ID: 1092231799

View in Genome Browser
Species Human (GRCh38)
Location 12:6779918-6779940
Sequence GTGAGTGGGAGTGAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092231794_1092231799 11 Left 1092231794 12:6779884-6779906 CCATACAGGAGAACAAAATATTG 0: 1
1: 0
2: 2
3: 33
4: 406
Right 1092231799 12:6779918-6779940 GTGAGTGGGAGTGAAACTGCTGG 0: 1
1: 0
2: 0
3: 33
4: 288
1092231792_1092231799 13 Left 1092231792 12:6779882-6779904 CCCCATACAGGAGAACAAAATAT 0: 1
1: 0
2: 1
3: 45
4: 311
Right 1092231799 12:6779918-6779940 GTGAGTGGGAGTGAAACTGCTGG 0: 1
1: 0
2: 0
3: 33
4: 288
1092231793_1092231799 12 Left 1092231793 12:6779883-6779905 CCCATACAGGAGAACAAAATATT 0: 1
1: 0
2: 2
3: 32
4: 433
Right 1092231799 12:6779918-6779940 GTGAGTGGGAGTGAAACTGCTGG 0: 1
1: 0
2: 0
3: 33
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092231799 Original CRISPR GTGAGTGGGAGTGAAACTGC TGG Intergenic
900430737 1:2602002-2602024 GTGGGTAGGAGTGGAATTGCTGG - Intronic
902918021 1:19650490-19650512 GTGAGTGAGTGTGGAACTGCAGG + Intronic
903999919 1:27333065-27333087 GTGAGTGGCAGGGAAGCTGATGG - Intronic
904363248 1:29992021-29992043 GTGAGTGGTCTTGAACCTGCAGG - Intergenic
904866697 1:33584929-33584951 ATGAGTGGGAGGGAAGCTGCTGG + Intronic
905892724 1:41527369-41527391 GTGAGTGCGAGTGTGAGTGCAGG - Intronic
906730086 1:48073597-48073619 GTGGGTGGGAGTGATTGTGCTGG - Intergenic
907073023 1:51554201-51554223 GAGAGAGAGAGAGAAACTGCAGG + Intergenic
908187907 1:61670311-61670333 ATGAGTGGGAGCTAAACTTCAGG + Intergenic
912546535 1:110455384-110455406 GTGATTGGGAGAGAAACCGCTGG - Intronic
914948098 1:152084924-152084946 GTGATTGGGAGAGAAATTGGGGG + Exonic
915718632 1:157967124-157967146 GTGAGTGGAAGTGTCACTTCTGG - Intergenic
916487270 1:165270980-165271002 GTGATTGGGAGGGAAATGGCTGG - Intronic
916646762 1:166794316-166794338 GTGAGTGGGTGAGAAAAAGCTGG + Intergenic
918488414 1:185054092-185054114 GTGTCTAGAAGTGAAACTGCCGG + Intronic
920202197 1:204266444-204266466 CAGAGTGGGAATGAAACTGGAGG - Intronic
920613382 1:207464778-207464800 GTGAGTTGGGCTGAAACTTCAGG + Intronic
921132716 1:212233529-212233551 GTTAGTAGGAATGAAACTCCTGG + Intergenic
922578043 1:226676311-226676333 GTGAGTGTGTGTGGACCTGCTGG - Intronic
923520083 1:234728590-234728612 GTGGGTCAGAGTGAACCTGCAGG + Intergenic
924402569 1:243702272-243702294 TTGAGTGGGAAAGAAACTGAAGG - Intronic
1062822397 10:544445-544467 ATGCCTGGGAGTGAAATTGCTGG + Intronic
1062909401 10:1202888-1202910 GTGAGTGGCTGTGATGCTGCAGG + Intronic
1063139970 10:3247372-3247394 GACGGTGGCAGTGAAACTGCGGG + Intergenic
1063469488 10:6272979-6273001 GTGAGTGGGGCTGAGATTGCAGG + Intergenic
1063584638 10:7340850-7340872 GTAACTGGGACAGAAACTGCAGG + Intronic
1065350556 10:24791875-24791897 GTGAGTGGGAGTGAAACAATGGG - Intergenic
1069238088 10:66103357-66103379 ATAACTGGGAGTGAAATTGCTGG - Intronic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1073215617 10:101834471-101834493 GAGAGTGGGAGGGAGGCTGCAGG - Intronic
1073817115 10:107219955-107219977 TTGACTGGGAGGGAAACTGAGGG + Intergenic
1074733251 10:116399726-116399748 GTGAGTGTGAGTGAATGTGAAGG + Intergenic
1075491625 10:122876264-122876286 GTTAGTGGTAGTGAATCTGCAGG - Intronic
1076794254 10:132791121-132791143 GTGGGTGGGAGAGATGCTGCAGG - Intergenic
1077735466 11:4786123-4786145 CTGGGTGTGTGTGAAACTGCAGG + Intronic
1080633971 11:34107158-34107180 GGGAGTGGTAGTGGAGCTGCAGG - Intronic
1080766560 11:35302747-35302769 ATGCGTTGGAGTGAGACTGCAGG - Intronic
1081747539 11:45483569-45483591 GGGGGTGGGAATGAAGCTGCCGG + Intergenic
1081994950 11:47358265-47358287 GTGAGTGGGGGTGTGACAGCAGG - Intronic
1082757649 11:57093577-57093599 GTGAGGGAGAGGGAAAGTGCTGG - Intergenic
1082827516 11:57591326-57591348 GTAAGTGAGAGGGAAACTTCTGG + Intergenic
1083155824 11:60822219-60822241 TGAAGTGGGAGTGAAGCTGCAGG + Intergenic
1083969039 11:66061333-66061355 GGGAGTGGTAGAGAAATTGCTGG + Intronic
1084460073 11:69292231-69292253 GTGAGACTGAGTGACACTGCGGG + Intergenic
1084512956 11:69617504-69617526 GTGAGTGTGGGGGAAACTGTAGG + Intergenic
1085259486 11:75196016-75196038 GGTGGTGGGAGTGAGACTGCAGG + Intronic
1085322211 11:75582326-75582348 TGGAGAGGGAGTGAAAGTGCAGG + Intergenic
1085803352 11:79611791-79611813 GAGTGTGGGAGGAAAACTGCAGG + Intergenic
1086014598 11:82151580-82151602 ATAACTAGGAGTGAAACTGCAGG + Intergenic
1086549656 11:88041256-88041278 GTGAGTGGGACTGAAAACGCAGG - Intergenic
1087016007 11:93555283-93555305 GTGAGTGGTAGAGAAAATGTTGG - Intergenic
1087502435 11:98974946-98974968 GTCAGTGGGAGAGAACCTACTGG + Intergenic
1088186573 11:107177323-107177345 GTGAGTGGAAGGGAAAGTGCAGG + Intergenic
1088703970 11:112444160-112444182 ATGCCTGGGAGTGAAATTGCTGG + Intergenic
1088749997 11:112835321-112835343 GTGTGTGGAAATGAGACTGCAGG - Intergenic
1092231799 12:6779918-6779940 GTGAGTGGGAGTGAAACTGCTGG + Intergenic
1092323267 12:7501388-7501410 GAGAGTGGAAGTGAAAGTCCAGG - Exonic
1092477294 12:8829906-8829928 GTGCGTGGGACTGGAAGTGCTGG + Intronic
1092926384 12:13276103-13276125 GTGGGTGGGAGTGAGGCAGCAGG + Intergenic
1094424151 12:30301460-30301482 CTGAGTGGGAGAGGCACTGCAGG + Intergenic
1095301614 12:40590729-40590751 GTGAAAGGGAGTGAAACTTGTGG + Intergenic
1096122615 12:49097921-49097943 GTGAGAGGGAGTGAGGGTGCAGG - Intronic
1096235878 12:49925972-49925994 GTGTGTGGGAGTGACAGAGCAGG - Intergenic
1096529064 12:52232146-52232168 TTGACTGGGTTTGAAACTGCTGG + Intergenic
1097165931 12:57086993-57087015 GTGTGTGAGAGTGAAACTACCGG - Intronic
1097614985 12:61872854-61872876 GAGAGAGAGAGAGAAACTGCAGG - Intronic
1100403861 12:94255963-94255985 GTGAGTGGGTGAGAAAATGGAGG - Intronic
1101455247 12:104824887-104824909 GTGAGTGAATGTGAAACTGTCGG + Intronic
1104061887 12:125275614-125275636 GTGAGTGGGAGTTGAACAGATGG + Intronic
1108104597 13:46995399-46995421 GTGAGTGTGAGTGAATGTGAAGG + Intergenic
1109118034 13:58414839-58414861 CTGAGTGTGAGTGATACTTCTGG - Intergenic
1109579167 13:64303057-64303079 ATGATTAGGAGTGAAAATGCTGG - Intergenic
1110362418 13:74642679-74642701 GTGGGTGGGAGAGACATTGCAGG + Intergenic
1111544616 13:89715441-89715463 TTGAGAGGAAGTGACACTGCAGG - Intergenic
1111669499 13:91311805-91311827 GGGTGTGGGAGGGAAATTGCAGG - Intergenic
1112752795 13:102598656-102598678 ATGAGTGGGAGGAAAACAGCTGG + Intronic
1113896950 13:113770644-113770666 GTGGGTGGGAGAGGAAATGCCGG - Intronic
1114567265 14:23641807-23641829 TTGAGTGGGAGTGAGATTGGGGG + Intronic
1117008640 14:51447749-51447771 GTGAGTAGGATTGAGACAGCTGG - Intergenic
1117582073 14:57161447-57161469 ATGAGTGACAGTGAATCTGCTGG - Intergenic
1119060555 14:71469907-71469929 GTGAGTGGGATGGGAACTGAAGG + Intronic
1120446764 14:84607909-84607931 CTGAGTGGGAGAGGAAATGCAGG - Intergenic
1121370852 14:93357066-93357088 GTAAGTGGGAGTGAAACATGGGG - Intronic
1121907854 14:97763905-97763927 GTGACTGGGCATGAAATTGCAGG - Intronic
1122979800 14:105186367-105186389 GTGTGTGGGAGTGAATGTGGGGG + Intergenic
1122979840 14:105186503-105186525 GTGTGTGGGAGTGAATGTGGGGG + Intergenic
1122979880 14:105186639-105186661 GTGTGTGGGAGTGAATGTGGGGG + Intergenic
1124396269 15:29304713-29304735 GGGAGAGGGAAGGAAACTGCAGG - Intronic
1124880931 15:33641924-33641946 GTGAGAGGGAGTGAGTCTTCAGG - Intronic
1125394037 15:39227302-39227324 GTGGGTGGGGGTGAAACTTCTGG + Intergenic
1126215798 15:46153544-46153566 GTGAGTGGGGGAGAGACTGCAGG - Intergenic
1126691180 15:51289984-51290006 GTGAGTGGAAGTGATATAGCAGG + Intronic
1127486988 15:59427916-59427938 GTATCTGGCAGTGAAACTGCTGG + Intronic
1128283164 15:66414110-66414132 GTGAGTTGGAGATAACCTGCAGG - Intronic
1128780168 15:70353972-70353994 GGGTGTGGGGGTGGAACTGCAGG + Intergenic
1128783393 15:70377533-70377555 GTGAGAGGGAGTGTCACTGTGGG + Intergenic
1128944648 15:71812177-71812199 GTGAGTGGGAGAGCAGCTGAGGG + Intronic
1128990996 15:72260419-72260441 GAGGGTGGGAGTGGAACTGTGGG - Intronic
1129580545 15:76804476-76804498 GTGATTGCTATTGAAACTGCTGG + Intronic
1130121350 15:81050407-81050429 GTGTGAGGGAGTGAAACTGAGGG + Intronic
1130283756 15:82539241-82539263 GTGAAGGGTCGTGAAACTGCGGG - Intronic
1131388094 15:92024331-92024353 GGGAGTGGGAATGAAAGTGAGGG - Intronic
1131463500 15:92636773-92636795 GTGAGTGGGGGTGACAGAGCAGG - Intronic
1131974432 15:97929970-97929992 CTGGGTAGGACTGAAACTGCAGG + Intergenic
1133688682 16:8191574-8191596 GTGAGTCTGAGTGAGACTCCAGG + Intergenic
1135169583 16:20171550-20171572 ATGCCTGGGAGTGAAACTGTTGG + Intergenic
1136185949 16:28589165-28589187 GTGAGTGGGAGAGAACATGCTGG + Intronic
1137362846 16:47835437-47835459 GGCAGTGGGATTCAAACTGCTGG + Intergenic
1137848398 16:51714135-51714157 GTCAGTGGGTGGGAAAGTGCTGG - Intergenic
1138561388 16:57802645-57802667 GGGAGTGGGAGTGGGAGTGCCGG - Intronic
1138703644 16:58892343-58892365 GTGAGTGGGAGTGGTAGTGGTGG - Intergenic
1139332013 16:66200199-66200221 GTATGTAGGAGTGAAATTGCCGG - Intergenic
1140296608 16:73715167-73715189 GTGATGGGAAATGAAACTGCAGG - Intergenic
1140999749 16:80297326-80297348 GAGGGTGGAAGTGACACTGCTGG - Intergenic
1141787146 16:86209171-86209193 GGCAGTGGGAGAGAAACTACTGG + Intergenic
1141869263 16:86773423-86773445 GTGAGAGGGAGGGGAACTGAGGG + Intergenic
1142250298 16:88988928-88988950 GTGGGTGGGAAGGAGACTGCTGG - Intergenic
1143216529 17:5229249-5229271 GTGAGTGGGAGAGCAACTGAAGG + Intronic
1143457816 17:7079031-7079053 GAGTTTGGGAGTGAAACTGGAGG + Intronic
1143888227 17:10082624-10082646 GTACGTAGGAGTGAAATTGCTGG - Intronic
1143943061 17:10563227-10563249 GTGAGTAGGAGTGAACGTGAAGG + Intergenic
1144013670 17:11173693-11173715 ATAACTGGGAGTGAAATTGCTGG - Intergenic
1146409724 17:32572216-32572238 GCGAGGGGGAGTAAAAGTGCTGG - Intronic
1147562782 17:41519380-41519402 GTGAGTGAGTGAGAGACTGCAGG + Exonic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148496648 17:48056926-48056948 GGGAATGGGAGGGAGACTGCAGG + Intronic
1148782125 17:50128444-50128466 GTGTGTGGGAGTGAGAGTGGGGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151020745 17:70614559-70614581 GTGAGTGGTAGTGAATGTGAAGG - Intergenic
1152471663 17:80492935-80492957 GGGGGTGAGAGTGACACTGCGGG - Intergenic
1152520047 17:80850266-80850288 GTGAGTGGGAGCTAAACAACGGG - Intronic
1152968317 18:137418-137440 GTGCGTGGGAGGGAAACAGCAGG - Intergenic
1153028538 18:692214-692236 GTTAGTGGGAATGGAACTACTGG - Intronic
1153236357 18:2992063-2992085 GTACCTGGGAGTGAAATTGCTGG - Intronic
1153652134 18:7250188-7250210 GTGAGCTGGATTGAATCTGCAGG - Intergenic
1153699393 18:7677662-7677684 GTGAGTAGGAGGGAAGTTGCAGG - Intronic
1154290949 18:13106301-13106323 GTGAGTGGGAGTGGTAGTGGTGG - Intronic
1155392424 18:25350788-25350810 GTGAGTGTGAGTGTGAGTGCGGG - Intronic
1155757945 18:29525294-29525316 TTGAGTGGGAGTGAAAAAGAGGG - Intergenic
1157168182 18:45377691-45377713 GGAAGTGGGAGTGAAAATGCAGG - Intronic
1157526761 18:48389113-48389135 GTGAGTAGCAGGGTAACTGCAGG + Intronic
1157727331 18:49974766-49974788 GTGTGTGTGAGAGAGACTGCTGG - Intronic
1158660766 18:59385564-59385586 GGGAGTGGAAGACAAACTGCAGG + Intergenic
1159683833 18:71391422-71391444 ATGACTGGGATTGAAACTACAGG + Intergenic
1160174372 18:76580513-76580535 GTGACTGGGTGTGGAACTGGTGG + Intergenic
1160945703 19:1642810-1642832 GTGTCTGGGAGTGGAATTGCTGG - Intronic
1161777439 19:6271298-6271320 GTGCTTGGGAATGAAAATGCTGG - Intronic
1162039450 19:7961256-7961278 ATGTGTGGGAGTGAGACTCCAGG + Exonic
1163310756 19:16513164-16513186 CAGAGTGGGTGTGAATCTGCAGG - Intronic
1164814665 19:31186180-31186202 GTGTGTAGGAGTGGAATTGCTGG + Intergenic
1165934815 19:39382959-39382981 GAGAGTGGAATTGAAACTGAAGG - Intronic
1166311185 19:41963514-41963536 GTGCCTGGGAGTGGAATTGCTGG - Intergenic
1167024395 19:46904700-46904722 GTGGATGAGAGTGAAACAGCAGG + Intergenic
1167300353 19:48674166-48674188 GTGAGTCAGAGTGGAACTTCGGG + Intergenic
925245578 2:2379655-2379677 ATGACTGGGACTGAAACAGCTGG - Intergenic
925298492 2:2793519-2793541 ATGAGTGGCAGTGACACAGCGGG - Intergenic
926273468 2:11385785-11385807 GTGCCTGGGAGTGAAATTGCTGG + Intergenic
926940155 2:18127120-18127142 GTGAGTGGGGTTCAAACTCCCGG - Intronic
928081492 2:28316380-28316402 GGGAGTGGGAGTGGAAATGGGGG + Intronic
928117086 2:28553364-28553386 CTGTGTGTGAGTGAATCTGCAGG - Intronic
929035822 2:37690626-37690648 GGGAGTGGGTGTGAAGTTGCAGG - Intronic
931262125 2:60629528-60629550 GAGAGTTGGTGTGATACTGCAGG + Intergenic
931429639 2:62197724-62197746 GGGACTGGGAGTGAAAAGGCGGG + Intronic
937364019 2:121248029-121248051 GTCACTGGGAAGGAAACTGCAGG - Intronic
938210170 2:129460353-129460375 GTGTGTGCGTGTGAACCTGCAGG + Intergenic
938620262 2:133044701-133044723 ATAAGTAGGAGTGAAATTGCTGG - Intronic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
942486167 2:176442245-176442267 GTTAGTGGGAATTAAAATGCCGG - Intergenic
942746809 2:179243688-179243710 GTAAGTGGGAGCTAAACTACGGG + Intronic
942828469 2:180209808-180209830 CTGGGTGGGAGTGAAATTTCTGG + Intergenic
943503520 2:188723012-188723034 GTGATTGGTTGTGAAAATGCGGG + Intergenic
944890133 2:204108929-204108951 GGAAGTGGGAGGGAAACTGGAGG + Intergenic
945155952 2:206837848-206837870 GTGAGTGGAAGTGGAACTTTGGG + Intergenic
945421220 2:209639433-209639455 GTGAGTGGGACTGAAACAAGGGG - Intronic
1168753692 20:301146-301168 GTGAGAGGGAGGGAAACCGCTGG - Intergenic
1168997883 20:2146264-2146286 GAGAGTGGCACTGAAACTACAGG - Exonic
1169248081 20:4039394-4039416 GTGACTGGAAGTGGAATTGCTGG - Intergenic
1170175268 20:13461703-13461725 GTAGGTGGGATTGAACCTGCAGG + Intronic
1170964162 20:21051731-21051753 ATGCCTGGGAGTGAAATTGCTGG + Intergenic
1172040536 20:32041547-32041569 GTGAGTGATAGTGACAGTGCTGG - Intergenic
1172916655 20:38448361-38448383 CTGAGTGGCAGTGACTCTGCTGG - Intergenic
1173331584 20:42080144-42080166 GTGGGAGGGGGTGGAACTGCAGG - Exonic
1173903655 20:46609881-46609903 GTGTCTGGGAGCAAAACTGCTGG + Intronic
1175172878 20:57092432-57092454 GTGTGTGTGAGTGAATGTGCAGG - Intergenic
1175213329 20:57375475-57375497 GTGAGCGGGAAAGACACTGCAGG - Intronic
1176038626 20:63052553-63052575 GGGACAGGGAGAGAAACTGCAGG + Intergenic
1177575244 21:22946145-22946167 AAGAGTGTGAATGAAACTGCAGG + Intergenic
1178388149 21:32173424-32173446 ATTTGTAGGAGTGAAACTGCTGG - Intergenic
1182427210 22:30280682-30280704 GTGAGTGTGAGTGAATGTGAAGG - Intergenic
1183731867 22:39622714-39622736 GTGGGTGGGAGAGGGACTGCTGG + Intronic
1184192341 22:42903220-42903242 GTGAGAGGTAGTGACTCTGCAGG - Intronic
1184816411 22:46875037-46875059 GTGTGAAGGAGTGGAACTGCTGG - Intronic
1184956576 22:47890933-47890955 GTGAGTGGGAGGCAAACGGAAGG - Intergenic
949118413 3:356741-356763 GTGAGTGTGACTGAAGCTGAGGG + Intronic
950386579 3:12664759-12664781 GTGTCTAGAAGTGAAACTGCCGG - Intergenic
951744175 3:25959050-25959072 GCGAGTGGGAATGAAGCAGCAGG - Intergenic
953525936 3:43690393-43690415 TCGAGTGGGAGGGAAATTGCTGG + Intronic
954502939 3:51037985-51038007 ATTACTGGGAGTGGAACTGCTGG + Intronic
954866229 3:53732273-53732295 GTGATGGGGAGGGAAAGTGCAGG + Intronic
956225097 3:66948504-66948526 GTGGATGGAAGTGAAATTGCTGG + Intergenic
956370305 3:68551801-68551823 GGGAGTGGGAGTGAACCAGTGGG + Intergenic
957151644 3:76493975-76493997 ATGCCTGGGAGTGAAATTGCTGG - Intronic
958948658 3:100393376-100393398 ATAAGTGGGAGCTAAACTGCAGG + Intronic
960001309 3:112734924-112734946 GTGAAGTGGAGTGAAACTGGAGG - Intergenic
961474932 3:127140542-127140564 GGGAGGGGGAGTGAGACAGCAGG + Intergenic
962166461 3:133054298-133054320 CTGAGTGGTAGGGAAATTGCTGG + Intronic
964333901 3:155634451-155634473 GTGAGTGGGACTGAAACCATGGG + Intronic
966194171 3:177297350-177297372 ATGAGTGGAAGGGAAAGTGCAGG - Intergenic
970920691 4:21390823-21390845 ATTTTTGGGAGTGAAACTGCTGG + Intronic
970929771 4:21496196-21496218 GTGATTGAGAGTGAGACTACAGG + Intronic
971389865 4:26175666-26175688 GTCAGTGGGAGTGACACCACAGG - Intronic
971423104 4:26491704-26491726 GTGAGTGAGAGGCAAACAGCAGG + Intergenic
972476836 4:39458635-39458657 CTGAGTGGGAGTTCGACTGCTGG - Exonic
973891541 4:55372373-55372395 ATGAGTGGGAGAGAGACAGCAGG - Exonic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
979686471 4:123515730-123515752 TTGAGGGGGAGTGTAACTGAGGG - Intergenic
981292999 4:143098127-143098149 GAGACAGGGAGTGACACTGCTGG - Intergenic
981909738 4:149964980-149965002 GAGAGTTGGAGTAAATCTGCGGG - Intergenic
985894702 5:2741285-2741307 GTTAGTGGGACTGAGACTGCTGG - Intergenic
985897294 5:2756312-2756334 CTGAGCGGGAGAGAAACTTCAGG - Intergenic
986196101 5:5537423-5537445 GTGAGTGAGAGAGAAGCTGTGGG + Intergenic
986520222 5:8607787-8607809 GTGAGTGTGACTAGAACTGCAGG + Intergenic
988791895 5:34616115-34616137 GAGAGAGGGAGGGAGACTGCTGG + Intergenic
990279384 5:54233026-54233048 GAGTGAGTGAGTGAAACTGCTGG + Intronic
990792516 5:59496860-59496882 TTCAGTGGGAGTGGAATTGCTGG - Intronic
991147851 5:63328000-63328022 ATGAGTGGGAGTTAAACACCAGG - Intergenic
991419394 5:66426036-66426058 GTGGTAGGGAGGGAAACTGCTGG + Intergenic
991511761 5:67385506-67385528 GTGAGTGAGAGAGAAACTTCAGG - Intergenic
994841273 5:104928169-104928191 GAGAGTGGCAGTGAACCTGGTGG + Intergenic
995016553 5:107316301-107316323 GGGAGACGGAGAGAAACTGCTGG + Intergenic
995267106 5:110175099-110175121 GTGAGAGGGAATGAGACTACAGG + Intergenic
995478242 5:112569452-112569474 GTGAGTGGGACTGACAGTGGTGG - Intergenic
996562857 5:124849736-124849758 TTGAGTGGGATTGAAAATGATGG + Intergenic
999977076 5:156922308-156922330 GTGAAATGTAGTGAAACTGCTGG - Intronic
1000770713 5:165350237-165350259 GTGAGTATGAGTGAAAGTGGTGG - Intergenic
1001032024 5:168269989-168270011 GTGGTTGGGAGTGAAAGTGAAGG - Intergenic
1001160536 5:169308691-169308713 GTGGATGTGAGTGAAAGTGCTGG + Intergenic
1001756759 5:174176316-174176338 GTGAGTGTTAGTGAAATTGCTGG + Intronic
1002577984 5:180187960-180187982 GTAACTGGGAGTGGAATTGCTGG - Intronic
1003159617 6:3624058-3624080 CTGAGTGGGAGGGAAAAGGCAGG - Intergenic
1004401692 6:15294566-15294588 GTGAGGAGGAGTGAAAGTGCAGG + Intronic
1005168094 6:22948948-22948970 GTGAGAGTGGGTGAAGCTGCTGG + Intergenic
1006821283 6:36897746-36897768 GTGATTGGGAGGCACACTGCTGG + Intronic
1010067666 6:71704007-71704029 GTGTGTCTGAGTGAAACTCCAGG + Intergenic
1010309625 6:74369596-74369618 GTGAGTGGGAGTGAATGTGAAGG - Intergenic
1011842302 6:91516804-91516826 GTGTGTCTGAGGGAAACTGCTGG + Intergenic
1012971075 6:105731815-105731837 GGGGGTGGGAGGGAGACTGCTGG - Intergenic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1014400332 6:120981215-120981237 GTGAGTTGAAGTTAAACTGCTGG - Intergenic
1016511977 6:144853147-144853169 GTGTGTATGAGAGAAACTGCAGG - Intergenic
1017564164 6:155666365-155666387 GTGAGGTGGAGTCAAGCTGCAGG + Intergenic
1018473833 6:164121235-164121257 GGGAGTGGGATTGAAGCTGGAGG + Intergenic
1019428799 7:989098-989120 GTGGGTGGGAGTGCAGCTTCAGG - Exonic
1019576448 7:1739862-1739884 GGGAGGGGGATGGAAACTGCTGG + Intronic
1019875665 7:3808361-3808383 TTCAGAGGGAGTGAACCTGCTGG - Intronic
1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG + Intronic
1023865063 7:44234574-44234596 GGGCGTGGGGGTGAAGCTGCAGG + Intronic
1024142204 7:46473128-46473150 GTGCCTGGAAGTGAAATTGCTGG + Intergenic
1024804201 7:53117596-53117618 GTGAGTGACAGGGAAACTGATGG + Intergenic
1025023833 7:55499816-55499838 GTGAGGGGGAGTGAGACACCTGG + Intronic
1027266846 7:76499201-76499223 GTGACCTGGAGGGAAACTGCTGG - Intronic
1027318663 7:76999061-76999083 GTGACCTGGAGGGAAACTGCTGG - Intergenic
1027957668 7:84902299-84902321 GTTAGTGTGAGTGAAAAGGCAGG + Intergenic
1031601571 7:123716607-123716629 GGGAGGGAGAGTGCAACTGCAGG + Intronic
1032168025 7:129561051-129561073 GTGAGTGAGAGGGAAACAGCTGG - Intergenic
1032238285 7:130142317-130142339 CTGCGTGGGAGTGTGACTGCTGG + Intergenic
1032410808 7:131692306-131692328 GTGAGTGGGTGTGTGCCTGCCGG + Intergenic
1032608600 7:133386658-133386680 CTGAGTGGAAGTGAAATTGTAGG + Intronic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035943627 8:3933450-3933472 GTGGGTGGGAGTGAAGATGTAGG - Intronic
1036647207 8:10618776-10618798 GAGAGTGGGATAGAAACAGCTGG - Intronic
1038415792 8:27394540-27394562 GTGAGTGTGAGTGAATGTGATGG + Intronic
1041225567 8:55694106-55694128 CTGTCTGGGAGTGAAACTGCTGG + Intergenic
1041253990 8:55963222-55963244 GTGAGTGGGAGTGGATTTGCTGG + Intronic
1041321000 8:56612401-56612423 GAGAGGCTGAGTGAAACTGCAGG + Intergenic
1041756845 8:61323313-61323335 TGGAGTAGGAGTGACACTGCAGG - Intronic
1042653284 8:71067074-71067096 GTGGGTGGGAGAGATACTACTGG - Intergenic
1043321294 8:78989696-78989718 GTCAGTGCAAGTGAGACTGCAGG + Intergenic
1043373643 8:79622911-79622933 CGGAGTGGGAGTGAAACTGATGG - Intronic
1043421452 8:80102789-80102811 GGGAGTGGGACTGAAATTTCCGG - Intronic
1043528006 8:81117402-81117424 GTGAGTGCTAGTGAGAATGCAGG + Intergenic
1044370634 8:91406429-91406451 GTGAGTGTGATTGGAACAGCAGG + Intergenic
1044748621 8:95395055-95395077 GTGAGTGGGAGAGGAAGTGAAGG + Intergenic
1049472336 8:142782095-142782117 AGGAGTGGGAGCGAACCTGCAGG - Intergenic
1049763123 8:144339698-144339720 GTGGGTGAGAATGCAACTGCAGG - Intergenic
1049809777 8:144561181-144561203 GTGAGTCCGATGGAAACTGCTGG - Intronic
1050132644 9:2428689-2428711 TTGAGTGGGAGTCAAACTGTTGG + Intergenic
1052798645 9:32947022-32947044 ATGAGTGGAAGGGAAAGTGCAGG + Intergenic
1056961448 9:91127820-91127842 GTGAGTGGGGGTGAATGTGAAGG - Intergenic
1057793102 9:98137119-98137141 GTGAGTGAGACTGAAGCTGCTGG + Intronic
1058699410 9:107588188-107588210 GTGAGTGTGAGTGTATATGCTGG - Intergenic
1060015758 9:120084898-120084920 GTGACAGGGAGTGACTCTGCTGG - Intergenic
1060560912 9:124542576-124542598 GTGAGGGTGAGTAAAACTGAGGG - Intronic
1060803440 9:126558961-126558983 GTGACTGGGAGTGGAAAGGCAGG - Intergenic
1060866523 9:127003604-127003626 ATGTGTGGGAGTGAAATTGCTGG + Intronic
1061425361 9:130494925-130494947 GCGAGTGGAAGGGAAAGTGCAGG + Exonic
1062128207 9:134877805-134877827 TTGTGTGGGAGGGAAACTTCTGG + Intergenic
1062391273 9:136334877-136334899 GTGAGTGGGGGTGGCCCTGCTGG + Intronic
1186913587 X:14195729-14195751 GAGAGAGAGAGTGAAAGTGCAGG - Intergenic
1187265229 X:17726057-17726079 GTGAGTGGAGGAGAAGCTGCAGG - Exonic
1188605709 X:32026935-32026957 GTGAGTGGGAGTTATGTTGCAGG - Intronic
1189090736 X:38080061-38080083 GTGAGGGGGAGACAAACTCCAGG + Intronic
1189126674 X:38455343-38455365 GAGAGTGGGAGAGAAACTTTGGG - Intronic
1189126746 X:38456235-38456257 GAGAGTGGGAGAGAAACTTTGGG - Intronic
1189257245 X:39649996-39650018 GGGAGGGGGAGAGAAAATGCTGG + Intergenic
1190234590 X:48605892-48605914 GTGAGTGGGAGTCATAGTGTAGG + Exonic
1190617582 X:52251636-52251658 GTAAGTGGTAGTGATAATGCAGG - Intergenic
1190709520 X:53056512-53056534 GTGAGTGTGAGTGAATCTGGGGG + Intronic
1190905980 X:54728788-54728810 GACAGTGGTAGGGAAACTGCAGG + Intergenic
1191046677 X:56145435-56145457 GTAACTGGGAGTGAAATAGCTGG - Intergenic
1193610985 X:83631267-83631289 GTGAGTGGGAGGGAGCATGCAGG + Intergenic
1194067983 X:89285096-89285118 GTGAGTGAAAGTGTGACTGCAGG - Intergenic
1195208441 X:102626525-102626547 GTGAGTGAGTGAGAAACTTCAGG - Intergenic
1195246843 X:103002675-103002697 GTGAGTGAGAGTAAAGCAGCTGG + Intergenic
1195697428 X:107677228-107677250 CTGAGTGGGAGGGAGACAGCTGG + Intergenic
1196047077 X:111267685-111267707 GTGAGTGGGAGAGAACATGAGGG + Intronic
1196434942 X:115665924-115665946 GTGAGTGGAAGGGAAAGTGCAGG + Intergenic
1196707626 X:118729218-118729240 GTGTGTGGGAGTGAGTCTGTAGG - Intronic
1198154532 X:133945828-133945850 GTGAGAGGGTGTGCAAGTGCAGG - Intronic
1200722127 Y:6619257-6619279 GTGAGTGAAAGTGTGACTGCAGG - Intergenic
1201237172 Y:11922721-11922743 GTGAGTGGAAGGGAAAGTGCAGG - Intergenic