ID: 1092229225

View in Genome Browser
Species Human (GRCh38)
Location 12:6767456-6767478
Sequence AGGGCGAACGGATGGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092229225_1092229237 13 Left 1092229225 12:6767456-6767478 CCCCGGCCCCATCCGTTCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1092229237 12:6767492-6767514 GCCTTCCTCTAATTTCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 189
1092229225_1092229240 22 Left 1092229225 12:6767456-6767478 CCCCGGCCCCATCCGTTCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1092229240 12:6767501-6767523 TAATTTCCCCAGGGAACCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 198
1092229225_1092229236 12 Left 1092229225 12:6767456-6767478 CCCCGGCCCCATCCGTTCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1092229236 12:6767491-6767513 AGCCTTCCTCTAATTTCCCCAGG 0: 1
1: 0
2: 2
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092229225 Original CRISPR AGGGCGAACGGATGGGGCCG GGG (reversed) Intronic
900480400 1:2895380-2895402 GGGGCGAGGGGCTGGGGCCGTGG + Intergenic
900626659 1:3611605-3611627 AGGGGGAAGGGGCGGGGCCGAGG - Intergenic
912505236 1:110151307-110151329 AGGCCGAGCGGCTGGGGCTGGGG - Intronic
920430269 1:205914408-205914430 AGGGAAAACGGATGGGACCTGGG - Exonic
921923148 1:220690471-220690493 AGGGCGAACCGAGGGGGACGAGG + Exonic
1064863619 10:19854176-19854198 AGGGCGAGTGGATGAGGCCTGGG + Intronic
1067317233 10:45180305-45180327 AGGGCGAGCGGCGGGGGCTGGGG + Intergenic
1067318778 10:45198371-45198393 AGGGCGAGCGGCGGGGGCTGGGG - Intergenic
1073097486 10:100988600-100988622 GGGGCGAGGGGATGGGGCCAGGG + Exonic
1075389820 10:122084141-122084163 GGGGCCAACGGATGGAGCCAAGG + Exonic
1076797224 10:132804120-132804142 GGGCCGAGGGGATGGGGCCGAGG - Intergenic
1077319942 11:1936637-1936659 ACGGAGCACGGATGGGGCTGGGG - Intronic
1079356922 11:19737440-19737462 AGGGAGAAGGGATGGGGAAGAGG + Intronic
1084006603 11:66326614-66326636 AGGAAGAAAGGATGGGGCTGGGG - Intergenic
1084176129 11:67423301-67423323 AGGGGGATAGGATGGGGCCTAGG - Intronic
1084399124 11:68933501-68933523 AGGGCAGAAGGATGGGGCGGCGG - Intronic
1084536134 11:69758380-69758402 AGCCAGAACGGATGGGGCCTGGG - Intergenic
1090640746 11:128726915-128726937 AGGGACAACGGCTGGGGCAGAGG + Intronic
1092229225 12:6767456-6767478 AGGGCGAACGGATGGGGCCGGGG - Intronic
1094159732 12:27377885-27377907 AGGGTGAATGGTTGGGGCAGGGG + Intronic
1096782899 12:54001041-54001063 AGGGCCAGGGGATGGGGCTGGGG + Intronic
1101710046 12:107256737-107256759 AGGGCTAAAGGAAGGGGCAGGGG - Intergenic
1102915638 12:116750040-116750062 AGGGAGGAAGGAGGGGGCCGGGG + Exonic
1103698566 12:122835715-122835737 CGCGCGAACGGCTGGGGCCCGGG + Intronic
1103907828 12:124336302-124336324 AGGGAGCAGGGATGGGGCTGCGG - Intronic
1105611725 13:21974773-21974795 AGGACGAACGGGTGGGGAGGTGG - Intergenic
1105898482 13:24738374-24738396 AGGGAGAACAGAAGGGGCCTGGG - Intergenic
1108708064 13:53007957-53007979 AGGGAGAACAGATGGGGAAGTGG + Intergenic
1109744415 13:66604111-66604133 AGTGCGGAGGAATGGGGCCGTGG - Intronic
1115860704 14:37683044-37683066 AGGACCAACGTATGGGGCTGGGG + Intronic
1119479283 14:74949652-74949674 AGGGAGCTCGGATGGGGCTGGGG - Intronic
1120996473 14:90421894-90421916 AGGGAGAAAGGCTGGGGCAGGGG - Intergenic
1122207130 14:100153402-100153424 AGGGAGAATGGGTGGGGCTGGGG + Intronic
1126436897 15:48645856-48645878 AGGGAGGATGGATGGGGCCGGGG - Intergenic
1127310208 15:57745570-57745592 ATGGCAAAGGGAAGGGGCCGGGG - Intronic
1132631523 16:919915-919937 AGGCCGGAAGGATGGTGCCGGGG - Intronic
1132897223 16:2234803-2234825 AGGGGGAGGGGAGGGGGCCGGGG + Intronic
1133780629 16:8936303-8936325 AAGGTGAACTGATGGGGGCGGGG - Intronic
1134073034 16:11272419-11272441 AGAGCGAGAGGATGGGGCCTAGG + Intronic
1134581830 16:15377582-15377604 AGGGCGGAGGGAAGGGGACGGGG + Intronic
1139375055 16:66491642-66491664 AGGGTGGAGGGATGGGGGCGGGG + Intronic
1141690644 16:85594350-85594372 AGGGCTCACAGATGGGGCCTGGG - Intergenic
1141950622 16:87336821-87336843 AGGGCGGACTGGTGGGGCTGCGG - Intronic
1141971333 16:87485133-87485155 AGGGTGAACGGCTGGGTCCAGGG + Intronic
1142252625 16:88999666-88999688 AGGGCGGAGGGAGGGGGCGGGGG + Intergenic
1143262102 17:5607115-5607137 AGGGCTTAAAGATGGGGCCGTGG + Intronic
1144750864 17:17647169-17647191 AGGGGGAAGGGATGGGGCCAAGG + Intergenic
1144830582 17:18128839-18128861 AGGGAGGACGGATGGAGCTGTGG + Intronic
1147387700 17:40091720-40091742 AGGGGGAAGGGAGGGGTCCGGGG - Intronic
1147648827 17:42050531-42050553 AGTGCGAGCGGACGGGGCGGGGG - Intronic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1148769045 17:50056445-50056467 GGGGCGCGCGGCTGGGGCCGGGG - Exonic
1152218031 17:79045692-79045714 GGGGCGAAGGGATGGGGACAGGG + Intronic
1155054247 18:22170801-22170823 ACGGAGAAAGGATGCGGCCGAGG + Intronic
1155147882 18:23098900-23098922 AGGGAGAACAGTTGTGGCCGAGG + Intergenic
1157139087 18:45087618-45087640 AGGATGAATGGATGGGGCTGGGG + Intergenic
1160163228 18:76491302-76491324 GGAGCGAGCGGATGGGGCTGTGG - Intronic
1160183975 18:76660499-76660521 AAGGCAAAGGGATGGGGCTGTGG + Intergenic
1160937778 19:1605323-1605345 CGGGAGCGCGGATGGGGCCGCGG + Intronic
1160946316 19:1645558-1645580 AGGGTGAGAGGAAGGGGCCGTGG - Intronic
1161704895 19:5815046-5815068 AGGGGAAGCAGATGGGGCCGGGG - Intergenic
1161768142 19:6217912-6217934 GGGGGGCACGGATGGGGCCGGGG - Intronic
1161800249 19:6413492-6413514 AGGGGGGACGGGCGGGGCCGCGG + Exonic
1162291599 19:9785141-9785163 TGAGAGAACAGATGGGGCCGGGG - Intronic
1163185992 19:15640202-15640224 AGAGGGAACGGATGGGGTCCAGG - Intronic
1163455638 19:17404341-17404363 AGGGAGAAGGGAGAGGGCCGGGG - Intronic
1163547291 19:17947963-17947985 AGGACGACCGGGCGGGGCCGCGG + Intergenic
1164432033 19:28197215-28197237 AGGCAGAGAGGATGGGGCCGGGG - Intergenic
1165778406 19:38418169-38418191 AGGGCCAAGGGGTGGGGCCACGG + Intronic
1166807243 19:45494677-45494699 AGGGCGCTCGGATGGAGGCGCGG + Exonic
1167127445 19:47559915-47559937 AGGGAGTAGGGATGGGGCAGGGG - Intergenic
927207978 2:20621978-20622000 AGGGAGAAGGAATGGGGCCAGGG - Intronic
927282918 2:21326288-21326310 AGGTTGAACAGATGGGGCTGTGG + Intergenic
935762170 2:106331288-106331310 AGAGCGACCGGCTGGAGCCGCGG - Intergenic
937908365 2:127063654-127063676 AGGGCGGAAGGATGGGGGCCAGG + Intronic
941411892 2:165167987-165168009 AGGGAGAAAGGATGAGGCCTGGG + Intronic
942161121 2:173188623-173188645 GGGGTGAAGGGATGGGGGCGGGG + Intronic
946311899 2:218886674-218886696 AGGGGGAGCGGGTGGGGCCATGG - Intronic
947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG + Intronic
949030864 2:241796700-241796722 AGGGCCATCGGCTGGGGTCGGGG + Intronic
1170373406 20:15674230-15674252 AGGGAGAACGGAAGGGGAAGAGG + Intronic
1173626380 20:44476000-44476022 AGGGCACACGGATGGGCTCGCGG - Intronic
1174107225 20:48171331-48171353 AGGGAGGTCGCATGGGGCCGGGG + Intergenic
1174340374 20:49891541-49891563 AGGGGGATGGGATGGGGCAGGGG - Exonic
1174380803 20:50154101-50154123 AGGGCGCCGGGCTGGGGCCGAGG + Intergenic
1174843218 20:53919209-53919231 AGGGCGAAGGGGAGGGGTCGCGG - Intergenic
1176000013 20:62827465-62827487 TGGGAGAACGGCTGGGGCCAGGG - Intronic
1179810269 21:43865440-43865462 AGGTCGGACGGCTGGGGCAGGGG - Intronic
1183427182 22:37746239-37746261 TGGGCGGATGGAAGGGGCCGGGG + Intronic
1183604281 22:38859645-38859667 GGGGCAAACAGATGGGGCTGGGG + Intergenic
1183862294 22:40679007-40679029 AGGGCACAGGGAAGGGGCCGAGG + Exonic
1184323643 22:43764194-43764216 AGGGGGAAGGGATGGGGGCAAGG - Intronic
1185297636 22:50062153-50062175 AGGGTGGACGGCTGGGGCCCAGG - Intronic
1185315786 22:50178531-50178553 AGGGGGAAGGGAGGAGGCCGAGG + Intronic
954693982 3:52410483-52410505 GCGGCGAACGGAAGGGGCGGGGG + Intergenic
962853434 3:139324840-139324862 AGGGCTAAGGGATGGGCCCAGGG + Intronic
964720759 3:159765230-159765252 AGGAAGAATGAATGGGGCCGCGG - Intronic
968514714 4:1011350-1011372 AGGGCGCGCGGGCGGGGCCGGGG + Intronic
968779699 4:2571115-2571137 AGGAGGAAGGGCTGGGGCCGCGG - Intronic
982206731 4:153002125-153002147 AGGGAGAAGGCATGGGGCCAGGG - Intergenic
983904198 4:173168307-173168329 AGGTCCAACGGAGGGGGCGGCGG + Intergenic
984999714 4:185471357-185471379 GGGGCGGAGGGATGGGGCGGAGG + Intronic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
988500061 5:31776975-31776997 AGAGCGAACGCCTGAGGCCGAGG - Intronic
993641308 5:90409555-90409577 AGGGAGGACGTTTGGGGCCGAGG - Intronic
997467411 5:134097575-134097597 AGGGTGAACCGAGGTGGCCGAGG - Intergenic
1001456190 5:171862120-171862142 AGGGGGAAGGGAGGGGGCAGGGG - Exonic
1003479178 6:6515738-6515760 AGGGTGGACGGAGGGGGCGGTGG - Intergenic
1006155673 6:32011651-32011673 AGCGCGAGCTGATGGTGCCGGGG - Intergenic
1006162004 6:32044505-32044527 AGCGCGAGCTGATGGTGCCGGGG - Exonic
1006271752 6:32970916-32970938 AGGGCGAGCGGAGGAGGCGGCGG - Exonic
1009370121 6:62889106-62889128 AGGGGAAACGGCTGGAGCCGTGG + Intergenic
1019143113 6:169960730-169960752 AGGGCGACTGGGTGGGGCCTTGG + Intergenic
1020118934 7:5492042-5492064 AGGGCCAAAGGAGGAGGCCGAGG + Intronic
1026360197 7:69597092-69597114 AGGACGAAGGGTTGGTGCCGTGG + Intergenic
1027233002 7:76282828-76282850 ACGGCGAGCGGCTGGGGCTGTGG - Exonic
1029373916 7:100166757-100166779 TGGTCGTAGGGATGGGGCCGAGG + Exonic
1031998522 7:128248783-128248805 AGTGGGAAGGGATGGGGCAGAGG - Intronic
1034264295 7:149773633-149773655 AGCGCGAACGGGTGGGGGGGTGG + Intergenic
1034344805 7:150379515-150379537 GGGGCGGAGGGATGGGGCGGGGG + Intronic
1034459527 7:151190902-151190924 AGGGTAAAGGGATGGGGCAGAGG - Exonic
1035044523 7:155954859-155954881 AGGGCAAACGGATGGTGGGGTGG + Intergenic
1035265156 7:157686003-157686025 AGGGCGACCGCGCGGGGCCGCGG + Intronic
1041390938 8:57347122-57347144 AGGGTGATCGGCTGGGGCAGGGG - Intergenic
1044370344 8:91402900-91402922 AGGGGGAATGGATGGGGGAGGGG + Intergenic
1047747168 8:127853924-127853946 AGGGCCACGGGATGGGGGCGGGG - Intergenic
1049762829 8:144338630-144338652 AGGACGAACGGAGGAGGCCAAGG - Intergenic
1053001086 9:34577750-34577772 AGGTCCCAGGGATGGGGCCGGGG - Intronic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1062088825 9:134663356-134663378 AGGGTGAAGGGCTGGGGCTGGGG + Intronic
1062595188 9:137296091-137296113 AGGGCGGGGGGCTGGGGCCGGGG - Intergenic
1192206210 X:69098168-69098190 AGGGAGAGAGGATGGGGCAGTGG - Intergenic
1198235706 X:134734346-134734368 ACTGGGAACGCATGGGGCCGGGG + Intronic
1200169271 X:154060640-154060662 AGGGGGAACTGGTGGGGCAGAGG + Intronic