699 GTAGATGCTCAGATACTTGTTGG + Intergenic
1095395721 12:41760178-41760200 ATTGAAGATCAGATAATTGTAGG - Intergenic
1096830054 12:54306978-54307000 ATGAAAGCTTAGATACCTGGAGG + Intronic
1096860707 12:54525858-54525880 GTGAAATCTCAGATACTTGGGGG + Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1098921526 12:76306535-76306557 ATGTAATCCCAGCTACTTGGGGG - Intergenic
1099185305 12:79509954-79509976 TTGTAATCTCAGCTACTTGGGGG + Intergenic
1100005154 12:89886337-89886359 ATGAAAGGTCAGATTCTTGGAGG + Intergenic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1102068883 12:110000878-110000900 CTGTAATCTCAGTTACTTGGGGG - Intronic
1102385923 12:112510199-112510221 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1102542033 12:113627903-113627925 AAGGAAGCTGAGGTACTAGGAGG + Intergenic
1102848779 12:116218052-116218074 ATCGAATCTCTTATACTTGGAGG - Intronic
1103750750 12:123158751-123158773 CTGCAATCTCAGCTACTTGGAGG - Intronic
1104501894 12:129293974-129293996 ATGGAATCTCAGTTACTGTGGGG - Intronic
1104512479 12:129393050-129393072 CTAGAAGCTCAGATATTTAGAGG + Intronic
1105258547 13:18761450-18761472 ATGCAAGCTCGAAGACTTGGTGG - Intergenic
1105261215 13:18780751-18780773 ATGCAAGCTCATAGACTTGGTGG - Intergenic
1105752632 13:23435389-23435411 CTGTAATCTCAGATACTTGGAGG + Intergenic
1106195182 13:27487316-27487338 CTGTAATCCCAGATACTTGGGGG + Intergenic
1106266184 13:28112279-28112301 CTGTAACCTCAGCTACTTGGAGG + Intergenic
1106875296 13:34065412-34065434 ATGTAATCTCTGTTACTTGGGGG + Intergenic
1107678566 13:42822548-42822570 AAGGAAGATCAGAGACATGGAGG + Intergenic
1109930535 13:69211008-69211030 GTTGAAGATCAGATAGTTGGAGG + Intergenic
1110151441 13:72259615-72259637 GTGTAAGACCAGATACTTGGAGG + Intergenic
1110272114 13:73602693-73602715 ATTGAAGATCAGATACTTGTAGG - Intergenic
1111299329 13:86326191-86326213 GTTGAAGATCAGATAATTGGAGG - Intergenic
1111888145 13:94049128-94049150 CTGTAATCTCAGCTACTTGGAGG + Intronic
1112060071 13:95730112-95730134 ATGTAGTCTCAGTTACTTGGGGG - Intronic
1112066842 13:95802023-95802045 ATGGGAGCTCACATTCTAGGTGG - Intronic
1112797371 13:103071112-103071134 ATGGAAGATCAGAGACTAGGAGG + Intergenic
1114983825 14:28199900-28199922 CTGGTAGCTCAAATGCTTGGTGG - Intergenic
1115998794 14:39220642-39220664 CTGTAGTCTCAGATACTTGGAGG - Intergenic
1116789778 14:49327986-49328008 CTGGAAGATCAGACACTTGCTGG - Intergenic
1116956520 14:50929170-50929192 ATGTAATCCCAGCTACTTGGGGG - Intronic
1117109705 14:52438471-52438493 TTGAAAGCTCAGATAATTGTTGG + Intronic
1117480186 14:56135483-56135505 ATGGTAGCTCAGAGATTTTGAGG + Intronic
1118196128 14:63628112-63628134 CTGCAATCTCAGCTACTTGGGGG + Intronic
1119416223 14:74471473-74471495 CTGAAATCTCAGCTACTTGGGGG + Intergenic
1119821440 14:77619640-77619662 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1120053312 14:79893685-79893707 CTGTAATCTCAGCTACTTGGGGG - Intergenic
1121084239 14:91133170-91133192 CTGTAATCTCAGCTACTTGGGGG + Intronic
1121965437 14:98299321-98299343 ATGCAACCTCAGAGACATGGAGG + Intergenic
1122102338 14:99422972-99422994 CAGGAAGCTCAGTTACTTGAGGG + Intronic
1124036162 15:26055061-26055083 AAGGAAGTCCAGATGCTTGGGGG + Intergenic
1124582200 15:30967826-30967848 ATTAAAGCTCATGTACTTGGAGG + Intronic
1124647641 15:31450283-31450305 ATGGATGGTCAGGGACTTGGAGG - Intergenic
1126026478 15:44450716-44450738 CTGTAATCTCAGCTACTTGGAGG - Intronic
1126212592 15:46116655-46116677 ATTGAAGATCAGATAGTTGTAGG - Intergenic
1127013094 15:54651427-54651449 ATCCCAGCTCAGCTACTTGGAGG + Intergenic
1127335337 15:57978911-57978933 CTGTAATCCCAGATACTTGGGGG + Intronic
1127599174 15:60518119-60518141 TTGGAATCCCAGCTACTTGGGGG - Intronic
1127946413 15:63758984-63759006 CTGTAATCTCAGCTACTTGGGGG - Intronic
1128169987 15:65503227-65503249 ATATAATCCCAGATACTTGGAGG - Intronic
1129151778 15:73693671-73693693 AAGGAAGATCAAATACTTGCAGG + Intronic
1130200156 15:81818349-81818371 ATGGAAGCTCAGAGAAGTTGTGG - Intergenic
1131499743 15:92950629-92950651 ATGTAGTCTCAGCTACTTGGGGG + Intronic
1131995472 15:98128699-98128721 ATGGAAGCTCAGAGAGGTTGAGG - Intergenic
1135088174 16:19491130-19491152 CTGCAAGCCCAGCTACTTGGGGG - Intronic
1135842426 16:25888821-25888843 AAAGATGCTCAGATGCTTGGAGG + Intronic
1136579968 16:31145505-31145527 CTGTAATCTCAGCTACTTGGGGG + Intronic
1137657339 16:50171432-50171454 ATGGAAGCTGGGAAACATGGTGG + Intronic
1138308679 16:56004369-56004391 ATGGAAGCTGCAATACTTGTGGG + Intergenic
1139757292 16:69154849-69154871 ATGTAATCCCAGCTACTTGGGGG - Intronic
1140446543 16:75033559-75033581 CTGTAATCTCAGCTACTTGGAGG - Intronic
1140514764 16:75533915-75533937 CTGTAATCTCAGCTACTTGGAGG + Intronic
1142990639 17:3728493-3728515 CTGTAATCTCAGCTACTTGGGGG - Intronic
1143702509 17:8671723-8671745 CTGTAATCTCAGCTACTTGGGGG + Intergenic
1144010338 17:11142386-11142408 CTGGTAGCTCAGATGCCTGGAGG - Intergenic
1144094802 17:11890513-11890535 ATTAAAGTTCAAATACTTGGTGG + Intronic
1144450535 17:15374111-15374133 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1145786198 17:27595468-27595490 ATGGAAGCTCAGAGAGGTGGAGG + Intronic
1146249537 17:31326523-31326545 CTGTAATCTCAGCTACTTGGAGG + Intronic
1146304457 17:31720110-31720132 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1146799328 17:35805994-35806016 CTGTAATCTCAGCTACTTGGGGG + Intronic
1146989859 17:37260002-37260024 CTGTAATCTCAGCTACTTGGGGG - Intronic
1147612686 17:41811192-41811214 ATAGTAGTTGAGATACTTGGCGG + Exonic
1150054828 17:62005015-62005037 CTGTAATCCCAGATACTTGGAGG - Intronic
1150082309 17:62251065-62251087 CTGTAATCTCAGCTACTTGGGGG + Intergenic
1150333722 17:64314864-64314886 CTGTAATCTCAGCTACTTGGGGG - Intergenic
1151600721 17:75104572-75104594 CTGTAATCTCAGCTACTTGGGGG - Intronic
1151900702 17:77011587-77011609 CTGTAATCTCAGCTACTTGGGGG + Intergenic
1151987098 17:77550486-77550508 CTGTAATCTCAGCTACTTGGAGG - Intergenic
1152283350 17:79398252-79398274 CTGGACGCTCCCATACTTGGGGG - Intronic
1153349741 18:4066017-4066039 GTAGAAGATCAGATACTTGTAGG - Intronic
1153523644 18:5975466-5975488 ATGGAAGCACAGGTCCTGGGTGG - Intronic
1153945440 18:10013534-10013556 ATGCAAGCTGAGATACTGGAGGG + Intergenic
1154424812 18:14264057-14264079 ATGCAAGCTCATAGACGTGGTGG + Intergenic
1154432500 18:14319280-14319302 ATGCAAGCTCGAAGACTTGGTGG + Intergenic
1155475286 18:26231472-26231494 CTGTAATCTCAGCTACTTGGAGG - Intronic
1155703816 18:28782775-28782797 AGGGAAGCTCAAATATATGGGGG + Intergenic
1156024483 18:32636357-32636379 AGGGAAGCTGAGATTTTTGGGGG + Intergenic
1159390606 18:67788057-67788079 ATGGGCACTCAGATACTTTGGGG - Intergenic
1160003599 18:75051627-75051649 ATGGAATCTCTGAACCTTGGAGG + Intronic
1160078867 18:75704046-75704068 CTGGAGGCACAGAGACTTGGAGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161017871 19:1992213-1992235 CTGGAATCTCAACTACTTGGGGG - Intronic
1161549465 19:4903623-4903645 CTGTAATCTCAGGTACTTGGGGG - Intronic
1161568293 19:5015752-5015774 AAAGACGCTCAGATACTTGTAGG - Intronic
1161847425 19:6719711-6719733 CTGGAAGTCCAGAGACTTGGAGG - Intronic
1162331897 19:10034983-10035005 CTGTAACCTCAGCTACTTGGGGG + Intergenic
1163029158 19:14532421-14532443 CTGTAATCTCAGCTACTTGGAGG + Intronic
1163355592 19:16808425-16808447 TTGTAATCTCAGCTACTTGGGGG + Intronic
1163952929 19:20607515-20607537 AAGGAACCCCAGTTACTTGGAGG - Intronic
1163995131 19:21038548-21038570 CTGTAACCTCAGCTACTTGGGGG - Intronic
1164943995 19:32274981-32275003 ACGGAGGCTCAGAGACTTGTGGG + Intergenic
1165926680 19:39330717-39330739 CTGTAATCTCAGCTACTTGGGGG - Intronic
1167950738 19:53025437-53025459 ATCGAAGATCAGATAGTTGCAGG - Intergenic
1168363661 19:55765763-55765785 CTGTAATCTCAGCTACTTGGGGG - Intergenic
926207842 2:10846775-10846797 ATGGATGCACAGAAAATTGGAGG + Intergenic
926568000 2:14498956-14498978 ATGGAAGCTCTAATATGTGGTGG - Intergenic
926628800 2:15118468-15118490 AGGGCAGCTCAGATACAAGGTGG - Intergenic
926893716 2:17661046-17661068 ATAGAAAATCAGACACTTGGGGG - Intergenic
929472416 2:42208554-42208576 CTGTAATCTCAGCTACTTGGAGG - Intronic
929492167 2:42406702-42406724 CTGTAATCCCAGATACTTGGGGG + Intronic
931565163 2:63608518-63608540 ATGGATGCTCAAATATTTGTTGG + Intronic
931742492 2:65259604-65259626 CTGTAATCTCAGCTACTTGGGGG + Intronic
931934305 2:67178891-67178913 ATGGAAACTAACATACATGGTGG + Intergenic
933127153 2:78622924-78622946 ATGCAAGCTCATATAATAGGAGG + Intergenic
933393107 2:81697486-81697508 TTTGAAGCTCAGATAGTTGTAGG - Intergenic
933472749 2:82747794-82747816 ATTGAAGATCAGATAGTTGCAGG + Intergenic
934900741 2:98157952-98157974 ATAGTACTTCAGATACTTGGGGG + Intronic
935254115 2:101293435-101293457 CTAGAAGCTCAGATTCTTGGAGG - Intronic
936094622 2:109522417-109522439 CTGTAATCCCAGATACTTGGGGG - Intergenic
936655830 2:114485820-114485842 GTGGAAGTTCAGATAATTGTGGG - Intronic
936860851 2:117018705-117018727 AAGGAAGCTGAGATATTTGGGGG + Intergenic
937817293 2:126265436-126265458 ATGGATGATCAGATTTTTGGTGG - Intergenic
939571843 2:143848947-143848969 ATGAAATCTCAGATTTTTGGGGG - Intergenic
940097806 2:149997934-149997956 GTTGAAGATCAGATAGTTGGAGG - Intergenic
940368052 2:152870686-152870708 ATGAAATCTCTGACACTTGGAGG + Intergenic
940648756 2:156419180-156419202 CTGTAATCTCAGCTACTTGGGGG - Intergenic
941974118 2:171384707-171384729 CTGTAATCTCAGCTACTTGGGGG + Intronic
943657035 2:190520845-190520867 AAGGATGTTCAGATCCTTGGTGG - Intronic
943978628 2:194516312-194516334 ATGCAAGATCAGATAGTTGTAGG + Intergenic
945196106 2:207238944-207238966 ATGGAAGCTCAAGTTCTTGGTGG - Intergenic
945932142 2:215865928-215865950 CTGTAATCTCAGCTACTTGGGGG - Intergenic
947423061 2:229958021-229958043 GTGGAACCACAGACACTTGGGGG + Intronic
947442949 2:230139382-230139404 CTGTAAGCCCAGCTACTTGGGGG - Intergenic
947539601 2:230966935-230966957 CTGTAATCTCAGCTACTTGGGGG - Intergenic
948144547 2:235698860-235698882 ATAGAAGCTCAGTTACTCAGAGG + Intronic
948775160 2:240283665-240283687 ATGGAAGTGCAGATACCTAGCGG - Intergenic
1169176431 20:3519519-3519541 ATGAAAGCAAAGAAACTTGGAGG + Intronic
1169435971 20:5590419-5590441 CTGTAATCTCAGCTACTTGGAGG + Intronic
1169494287 20:6099278-6099300 ATGTAATCCCAGCTACTTGGGGG + Intronic
1169782602 20:9325506-9325528 CTGGATGCTCAGATTCTGGGAGG - Intronic
1171259305 20:23717811-23717833 ATGGAAGCTCAGATGAGAGGAGG + Intergenic
1172202643 20:33137670-33137692 ATGAAAAGTCAGATACATGGTGG - Intergenic
1172316960 20:33963296-33963318 CTGTAATCTCAGCTACTTGGGGG - Intergenic
1173372601 20:42451201-42451223 ATGGAAGATCAATGACTTGGTGG + Intronic
1173429300 20:42971929-42971951 TTGGAAGCTCACATACTAGTAGG + Intronic
1175200254 20:57272006-57272028 ATTGAGGCTCAAATACTTGAGGG + Intergenic
1176281889 20:64318021-64318043 CTGGAAGCTCAGGTACGGGGCGG - Intergenic
1176844538 21:13866469-13866491 ATGCAAGCTCGAAGACTTGGTGG - Intergenic
1176847271 21:13886032-13886054 ATGCAAGCTCATAGACTTGGTGG - Intergenic
1176944977 21:14968807-14968829 ATGAAAATTCAGAGACTTGGCGG - Intronic
1177782354 21:25634791-25634813 ATCGAAGGTCAGATACTGGGTGG - Intergenic
1177914112 21:27066824-27066846 ATTGAAGATCAGATGCTTGTAGG - Intergenic
1177971098 21:27790486-27790508 CTGTAATCTCAGCTACTTGGGGG + Intergenic
1182501279 22:30749728-30749750 CTGTAATCTCAGATACTTGGAGG - Intronic
1183875598 22:40777657-40777679 CTGTAATCTCAGCTACTTGGGGG + Intronic
1184469231 22:44686128-44686150 CTGTAATCTCAGCTACTTGGAGG + Intronic
1185285946 22:49999944-49999966 GGGGAAGCTCAGCTACTGGGTGG - Exonic
951622940 3:24625942-24625964 CTGTAATCTCAGCTACTTGGGGG + Intergenic
951934769 3:28010024-28010046 CTGTAATCTCAGCTACTTGGGGG + Intergenic
951973885 3:28481118-28481140 ATTGAAGATCAGATAGTTGTAGG + Intronic
952112056 3:30135419-30135441 ATGGCAGTTCCAATACTTGGTGG - Intergenic
952875352 3:37940300-37940322 ATGTAAGCTCTGATGCTAGGTGG - Intronic
954090571 3:48280508-48280530 CTGTAATCCCAGATACTTGGAGG + Intronic
955226488 3:57064443-57064465 CTGTAATCTCAGCTACTTGGGGG - Intronic
955785265 3:62531326-62531348 ATGAAAACTCTGATACCTGGGGG - Intronic
955806607 3:62742477-62742499 GTGGAAGATCAGATATTTGTAGG - Intronic
956791803 3:72685777-72685799 ATTGAAGCTCAGAGACTTGTTGG - Intergenic
957784176 3:84859815-84859837 CTGTAATCTCAGCTACTTGGAGG + Intergenic
958513553 3:95081492-95081514 ATGGAAGCTTAAAGCCTTGGAGG + Intergenic
958626894 3:96637814-96637836 ATGGAAGATCACATAGTTGAAGG - Intergenic
958749958 3:98183737-98183759 TTGTAATCACAGATACTTGGGGG + Intronic
959471830 3:106761870-106761892 AAGTAATCTCAGTTACTTGGGGG + Intergenic
960389117 3:117055097-117055119 CTGTAATCTCAGGTACTTGGAGG + Intronic
961545014 3:127627193-127627215 CTGGAATCCCAGCTACTTGGGGG - Intergenic
961912901 3:130339116-130339138 ATTGAAGATCAGATAGTTGTAGG + Intergenic
962235452 3:133703052-133703074 ATGGAGGCTAACATACTTGGTGG - Intergenic
962783639 3:138745508-138745530 CTGTAATCTCAGCTACTTGGGGG + Intronic
963869763 3:150402789-150402811 CTGTAATCTCAGCTACTTGGGGG - Intergenic
963962142 3:151321822-151321844 ATGGAAGTTGAGACAATTGGGGG - Intronic
965328777 3:167343197-167343219 ATGCAAGCTCAGAAGCTTGCAGG - Intronic
965805915 3:172541605-172541627 ATGTAATCCCAGCTACTTGGAGG + Intergenic
966170330 3:177072939-177072961 CTGTAATCTCAGCTACTTGGGGG + Intronic
966528365 3:180944743-180944765 CTGTAATCTCAGCTACTTGGGGG - Intronic
967208899 3:187149354-187149376 CTGTAAGCTCAGCTACTCGGAGG + Intronic
968670055 4:1844606-1844628 CTGTAATCTCAGTTACTTGGAGG + Intronic
970936174 4:21572747-21572769 CTGTAATCCCAGATACTTGGGGG - Intronic
971624248 4:28898097-28898119 TTTAAAGCTCAGATAGTTGGAGG - Intergenic
971933165 4:33112488-33112510 ATTGAAGATCAGATAATTGTAGG - Intergenic
972044485 4:34647475-34647497 GTGGAATGTCAGATATTTGGTGG + Intergenic
972162711 4:36245090-36245112 ACGGACGCTTAGATATTTGGAGG - Intergenic
972506237 4:39722916-39722938 CTGTAATCCCAGATACTTGGGGG - Intronic
973156296 4:46957671-46957693 ATGGAGGCTGAGATAGATGGTGG - Intronic
973262555 4:48179509-48179531 CTGGAATCCCAGCTACTTGGGGG - Intronic
973683561 4:53346395-53346417 CTGTAATCTCAGCTACTTGGGGG - Intronic
974078579 4:57190409-57190431 TTGGAAGATCAGATATTTGATGG + Intergenic
974763710 4:66312090-66312112 CTGTAATCTCAGCTACTTGGGGG + Intergenic
975325797 4:73057302-73057324 CTGCAATCCCAGATACTTGGAGG + Exonic
977199163 4:94095337-94095359 GTGGAAGATCAGATAGTTGTAGG + Intergenic
978906485 4:114012059-114012081 ATGGAAGCTAAGAACCTTGATGG - Intergenic
980794453 4:137662830-137662852 ATTGAAGCTCATATTATTGGTGG + Intergenic
982593216 4:157343340-157343362 ACAGAAGCTCAGATATTTTGGGG + Intronic
982706505 4:158716005-158716027 TTGGAAGCTCAGTTACTTGTAGG - Intronic
982752465 4:159178678-159178700 CTGTAAGCCCAGCTACTTGGGGG - Intronic
983979349 4:173975077-173975099 ATTGAAGCTCAGAGTCTTCGAGG + Intergenic
984298838 4:177889307-177889329 CTGTAATCTCAGCTACTTGGAGG + Intronic
987104253 5:14621841-14621863 ATGGGGCCTCAGTTACTTGGGGG + Intergenic
987759032 5:22134900-22134922 CTGGAAGCTCAGCAGCTTGGTGG - Intronic
988862262 5:35294643-35294665 ATGGGGCCTCAGATGCTTGGGGG + Intergenic
989094037 5:37764620-37764642 CTGTAATCTCAGCTACTTGGGGG + Intergenic
991093011 5:62710930-62710952 CTGTAATCTCAGCTACTTGGAGG - Intergenic
991893742 5:71368347-71368369 CTGGAAGCTCAGCAGCTTGGTGG - Intergenic
994121728 5:96121450-96121472 ATGCAAGCTCAAATACTGGGTGG - Intergenic
994370207 5:98959046-98959068 CTGTAATCTCAGATACTGGGAGG + Intergenic
994711993 5:103276700-103276722 ATGAAATCACAGGTACTTGGGGG + Exonic
995270108 5:110210224-110210246 ATGGAAGATCAGATGATTGTGGG + Intergenic
997227034 5:132216738-132216760 ATGCAAACTCAGTTGCTTGGAGG - Intronic
998728615 5:145047755-145047777 CTGTAAGCCCAGCTACTTGGGGG + Intergenic
998813295 5:145987558-145987580 ATGGGAGGTCAGAGACTTGAGGG - Intronic
999124098 5:149233836-149233858 ATGGGAGCTCAGACACATGGAGG - Intronic
1000186753 5:158866077-158866099 ATGGAAGCTCAGAAAGGTGAAGG + Intronic
1001484248 5:172108491-172108513 CTGTAATCCCAGATACTTGGGGG + Intronic
1002060636 5:176623745-176623767 CTGTAATCCCAGATACTTGGAGG + Intronic
1002498169 5:179629900-179629922 CTGTAATCTCAGCTACTTGGAGG + Intronic
1003545979 6:7058761-7058783 ATGGATTGTCAGAAACTTGGAGG + Intergenic
1003587862 6:7409374-7409396 CTGAAATCTCAGTTACTTGGAGG - Intronic
1003886126 6:10523051-10523073 ATAGCAGCTCAGTTACTAGGCGG - Intronic
1005576946 6:27198582-27198604 CTGTAATCCCAGATACTTGGGGG + Intergenic
1006963329 6:37956406-37956428 AGGAATGCTCAGATCCTTGGAGG + Intronic
1007332629 6:41125230-41125252 CTGTAAACCCAGATACTTGGGGG + Intergenic
1008357835 6:50575848-50575870 CTGTAATCTCAGCTACTTGGAGG - Intergenic
1008396598 6:51015900-51015922 ATGGAAGCACAGATAGATGTGGG - Intergenic
1009468756 6:64005757-64005779 ATTGAAGATCAGATAGTTGTAGG + Intronic
1010218644 6:73428099-73428121 CTGTAATCTCAGCTACTTGGGGG + Intronic
1010547001 6:77171345-77171367 AATGAAGATCAGATACTTGTTGG + Intergenic
1011138128 6:84121520-84121542 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1011625503 6:89280085-89280107 CTGTAATCTCAGCTACTTGGAGG + Intronic
1013081167 6:106814611-106814633 ATTGAAGATCAGATAGTTGTAGG - Intergenic
1014669098 6:124277725-124277747 CTGAAAGCTCAGATTCTTGAAGG + Intronic
1015206172 6:130642082-130642104 ATGGAAGCTCCTTTAATTGGAGG + Intergenic
1015504759 6:133972178-133972200 ATGTAGACTCAAATACTTGGGGG - Intronic
1015777076 6:136824725-136824747 ATGAATGCGGAGATACTTGGTGG - Intronic
1016459348 6:144265884-144265906 ATGAAAGCTGAGATTGTTGGGGG - Intergenic
1019206959 6:170369793-170369815 AGGAGAGCTCAGTTACTTGGGGG + Intronic
1021677043 7:23090715-23090737 ATTGAAGCTGTGACACTTGGTGG + Intergenic
1021780031 7:24095221-24095243 ATGGAAGATCAGATGGTTGTAGG + Intergenic
1022362080 7:29670624-29670646 CTGTAAGCTCAGCCACTTGGGGG + Intergenic
1022735213 7:33069841-33069863 CTGTAATCCCAGATACTTGGGGG - Intergenic
1023335335 7:39163421-39163443 ATGGAGATTCAGAGACTTGGGGG + Intronic
1023405692 7:39831587-39831609 CTGCAATCTCAGCTACTTGGGGG + Intergenic
1024565048 7:50673847-50673869 ATAGGAGCTCAGATAGATGGAGG - Intronic
1026966701 7:74444708-74444730 TTGTAATCTCAGCTACTTGGGGG - Intergenic
1027256464 7:76433819-76433841 CTGTAATCTCAGCTACTTGGGGG - Intronic
1027544791 7:79513771-79513793 ATGGGAGCACTGATACTCGGTGG + Intergenic
1028350278 7:89838447-89838469 CTGTAGTCTCAGATACTTGGGGG - Intergenic
1030174391 7:106636258-106636280 CTGTAAGCCCAGCTACTTGGGGG + Intergenic
1030663444 7:112247843-112247865 CTGTAATCTCAGCTACTTGGGGG + Intronic
1031119884 7:117709402-117709424 CTGCAATCTCAGCTACTTGGAGG + Intronic
1031615170 7:123871311-123871333 GTGTAACCTCAGCTACTTGGAGG - Intronic
1031714335 7:125089049-125089071 GTGGAAGATCAGATAGTTGTAGG + Intergenic
1031765974 7:125777930-125777952 ATGTAATCCCAGCTACTTGGAGG + Intergenic
1032372725 7:131375054-131375076 CTGTAACCTCAGCTACTTGGAGG - Intronic
1032849414 7:135781612-135781634 ATAGATGCTAAGATACTTGGGGG + Intergenic
1033784907 7:144718349-144718371 ATGGAAGCTCAGAAACCAGCAGG - Intronic
1034043461 7:147903565-147903587 ATGGAAGCCCTTACACTTGGTGG + Exonic
1034776572 7:153832941-153832963 ATGGAAGCTCAGATGTGGGGTGG + Intergenic
1034904616 7:154933223-154933245 ACGGAGGCACAGATTCTTGGAGG + Intronic
1039279080 8:35962925-35962947 ATGGAAGATCAGATAGTTGCAGG + Intergenic
1039880721 8:41623958-41623980 CTGTAATCTCAGCTACTTGGAGG - Exonic
1040935045 8:52773696-52773718 CTGTAATCTCAGCTACTTGGGGG + Intergenic
1041706010 8:60846957-60846979 TTGGTATCTCAGAAACTTGGTGG + Intronic
1041935800 8:63330519-63330541 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1042131184 8:65588081-65588103 CTGTAATCTCAGCTACTTGGTGG - Intergenic
1042545109 8:69944397-69944419 CTGTAATCTCAGCTACTTGGGGG - Intergenic
1042632914 8:70840275-70840297 ATGGAAACTCAGGTAATTTGAGG + Intergenic
1043027923 8:75094273-75094295 GTCGAAGATCAGATACTTGTAGG + Intergenic
1046032887 8:108804645-108804667 CTGTAAGCCCAGCTACTTGGGGG - Intergenic
1046795330 8:118365288-118365310 AGGGATGCCCAGATAGTTGGTGG + Intronic
1047680280 8:127247700-127247722 ATGGAAACTCAGATACTCCTGGG - Intergenic
1048723677 8:137357654-137357676 CTGTAATCTCAGCTACTTGGGGG + Intergenic
1048763662 8:137824304-137824326 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1049978181 9:880106-880128 ACTGAAACTCAGATATTTGGCGG - Intronic
1050136569 9:2472074-2472096 ATAGAAGCTCAAATACTTTTTGG - Intergenic
1051295172 9:15587672-15587694 CTTGAAGCTCAGATTCTAGGTGG + Intronic
1051874729 9:21779527-21779549 CTGCAATCTCAGCTACTTGGAGG + Intergenic
1051899259 9:22021165-22021187 GTTGAAGATCAGATAGTTGGAGG + Intronic
1053101548 9:35375856-35375878 ATGTAATCCCAGCTACTTGGGGG + Intronic
1053597543 9:39578079-39578101 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1053673134 9:40390759-40390781 CTGTAATCTCAGCTACTTGGGGG - Intergenic
1053855558 9:42335050-42335072 CTGTAATCTCAGCTACTTGGAGG + Intergenic
1054511491 9:65985524-65985546 CTGTAATCTCAGCTACTTGGGGG + Intergenic
1054568722 9:66786921-66786943 CTGTAATCTCAGCTACTTGGAGG - Intergenic
1054762072 9:69012870-69012892 CAGGAAGCCCAGATATTTGGAGG - Exonic
1055313146 9:75005767-75005789 ATAGAAGATCATATACTTGCCGG - Intronic
1055930181 9:81552076-81552098 ATGGGAGCTCAGATCCTTCTAGG + Intergenic
1055954331 9:81760435-81760457 CTGTAATCTCAGCTACTTGGAGG - Intergenic
1056024756 9:82482351-82482373 ATGGAAGCTCAACTACTAAGAGG + Intergenic
1056054926 9:82811658-82811680 ATTGAAGATCAGATAGTTAGAGG - Intergenic
1057601653 9:96463375-96463397 CTGTAATCTCAGCTACTTGGGGG - Intronic
1062422377 9:136489130-136489152 CTAGAATCTCAGCTACTTGGGGG - Intergenic
1185461768 X:336043-336065 CTGGAAGCCCAGCTACTCGGGGG + Intronic
1189448689 X:41106650-41106672 CTGTAATCTCAGCTACTTGGAGG - Intronic
1190435849 X:50424286-50424308 ATGGAAGCTTAGATATTTTCTGG - Exonic
1190810258 X:53876369-53876391 GTGGAAGATCAGATAGTTGTAGG + Intergenic
1190828699 X:54042177-54042199 CTGTAATCTCAGCTACTTGGAGG + Intronic
1191875738 X:65794225-65794247 ATGGAAGCTCAGCTTCTAGTTGG + Intergenic
1194248258 X:91541002-91541024 ATGAAATCCCAGCTACTTGGGGG - Intergenic
1194504344 X:94714298-94714320 ATGTAATCCCAGCTACTTGGGGG + Intergenic
1194990421 X:100541458-100541480 ATTGAAGATCAGATAGTTGTAGG + Intergenic
1195912625 X:109903909-109903931 CTGTAATCTCAGCTACTTGGGGG - Intergenic
1196231415 X:113227159-113227181 GTGGAAGATCAGATAGTTGTAGG + Intergenic
1196934402 X:120715315-120715337 ATCCAAGCTCACCTACTTGGTGG + Intergenic
1197440670 X:126485368-126485390 AGGGTAGCTCAGAACCTTGGAGG - Intergenic
1200139450 X:153891763-153891785 TTGTAATCTCAGCTACTTGGGGG - Intronic
1200249573 X:154545710-154545732 CTGTAATCTCAGCTACTTGGGGG + Intronic
1200329835 X:155284222-155284244 AAAGAGGCTGAGATACTTGGGGG - Intronic