ID: 1092228363

View in Genome Browser
Species Human (GRCh38)
Location 12:6763738-6763760
Sequence GGTTAGCCTCAGAGCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092228363_1092228369 -5 Left 1092228363 12:6763738-6763760 CCCCAGAGGCTCTGAGGCTAACC 0: 1
1: 0
2: 2
3: 13
4: 191
Right 1092228369 12:6763756-6763778 TAACCCCTAGGACTGTCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1092228363_1092228367 -9 Left 1092228363 12:6763738-6763760 CCCCAGAGGCTCTGAGGCTAACC 0: 1
1: 0
2: 2
3: 13
4: 191
Right 1092228367 12:6763752-6763774 AGGCTAACCCCTAGGACTGTCGG 0: 1
1: 0
2: 0
3: 5
4: 69
1092228363_1092228368 -8 Left 1092228363 12:6763738-6763760 CCCCAGAGGCTCTGAGGCTAACC 0: 1
1: 0
2: 2
3: 13
4: 191
Right 1092228368 12:6763753-6763775 GGCTAACCCCTAGGACTGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092228363 Original CRISPR GGTTAGCCTCAGAGCCTCTG GGG (reversed) Intronic
905348883 1:37330774-37330796 AGTGAGCCTCTGAGCCTATGAGG + Intergenic
905423640 1:37865712-37865734 GGTTAGCCCCAGACCCCATGGGG - Intronic
910507515 1:87966861-87966883 GGTCATCCTCAGTGTCTCTGAGG - Intergenic
910757134 1:90706071-90706093 GGTTTCCCCCAAAGCCTCTGGGG - Intergenic
912168017 1:107062856-107062878 CCTTATCCTCAGAGCTTCTGCGG - Intergenic
912540242 1:110409393-110409415 GGTAAGCCTCACCCCCTCTGTGG + Intergenic
913144650 1:115976912-115976934 GGCCGGCCTCAGAGCCTCTTGGG + Intronic
921327753 1:214004279-214004301 GGTTAGCCTCACATTCTCTTGGG + Intronic
922438824 1:225633827-225633849 GGTTAGCCTCAGAGATGCTCTGG + Intronic
923340426 1:233002047-233002069 GGTTAGCATCATCGTCTCTGGGG - Intronic
924591642 1:245409768-245409790 GGCCAGCCTCAGAGTCTCAGAGG + Intronic
1063193346 10:3718169-3718191 GGTTCGCCTCACTTCCTCTGGGG - Intergenic
1064034308 10:11902787-11902809 GGACAGCCTCATGGCCTCTGAGG - Intergenic
1064523925 10:16233176-16233198 GGTTTGCCTCAGAGGCTCTGTGG + Intergenic
1064523926 10:16233182-16233204 GTTTCACCACAGAGCCTCTGAGG - Intergenic
1066381684 10:34907117-34907139 GGTTTGCCTCTGAGCCTTAGAGG - Intergenic
1067138305 10:43631686-43631708 GTTTGGTCTCAGAGCCTCTTTGG + Intergenic
1067350929 10:45474892-45474914 TGTTAGCCTCAAGGCCTGTGAGG - Intronic
1067906208 10:50294200-50294222 TGTTAGTCTCAGGGCCTGTGTGG - Intergenic
1068946403 10:62733843-62733865 GCTCAGCCTCAGAGCTTCTCAGG + Intergenic
1072287015 10:93925949-93925971 GGTTAGCATCAAAGCCCCTCTGG - Intronic
1072435875 10:95414517-95414539 GGTCAGGCTCCGAGACTCTGCGG + Exonic
1072832338 10:98671916-98671938 GGTTAGCCTCACAAGCTTTGAGG - Intronic
1073804457 10:107082225-107082247 TTTTCACCTCAGAGCCTCTGAGG - Intronic
1074354030 10:112765829-112765851 GGTTAGACACAGAAACTCTGGGG - Intronic
1076182956 10:128424878-128424900 GGTGAGTCTCAGAGCCTCGCTGG + Intergenic
1076643318 10:131933758-131933780 GGTTAGCCTCAGGACACCTGAGG + Intronic
1076726634 10:132416949-132416971 GGTGAGCCTCAGGCCCTCCGGGG + Intronic
1077112537 11:868213-868235 TGTTAGCGTCAGCACCTCTGGGG + Exonic
1077494990 11:2882646-2882668 GGGCAGCCTCGAAGCCTCTGAGG - Intergenic
1077836673 11:5932541-5932563 GGTAAGCTTAAGAGCCTCTTTGG - Intronic
1081666538 11:44920078-44920100 GGGTAGCTTCAGACCCTCTGGGG - Intronic
1084270370 11:68026260-68026282 GATTGGACTCAGACCCTCTGGGG - Intronic
1085535812 11:77216726-77216748 GGTTCCCCTGAGAGCCTCCGTGG + Exonic
1086595618 11:88567246-88567268 GGTCAGCCTCAGTGCCACAGTGG - Exonic
1090912067 11:131129704-131129726 TGATAGCCTCAGGGCCTATGAGG + Intergenic
1091282870 11:134391844-134391866 GGGTGCCCTCAGAGCCTCAGAGG + Exonic
1091321844 11:134657358-134657380 GGTTGGCCTCAGGGCCTCCCAGG + Intergenic
1091380844 12:57558-57580 GGACAGACTCAGGGCCTCTGGGG - Intergenic
1092228362 12:6763732-6763754 CGTTGGCCCCAGAGGCTCTGAGG + Intronic
1092228363 12:6763738-6763760 GGTTAGCCTCAGAGCCTCTGGGG - Intronic
1097477318 12:60074228-60074250 TGATAGGCTCAGAGCCTGTGTGG - Intergenic
1098521088 12:71436225-71436247 TGTTACCTTCAGAGCCTCAGGGG - Intronic
1099440063 12:82687715-82687737 GGGAAGCTTCAGAGCCACTGCGG - Intronic
1104799766 12:131546684-131546706 GGTTCTCACCAGAGCCTCTGGGG - Intergenic
1105211303 13:18258647-18258669 GCTGAGCCCCAGAGGCTCTGAGG + Intergenic
1109024897 13:57144261-57144283 GGTCAGGACCAGAGCCTCTGTGG + Intronic
1109025884 13:57150831-57150853 GGTCAGGACCAGAGCCTCTGTGG + Intronic
1109026874 13:57157404-57157426 GGTCAGGACCAGAGCCTCTGTGG + Intergenic
1109027866 13:57163975-57163997 GGTCAGGACCAGAGCCTCTGTGG + Intergenic
1109028852 13:57170540-57170562 GGTCAGGACCAGAGCCTCTGTGG + Intergenic
1109114307 13:58361405-58361427 GCTTGACCTCAGAGCCTATGAGG + Intergenic
1110707323 13:78609760-78609782 GGCAAGCCCAAGAGCCTCTGGGG + Intergenic
1114435327 14:22701961-22701983 GCTTATCTGCAGAGCCTCTGGGG - Intergenic
1116243530 14:42378985-42379007 GGGTAGCCTCAGATGCCCTGGGG + Intergenic
1117340666 14:54788813-54788835 GGTGGGCCTCCCAGCCTCTGAGG - Intronic
1118316371 14:64728566-64728588 GGCTCCCTTCAGAGCCTCTGAGG + Intronic
1119322520 14:73740193-73740215 GCTGAGCCCCAGAGCCTCTCTGG - Exonic
1126383193 15:48068697-48068719 GGTTATCTTCAGAGCAGCTGTGG + Intergenic
1127296805 15:57615777-57615799 GGATAGCATCAGTGCCTTTGGGG + Intronic
1127991668 15:64123320-64123342 ACTTTGCCTCAGGGCCTCTGTGG - Intronic
1127995787 15:64152455-64152477 GGTCAGCCCCCGGGCCTCTGTGG + Intronic
1128224329 15:65991346-65991368 GGTTTACCTCAGATCCTCTTTGG - Intronic
1129154320 15:73708357-73708379 GGTCACCCACAGGGCCTCTGGGG - Exonic
1129522834 15:76196595-76196617 GGTGGGCCTCAGAGCCTCGCTGG - Intronic
1129880888 15:79005406-79005428 AGAGAGCCTCTGAGCCTCTGAGG + Intronic
1130168119 15:81484082-81484104 GTTTAGCCTCATAACATCTGTGG + Intergenic
1132809271 16:1789846-1789868 GGTGAGACGCAGAGCCCCTGGGG + Intronic
1132939075 16:2498152-2498174 GGTATGCCCCAGAGCCTCTTTGG - Intronic
1133897337 16:9942360-9942382 GGTTAGCCACAGTCCCTCAGAGG - Intronic
1134739006 16:16525649-16525671 GGTTAGCAGCAGAGTCTCAGTGG + Intergenic
1134928495 16:18186503-18186525 GGTTAGCAGCAGAGTCTCAGTGG - Intergenic
1136512121 16:30744469-30744491 TCTTGGCCTCAGAGTCTCTGTGG - Intronic
1137584599 16:49656965-49656987 GGTTAGGAACACAGCCTCTGAGG - Intronic
1138510060 16:57503529-57503551 GGGTAGCCGGAGAGCCTCTGGGG + Intergenic
1138582340 16:57949672-57949694 GGTCAGCCTCTGATCCTCTCTGG + Intronic
1140816432 16:78625254-78625276 CTTTAGCCTCAGTCCCTCTGTGG + Intronic
1141896507 16:86962079-86962101 GGTCAGCTTCACAGACTCTGGGG + Intergenic
1142010201 16:87709986-87710008 GGTGAGCGTCGGAGCCTGTGGGG - Intronic
1142723465 17:1793730-1793752 GATAAGCCTCAGAGCCTCTGGGG - Intronic
1142733752 17:1881011-1881033 GTTTAGGCTCTGGGCCTCTGTGG + Intronic
1144079274 17:11747799-11747821 TGCTAGCCTCAGAGTCCCTGTGG + Intronic
1144573818 17:16416601-16416623 TGTGTGCCTCAGGGCCTCTGGGG - Intronic
1145018344 17:19412973-19412995 GGTTCGCATCAATGCCTCTGGGG + Exonic
1145999373 17:29122144-29122166 GGTGAGTCTCAGAGGGTCTGGGG - Exonic
1146956564 17:36939521-36939543 GCTGAGCCTCTGAGCCTCCGCGG + Intronic
1147535900 17:41323276-41323298 GGCCAGCATCAGAGCCTCTGTGG - Intergenic
1148082840 17:44976961-44976983 GGTTCCTCACAGAGCCTCTGAGG + Intergenic
1148579588 17:48734459-48734481 GATAAGCCTAAGTGCCTCTGAGG + Intergenic
1150127153 17:62644806-62644828 GGTCAGCCTCCGAGATTCTGCGG + Intronic
1151961645 17:77408842-77408864 GGATAGGCTCAGAGCCTATGTGG - Intronic
1152196306 17:78920380-78920402 TGCCAGCCTCAGAGCCTCTCGGG - Intronic
1152347506 17:79762300-79762322 GGGCATCCTCGGAGCCTCTGGGG - Intergenic
1152942040 17:83177910-83177932 TTTTAGCCTCAGCTCCTCTGTGG + Intergenic
1157825456 18:50808160-50808182 GGCTAGTCTCTGAGCCTTTGTGG + Intronic
1158176136 18:54658293-54658315 GGTTAGCCTCATTGCTGCTGTGG + Intergenic
1160675312 19:387943-387965 GCTGAGACTCAGAGCCCCTGTGG - Intergenic
1160912842 19:1482823-1482845 GGCTAGCTCCAGAGCCCCTGGGG + Intronic
1163790915 19:19305695-19305717 GCTGAGCCTCAGGCCCTCTGAGG - Intronic
1167571867 19:50293430-50293452 GGTTAACCTCGGGGCCCCTGGGG + Intronic
1167798531 19:51726286-51726308 GGCTGGCCTCAGATCATCTGAGG - Intergenic
926348746 2:11975590-11975612 TGTTAGTCTCAGAGCCTGTGTGG + Intergenic
928066928 2:28174659-28174681 TGTTAGTCTGAGAGCCTCTGAGG - Intronic
930384997 2:50683226-50683248 AGTTTGCCTCTGATCCTCTGTGG - Intronic
932307563 2:70714797-70714819 GGGCAGCCTCAGACCTTCTGGGG - Intronic
933939578 2:87234135-87234157 AGACAGCCTCAGACCCTCTGGGG - Intergenic
936353557 2:111731638-111731660 AGACAGCCTCAGACCCTCTGGGG + Intergenic
939700110 2:145380634-145380656 GGGAATCCTCAGAGCCTCTGTGG + Intergenic
942337319 2:174903198-174903220 GTTTAGCTTCAGTGCCTATGAGG - Intronic
942922830 2:181397538-181397560 TGATAGGCTTAGAGCCTCTGTGG - Intergenic
946161591 2:217839145-217839167 GGTCACCCTCAGAACCTCTAGGG + Intronic
947598121 2:231426829-231426851 GGTTTGCCCCAGTGGCTCTGAGG - Intergenic
947940555 2:234051008-234051030 GGATGCCCTCAGTGCCTCTGTGG + Exonic
948551797 2:238777914-238777936 GGTCTGCCTCAGAGACTGTGGGG - Intergenic
948994168 2:241570365-241570387 GGTGAGCCTCTGAGCGCCTGGGG + Intronic
948994212 2:241570517-241570539 GGTGAGCCTCTGAGCGCCTGGGG + Intronic
948994254 2:241570670-241570692 GGTGAGCCTCTGAGCGCCTGGGG + Intronic
948994296 2:241570823-241570845 GGTGAGCCTCTGAGCGCCTGGGG + Intronic
1169362374 20:4961918-4961940 TGATTGCCTCATAGCCTCTGTGG + Intronic
1172649684 20:36493832-36493854 CGTAAGCCTCAGAGCCTGTGAGG - Intronic
1172843527 20:37915985-37916007 GAGCAGCCTCAGAGCCACTGAGG - Intronic
1173405076 20:42757388-42757410 GGTGGGGCTCAGAGCCTGTGGGG - Intronic
1174565822 20:51463837-51463859 AGTTAACCTCAGTGCATCTGTGG + Intronic
1175845152 20:62054299-62054321 TGTGAGCCTCAGCGTCTCTGTGG + Intronic
1178875289 21:36409464-36409486 AGGTATCCTCAGAGCCTCAGGGG + Exonic
1179514902 21:41899594-41899616 GGTTAACCTCTGAGCCCCGGGGG - Intronic
1180764932 22:18340790-18340812 GCTGAGCCCCAGAGGCTCTGAGG - Intergenic
1180814099 22:18778894-18778916 GCTGAGCCCCAGAGGCTCTGAGG + Intergenic
1181200282 22:21213229-21213251 GCTGAGCCCCAGAGGCTCTGAGG + Intronic
1181701456 22:24623730-24623752 GCTGAGCCCCAGAGGCTCTGAGG - Intronic
1181895217 22:26101224-26101246 GGTAAGTCTCTGAGCCTCTCTGG - Intergenic
1183014683 22:34976452-34976474 GGTTAGCCTCTCACCCTCCGGGG + Intergenic
1183751848 22:39725384-39725406 GGGTGGGCTCAGACCCTCTGTGG - Intergenic
1203226554 22_KI270731v1_random:81695-81717 GCTGAGCCCCAGAGGCTCTGAGG - Intergenic
1203264196 22_KI270734v1_random:4581-4603 GCTGAGCCCCAGAGGCTCTGAGG + Intergenic
950389316 3:12684024-12684046 GCTTTGCCCCACAGCCTCTGAGG + Intergenic
954618841 3:51984347-51984369 GGTCAGCAGCAGAGTCTCTGGGG - Intronic
956639401 3:71401433-71401455 GCTTAGCCTGACAGCTTCTGGGG - Intronic
956734494 3:72227821-72227843 GTTTAGAATCAGAGTCTCTGAGG - Intergenic
960416919 3:117396541-117396563 GGGCAGCCACAGAGGCTCTGAGG - Intergenic
960881860 3:122353502-122353524 GGTAAGCCTCTGAGCCTCCAGGG - Intergenic
961458400 3:127035475-127035497 GCTGACCCTGAGAGCCTCTGGGG + Exonic
962207521 3:133447223-133447245 TGTTAGGCACAGAGGCTCTGGGG - Intronic
967562110 3:190928080-190928102 GATTAGCCACAAAGCCTTTGTGG - Intergenic
967807689 3:193730028-193730050 GGTTACCATCAGAGCCATTGGGG + Intergenic
969311711 4:6356784-6356806 GGCTAGCCTCTCAGCCTCTCTGG + Intronic
969471428 4:7391596-7391618 GGGTACCCTCAGTCCCTCTGAGG + Intronic
977391595 4:96416334-96416356 GGTTGTCCTTAGAGCCTCTGAGG + Intergenic
985525282 5:398447-398469 AGTTAGCCTCTGACCATCTGTGG + Intronic
986038413 5:3962795-3962817 GGTTGGCGTCTGAGACTCTGCGG - Intergenic
986651081 5:9964075-9964097 GGTCACCCTGAGAGCCCCTGGGG + Intergenic
991009315 5:61866296-61866318 GTTTAGCCTAAGAGTCTCTTTGG + Intergenic
992510374 5:77427098-77427120 AGTTAGCTTCACAGCCTCTATGG + Exonic
996352908 5:122564941-122564963 GGTTATCCTTGGATCCTCTGAGG - Intergenic
996650271 5:125867394-125867416 GGATAGCCCCAGAACCACTGTGG - Intergenic
1003258444 6:4494387-4494409 GTGCAGCCTCAGAGTCTCTGGGG - Intergenic
1007304016 6:40890525-40890547 GGGTGGCATCACAGCCTCTGTGG - Intergenic
1009770691 6:68139735-68139757 GTTTAGCCTCAAAGCTTCTAAGG - Intergenic
1011581268 6:88868176-88868198 GGTTAGCCCCATAGCCTTTGAGG - Intronic
1011663971 6:89617553-89617575 GCTGGGCCTCAGATCCTCTGTGG + Intronic
1012765044 6:103357324-103357346 TGTTAGTCTCAGAGCCTGTAAGG - Intergenic
1014683058 6:124457608-124457630 GCTTAGCCTCAGAACATATGCGG - Intronic
1015937158 6:138415589-138415611 TGTGAGCCGCAGAGTCTCTGTGG + Exonic
1018818630 6:167355814-167355836 CGTTTGCTCCAGAGCCTCTGAGG + Intronic
1019606914 7:1914518-1914540 GGTTCGTTTCAGAGGCTCTGGGG - Intronic
1020082182 7:5292025-5292047 GTGTAGCCACAGAGACTCTGAGG + Intronic
1020082183 7:5292031-5292053 GGGCTGCCTCAGAGTCTCTGTGG - Intronic
1020449592 7:8306124-8306146 TGTAATCCTGAGAGCCTCTGGGG - Intergenic
1021930214 7:25573414-25573436 GGTTAGGCTCTGATCCTCTTTGG - Intergenic
1024352624 7:48382363-48382385 GGGTGGCCTGAGAGCCACTGAGG - Intronic
1025196740 7:56940108-56940130 GGTCTGCCTCAGAGTCTCTGTGG + Intergenic
1025196741 7:56940114-56940136 GTGTAGCCACAGAGACTCTGAGG - Intergenic
1025675206 7:63636823-63636845 GTGTAGCCACAGAGACTCTGAGG + Intergenic
1025675207 7:63636829-63636851 GGTCTGCCTCAGAGTCTCTGTGG - Intergenic
1026573097 7:71548987-71549009 GCTTTGCTTCTGAGCCTCTGGGG + Intronic
1026869060 7:73839933-73839955 GCTTAGCCTGAGGGGCTCTGGGG + Intronic
1029020878 7:97363912-97363934 TGTTAGTCTCAGGGCCTGTGAGG - Intergenic
1034741509 7:153478414-153478436 TGTTAGTCTCAGGGCCTGTGTGG - Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035344936 7:158191739-158191761 GGTTCGCCTCCGAGCCTGTCTGG + Intronic
1035346198 7:158200406-158200428 GTTTAGCTTCATAGGCTCTGAGG - Intronic
1035350732 7:158244751-158244773 GGTTAGCGTCAGAGTATGTGTGG + Intronic
1035374756 7:158400743-158400765 GGCCAACCTCAGAGCCTCTCTGG + Intronic
1037085256 8:14841291-14841313 GGTTAGCCTGAGAGCTTCTTTGG - Intronic
1037240523 8:16772036-16772058 ATTCATCCTCAGAGCCTCTGTGG - Intergenic
1038095222 8:24301750-24301772 TGTTCTCCTGAGAGCCTCTGTGG + Intronic
1040325350 8:46338802-46338824 GGTTTGCCGCAGGGCCTCAGTGG + Intergenic
1047849786 8:128844249-128844271 GGTTAGCATGAGAGGTTCTGGGG - Intergenic
1048332774 8:133482414-133482436 GGTTTGCCTCGGCACCTCTGGGG - Intronic
1048369081 8:133761250-133761272 CCTTAGCCTCTGAGCCTCTTGGG + Intergenic
1050664299 9:7918090-7918112 GGTGAGCCTGGGAGGCTCTGAGG - Intergenic
1052498108 9:29254165-29254187 GGTCTGCCTCAGAGCCTGTTTGG + Intergenic
1055515902 9:77032606-77032628 GCTAAGCCTCAGAACCTCAGGGG - Intergenic
1057197430 9:93122766-93122788 CTTTGGCCTCCGAGCCTCTGAGG + Intronic
1057274256 9:93667918-93667940 GATGTGCCTCAGAGACTCTGTGG + Intronic
1058979193 9:110153322-110153344 AGTTGGCATCTGAGCCTCTGTGG + Intronic
1060892607 9:127198327-127198349 ACTGAACCTCAGAGCCTCTGAGG + Intronic
1060979383 9:127783957-127783979 GCTTAGCCTCAAAGCCTCCTAGG - Intergenic
1062085997 9:134648832-134648854 GCTCAGGCTCAGAGCCTCAGAGG - Intronic
1203377692 Un_KI270442v1:390078-390100 GGTTTGGCTCACACCCTCTGAGG - Intergenic
1187621765 X:21063466-21063488 AGCTAGGCTCAGAGCCTGTGAGG + Intergenic
1188023582 X:25185374-25185396 CCTTAGCCAGAGAGCCTCTGAGG - Intergenic
1190895798 X:54616754-54616776 TGTTAGCCTCAGGGCCTGGGGGG + Intergenic
1193218690 X:78897278-78897300 TGTTAACCTCAGAGAATCTGAGG + Intergenic
1197469991 X:126855641-126855663 GGTCAGCCTTTGAGACTCTGTGG + Intergenic
1198685089 X:139220426-139220448 GGTCAGCATCAGATTCTCTGAGG + Intronic
1199038696 X:143084330-143084352 AGATAACCTCAGAGACTCTGGGG + Intergenic