ID: 1092230534

View in Genome Browser
Species Human (GRCh38)
Location 12:6773347-6773369
Sequence GGTCCTGTTGCCCAAGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092230534_1092230540 12 Left 1092230534 12:6773347-6773369 CCCCAAACTTGGGCAACAGGACC 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1092230540 12:6773382-6773404 ACTCAACCCCACACCCGTGCCGG 0: 1
1: 0
2: 1
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092230534 Original CRISPR GGTCCTGTTGCCCAAGTTTG GGG (reversed) Intronic
900511979 1:3065090-3065112 GCTCCTGCTGCTCAAGTCTGGGG + Intergenic
900875035 1:5336351-5336373 GGTCCTCTGGCTCAACTTTGGGG - Intergenic
902695512 1:18138187-18138209 GGTTCTGTAGCCCATGCTTGGGG - Intronic
903183552 1:21617440-21617462 CATCCTGCTGCCCCAGTTTGGGG - Exonic
903840180 1:26233622-26233644 TTTCCTGTGGACCAAGTTTGGGG + Intergenic
903929897 1:26856113-26856135 GGCCCTGGTGCCCAGGTTGGAGG - Exonic
905049999 1:35042170-35042192 GGTTCCGTTGCCCAAGCTGGAGG - Intergenic
906529192 1:46513454-46513476 GGTCCTCATTCCCAAGATTGAGG + Exonic
907748212 1:57236295-57236317 TGTGGTCTTGCCCAAGTTTGTGG - Intronic
907867677 1:58414237-58414259 AGTACTGTAGCCCTAGTTTGGGG - Intronic
908660958 1:66434673-66434695 GCTCCTGTTGCCCAGGCTGGAGG + Intergenic
909349262 1:74630444-74630466 GGTTCTGTTGCCCATGAATGAGG + Intronic
910449354 1:87330474-87330496 GGTCCTGTTTCCAAAGTCTCAGG + Intronic
910614241 1:89179695-89179717 GGTCCTGTTACAGAATTTTGGGG - Intergenic
914973597 1:152334937-152334959 GGTCCATTTGGCCAAGATTGGGG - Intergenic
915293485 1:154902523-154902545 GGTCCTTTTGCTTAAGTTTAAGG - Intergenic
915902662 1:159857540-159857562 GCTCTTGTTGCCCAAGCTGGAGG - Intronic
919802784 1:201363604-201363626 GGTCCTGATTCCCAAATGTGAGG + Intronic
919805856 1:201380659-201380681 AGTCCAGTTCCCCAAGTGTGTGG - Intronic
919941620 1:202290829-202290851 GCTCCTGTTGCCCAGGCTGGAGG - Intronic
924728076 1:246688483-246688505 TGTTCTGTTGCCCAGGTTGGAGG + Intergenic
1064743937 10:18460960-18460982 GTTCTTGTTGCCCAAGCTGGAGG + Intronic
1064913105 10:20425073-20425095 TGTGCTGTTGACCAAGTGTGTGG + Intergenic
1065247264 10:23770899-23770921 GGTACTGCTGTCCAAGTTTGAGG + Intronic
1069139286 10:64803467-64803489 GATGCTGTTGCCCAGTTTTGGGG + Intergenic
1069327791 10:67252176-67252198 TGCTCTGTTGCCCAAGTTAGAGG - Intronic
1071150809 10:82632068-82632090 GCTCTTGTTGCCCAGGTTGGAGG - Intronic
1071154319 10:82671976-82671998 GGTTATGTTTCCCAAGTTTCGGG + Intronic
1071270297 10:84000793-84000815 GGCTCTGTTGCCCAAGCTGGAGG + Intergenic
1072298943 10:94040430-94040452 TGTCCTTGTGCCCAAGGTTGTGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1075187837 10:120278750-120278772 AGACCTGTTGCCAAAGTTTAAGG - Intergenic
1075331309 10:121576152-121576174 GCTCTTGTTGCCCAGGTTGGAGG - Intronic
1075760695 10:124853710-124853732 TGTTCTGTTGCCCAAGCTGGAGG - Intergenic
1080425073 11:32147471-32147493 GGTCCTTCTGACTAAGTTTGGGG + Intergenic
1081381303 11:42418796-42418818 GGGCCAATTGCTCAAGTTTGTGG + Intergenic
1083069390 11:59961259-59961281 GGTCCTCTTGGCCAAGATGGGGG - Intergenic
1084022755 11:66427501-66427523 GGTCCTCTCTCCCAAGTGTGGGG + Intergenic
1084189663 11:67493252-67493274 GGTCCTGCTCCCCTAGTTTGAGG - Intronic
1089053474 11:115565576-115565598 CGCTCTGTTGCCCAGGTTTGAGG - Intergenic
1090344409 11:126057019-126057041 GGTCCTTTTCCCCTATTTTGAGG + Intronic
1092085587 12:5756636-5756658 GGGCCTGTTGCCAGAGTCTGTGG + Intronic
1092230534 12:6773347-6773369 GGTCCTGTTGCCCAAGTTTGGGG - Intronic
1096095830 12:48934984-48935006 GGTCTTGTTGCCCAGGCTGGAGG - Intronic
1097733094 12:63151350-63151372 CGTCCAGTTGTCCAAGTTTTTGG - Intergenic
1098022802 12:66173235-66173257 TGTTCTGTTGCCCAGGTTGGAGG + Intergenic
1098581339 12:72102823-72102845 GGGCTTGTTGCCCCAGTTGGTGG + Intronic
1101317426 12:103642623-103642645 GCTCCTGTTGCCCAGGTCTAAGG - Intronic
1103590813 12:121990759-121990781 GGTTCTGTTGCACAAGGCTGGGG - Intronic
1108580649 13:51825665-51825687 AGTCCTGTTGCCCAGGCTGGAGG + Intergenic
1109439649 13:62352753-62352775 GGCTCTGTTGCCCAAGCTGGAGG + Intergenic
1110914135 13:81000084-81000106 GCTCCTGTTGCCCAGGTTGGAGG + Intergenic
1114588018 14:23832586-23832608 GGTCCTGTGGCCCAAGTGGCAGG - Intergenic
1115760697 14:36577682-36577704 GGGCATGCTTCCCAAGTTTGGGG + Intergenic
1117359355 14:54958157-54958179 GCTCTTGTTGCCCAAGCTGGAGG + Intronic
1117646267 14:57856366-57856388 CTTTCTGTTGCCAAAGTTTGTGG + Intronic
1117973825 14:61279434-61279456 GGTCGTGATTCCCAAATTTGAGG + Exonic
1118266396 14:64298624-64298646 GGTCCTGGTGCCCAGGTATCAGG - Intronic
1118697298 14:68397611-68397633 CCTCCTGTGGCCCCAGTTTGTGG + Intronic
1119452125 14:74720851-74720873 AATCATGTTGCCCAAGTTTTTGG + Intronic
1121364645 14:93297725-93297747 GGGCCTGGAGGCCAAGTTTGTGG + Intronic
1121634759 14:95446409-95446431 GGTCCAGGTGCCCAAGGCTGAGG - Intronic
1123934535 15:25187790-25187812 GCTCCTGTTACCCAAGGGTGGGG + Intergenic
1124627050 15:31314003-31314025 GCTGCTGTTGCCCCAGATTGGGG - Intergenic
1125064497 15:35466162-35466184 TGTTCTGTTGCCCAGGTTGGAGG - Intronic
1126257076 15:46640462-46640484 GGTCTTGGTCCCAAAGTTTGAGG + Intergenic
1128458659 15:67849350-67849372 AGTCCTGTTGGCCAAGAGTGGGG + Intergenic
1128708843 15:69857051-69857073 GCTCCTGTTGCCCAGGTCTCAGG + Intergenic
1128850652 15:70952479-70952501 TGTGCTGTTGTCCAAGTGTGTGG + Intronic
1129195121 15:73959870-73959892 GGCACTGTTTCCCAAGTTTTCGG - Intergenic
1130275465 15:82473924-82473946 TGTGCTGTTGACCAAGTTAGAGG + Intergenic
1130467825 15:84201319-84201341 TGTGCTGTTGACCAAGTTAGAGG + Intergenic
1130496440 15:84472223-84472245 TGTGCTGTTGACCAAGTTAGAGG - Intergenic
1130590117 15:85205917-85205939 TGTGCTGTTGACCAAGTTAGAGG + Intergenic
1130767646 15:86888182-86888204 AGTCCTGTTGCCTTAGTCTGAGG + Intronic
1131136383 15:89939428-89939450 TGTTCTGTTGCCCAGGTTGGAGG - Intergenic
1131552552 15:93370052-93370074 TGCTCTGTTGCCCAAGTTGGAGG - Intergenic
1132052298 15:98617017-98617039 GGTTCTGTTGCCCAGGCTGGAGG - Intergenic
1135208883 16:20507202-20507224 GGTGGAGCTGCCCAAGTTTGTGG - Intergenic
1135224088 16:20640520-20640542 GGTCGTGTTGCCCAAGGATCAGG - Exonic
1136614556 16:31389587-31389609 GGCACTGTTGCCCAAGCTAGAGG - Intergenic
1138729218 16:59176304-59176326 GCTCTTGTTGCCCAGGTTGGAGG - Intergenic
1139006091 16:62573068-62573090 GCTCTTGTTGCCCAAGCTGGAGG - Intergenic
1139602713 16:67996391-67996413 GCTCCTGTTGCCCAGGCTGGAGG + Intronic
1142660545 17:1426151-1426173 GGTCTTGTTGCCCAGGCTAGGGG - Intronic
1143000526 17:3792152-3792174 GGCCCTGTTGCCCAGGCTGGAGG + Intronic
1143052402 17:4137016-4137038 GGTCCCGTTTCCCATGTATGTGG - Intronic
1144141457 17:12352605-12352627 GGTCCTGTTTCCTAAGATTTTGG + Intergenic
1144502697 17:15803242-15803264 GGTCCTATTGTCCAACTCTGAGG + Intergenic
1145164876 17:20605895-20605917 GGTCCTATTGTCCAACTCTGAGG + Intergenic
1146398288 17:32485818-32485840 TTTCCTGTTTCCCAGGTTTGTGG + Intergenic
1149507055 17:57203232-57203254 GGTACTGATGCCCCAGTGTGAGG - Intergenic
1151181915 17:72335344-72335366 GGTCCTGTTGGCCACTTTTATGG - Intergenic
1152271041 17:79325097-79325119 GGTGGTGTTGCCCAGGGTTGGGG - Intronic
1152449902 17:80371646-80371668 GGTCCTGAAACCAAAGTTTGAGG + Intronic
1152883729 17:82835453-82835475 GGTCTTGTTGCCCAGGCTGGAGG + Intronic
1153321877 18:3781382-3781404 GCTCCTGTTGCCCAGGCTGGAGG + Intronic
1157152104 18:45228531-45228553 GGACCTGTGTCCCGAGTTTGTGG - Intronic
1157905232 18:51563714-51563736 CCTCCTGTTGCCCCAATTTGGGG + Intergenic
1159435838 18:68415705-68415727 GGTCATGTTGCCCAGATATGTGG - Intergenic
1161038811 19:2099287-2099309 GGTCAGGTTGGCCAAGTGTGGGG - Exonic
1161383865 19:3980775-3980797 CTTCCTGTTGCCCAAGGTTGTGG - Intronic
1165694956 19:37893992-37894014 GATACTCTTGCCCAAGTCTGTGG - Exonic
1166308400 19:41948498-41948520 GGTCCAGTTGCCTAGTTTTGTGG - Intergenic
925007707 2:457201-457223 GGTTCTGTTGCCTAAGTTTCAGG + Intergenic
926081307 2:9988622-9988644 AGTCCAGGTGCCCAGGTTTGAGG - Intronic
926103028 2:10132768-10132790 GGGCCTATTGCACAAGTTCGGGG + Intergenic
927192031 2:20523621-20523643 GGTCCTAATGCGCATGTTTGAGG + Intergenic
928227564 2:29465659-29465681 TGTTCTGTTGCCCAGGTTGGAGG - Intronic
928569315 2:32587352-32587374 CGTTCTGTTGCCCAGGTTGGAGG - Intronic
929814926 2:45223079-45223101 GCTCTTGTTGCCCAGGTTGGAGG - Intergenic
931348562 2:61469172-61469194 GCTCTTGTTGCCCAAGCTGGAGG - Intronic
934096709 2:88613628-88613650 GGCCCTATTGCCCAGGTTTGAGG - Intronic
937933162 2:127220940-127220962 GGTCCTGTTGCACAAGGCTTGGG + Intergenic
938257490 2:129870489-129870511 GGTCCTTTTGCCCAAGAGGGGGG - Intergenic
942306972 2:174618196-174618218 GGTCCAGTTGACCATGGTTGGGG - Intronic
944370735 2:198980566-198980588 GCTCCTTTTGCCCAAGTCTAAGG + Intergenic
944537997 2:200730149-200730171 GGCTCTGTTGCCCAAGCTAGAGG - Intergenic
946312692 2:218891796-218891818 GGCCCTACTGCCCAAGTTTAAGG + Intronic
1169123061 20:3108898-3108920 GTCTCTGTTGCCCAAGCTTGAGG - Exonic
1169422180 20:5469614-5469636 TGTCCTGTTGCCCAGGGATGAGG - Intergenic
1172136529 20:32690203-32690225 GGTTCTGTTGGGCCAGTTTGTGG - Intergenic
1174148946 20:48472595-48472617 GGTGCTGCTGTTCAAGTTTGAGG - Intergenic
1174148954 20:48472648-48472670 GGTACTGCTGTTCAAGTTTGAGG - Intergenic
1174346253 20:49932275-49932297 GGCTCTGTTGCCCAAGCTGGAGG - Intergenic
1174775460 20:53339461-53339483 GGAGCTGTCTCCCAAGTTTGAGG - Intronic
1175644431 20:60658878-60658900 GGTCCTTTTGTCCGGGTTTGAGG + Intergenic
1178402526 21:32298964-32298986 GGTCCCGTTGGCCATGTCTGTGG - Exonic
1179605227 21:42511758-42511780 TGTTCTGTTGCCCAGGTTGGAGG - Intronic
1180052565 21:45338170-45338192 GCTCTTGTTGCCCAAGCTGGAGG - Intergenic
1181090346 22:20468232-20468254 GGTCCTGAAGACCAAGTTTTGGG + Intronic
1181275882 22:21687281-21687303 GGTCCTGTTGCTTAATGTTGTGG + Intronic
1182675437 22:32035687-32035709 CTTCCTGTTGCCCCAGATTGAGG + Intergenic
1185153787 22:49181396-49181418 GATGCTGCTGCCCAAGTCTGAGG + Intergenic
952380761 3:32803041-32803063 GTTCTTGTTGCTCAAGATTGTGG - Intergenic
952600242 3:35071146-35071168 GTTCCTGGTGCAAAAGTTTGGGG + Intergenic
953927327 3:46989139-46989161 GGCACTGTTGACCAAGTTGGTGG + Exonic
953993258 3:47499951-47499973 GGTGGTGTCGGCCAAGTTTGAGG + Intronic
954350865 3:50042712-50042734 GCTTCTGTTGCCCAGGTTGGAGG - Intronic
958853289 3:99354499-99354521 GCTCTTGTTGCCCAGGTTGGAGG - Intergenic
960613296 3:119574376-119574398 GCTCTTGTTGCCCAAGCTGGAGG + Intergenic
963141858 3:141952798-141952820 GGTCCTGCTGAGCAGGTTTGTGG - Intronic
964625024 3:158750408-158750430 GGTCGTCTTGCCCAGGTTTGTGG + Intronic
965821865 3:172692387-172692409 GGCTCTGTTGCCCAAGCTAGAGG + Intronic
968097297 3:195940865-195940887 GGAGCTGATGTCCAAGTTTGAGG - Intergenic
969056159 4:4404174-4404196 GGTCCTGTTGGCCGACTTGGAGG + Intronic
970838049 4:20434452-20434474 GCTCTTGTTGCCCAAGCTGGAGG - Intronic
971208049 4:24589126-24589148 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
972619559 4:40733744-40733766 GGTTCTGTTGCCCAAGCTGGAGG - Intergenic
972765149 4:42146065-42146087 GGTCCTGCTGCCAAGGTCTGAGG - Intronic
977983064 4:103348914-103348936 GGTGCTGTTGTCCCATTTTGTGG - Intergenic
980667080 4:135954332-135954354 GCTCTTGTTGCCCAGGTTGGAGG + Intergenic
982016788 4:151162625-151162647 GCTCTTGTTGCCCAAGCTGGAGG + Intronic
982021962 4:151213714-151213736 TGTTCTGTTGCCCAGGTGTGTGG + Intronic
983057138 4:163111503-163111525 TGTCCAGTGGCGCAAGTTTGGGG + Intronic
983778849 4:171643003-171643025 GGTCCTCTTGCCCAAGAGGGAGG - Intergenic
985250625 4:188021025-188021047 GCTCTTGTTGCCCAGGCTTGAGG - Intergenic
986269269 5:6217264-6217286 GGTGCTGTTTCCCAGGTATGTGG + Intergenic
988677060 5:33443035-33443057 GGTTCTGTTTCCCAACTTTTGGG + Intronic
994012918 5:94928524-94928546 TCTTCTGTTGCCCAAGTTTAAGG + Intronic
994403615 5:99315433-99315455 TGCTCTGTTGCACAAGTTTGAGG - Intergenic
1000056620 5:157612602-157612624 GCTCCTGCTGCCCAAGTCTTGGG - Intergenic
1000391795 5:160730240-160730262 GGTCCTGATGCCCATGGCTGTGG - Intronic
1001914898 5:175551749-175551771 GCTCTTGTTGCCCAAGCTGGAGG + Intergenic
1003264805 6:4556115-4556137 GGGGCTGTAGCCCAAGGTTGAGG + Intergenic
1003814049 6:9817469-9817491 GCTCTTGTTGCCCAAGCTGGAGG + Intronic
1005029663 6:21497164-21497186 GCTCTTGTTGCCCAGGTTGGAGG + Intergenic
1006127555 6:31849625-31849647 TGCCCTGTCGCCCAGGTTTGAGG + Intergenic
1006358377 6:33573826-33573848 GGTTCTGTTGGGCCAGTTTGTGG - Exonic
1006365870 6:33614858-33614880 GCTCTTGTTGCCCAGGTTGGAGG - Intergenic
1009557645 6:65194656-65194678 GGGCCTGTATCCCAAGTGTGAGG + Intronic
1010527801 6:76924783-76924805 GGTGGAGTTGCCCAAGTTTTTGG + Intergenic
1013403130 6:109818231-109818253 GCTCTTGTTGCCCAGGTTGGAGG + Intronic
1015353261 6:132247423-132247445 CCTCCTGGTACCCAAGTTTGAGG + Intergenic
1015716611 6:136199244-136199266 GGTTAACTTGCCCAAGTTTGTGG + Intergenic
1016059486 6:139614978-139615000 GGTCCTGTTACACCAGTTTTAGG + Intergenic
1017009765 6:150055339-150055361 GGTGCTGTTGTTCTAGTTTGAGG - Intergenic
1020306208 7:6837021-6837043 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1023837178 7:44075081-44075103 GCTCTTGTTGCCCAGGTTGGAGG + Intronic
1026414756 7:70167533-70167555 GGTAGTGTTGCTCAAGTTTTTGG - Intronic
1028228734 7:88280403-88280425 GGTCCTGGTGCCATATTTTGAGG + Intronic
1028781226 7:94738857-94738879 GGTACTGTTACACAAGTTTTGGG - Intergenic
1034448933 7:151127200-151127222 GGTCCTGACGCCCAAGGGTGGGG - Intronic
1035080206 7:156209451-156209473 GATCCTCTTGCCCATGTTTTGGG + Intergenic
1038280044 8:26155863-26155885 GGTCCCCTTGCCTCAGTTTGGGG - Intergenic
1038507711 8:28099918-28099940 GGTCTTGATGCCCAAGTTAAAGG + Exonic
1041290579 8:56304569-56304591 GCTCTTATTGCCCAAGTTGGAGG + Intronic
1042044343 8:64631531-64631553 GGTTCTGTTGCCCATGCTTTTGG - Intronic
1042838957 8:73104542-73104564 GGTCCTGTATCACAATTTTGGGG - Intronic
1043223011 8:77689988-77690010 GCTCTTGTTGCCCAAGCTGGAGG - Intergenic
1043315001 8:78909533-78909555 GGTGCTCCTGCCCAAGATTGGGG + Intergenic
1043690402 8:83143934-83143956 TACCCTGTTGCCCAGGTTTGAGG + Intergenic
1043777563 8:84289165-84289187 GCTGCTGTTTCCCAATTTTGTGG - Intronic
1051819834 9:21151491-21151513 GATCATTTTGCCCAAGTTGGAGG + Intergenic
1052080650 9:24202174-24202196 GGTACTGTTGCTCATGGTTGAGG + Intergenic
1053064751 9:35060096-35060118 GGCTCTGTTGCCCAGGTTGGAGG - Intronic
1053177856 9:35942202-35942224 GCTCCTGTTGCCCAAGCTGGAGG + Intergenic
1058017563 9:100052948-100052970 CATTCTGTTGCCCAAGTTGGAGG + Intronic
1060751610 9:126173490-126173512 GGTCCTGTTGGCCAAGTCTCTGG - Intergenic
1060751807 9:126174424-126174446 GGTCCTGTTGGCCAAGTCTCTGG + Intergenic
1060987168 9:127826416-127826438 ACTCTTGGTGCCCAAGTTTGAGG + Intronic
1185671225 X:1811711-1811733 GCTCTTGTTGCCCAAGCTGGAGG + Intergenic
1186109592 X:6241787-6241809 GGTTCTGTTGCCCAGGCTCGAGG - Intergenic
1186123476 X:6387391-6387413 GGCCCTGTTTCCCAGGTTTTGGG - Intergenic
1194302615 X:92206557-92206579 GCTCTTGTTGCCCAGGTTAGAGG + Intronic
1197246202 X:124169359-124169381 GCTCTTGTTGCCCAGGTTGGAGG - Intronic
1198432084 X:136577556-136577578 GGTCCTGTTGCCCTAGTTTCAGG + Intergenic
1198861379 X:141074325-141074347 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1198901313 X:141513057-141513079 GCTCCTGTTGCCCAGGCTGGAGG + Intergenic
1201486536 Y:14500784-14500806 GGTTCTGTTGCCCAGGCTAGAGG + Intergenic