ID: 1092233836

View in Genome Browser
Species Human (GRCh38)
Location 12:6793209-6793231
Sequence CAGAACAGGGAGCTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 805
Summary {0: 1, 1: 1, 2: 5, 3: 87, 4: 711}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092233829_1092233836 8 Left 1092233829 12:6793178-6793200 CCACTTAGCAGAGCCTTGGGGTG 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG 0: 1
1: 1
2: 5
3: 87
4: 711
1092233822_1092233836 21 Left 1092233822 12:6793165-6793187 CCCACAGCCTCCTCCACTTAGCA 0: 1
1: 1
2: 1
3: 29
4: 235
Right 1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG 0: 1
1: 1
2: 5
3: 87
4: 711
1092233823_1092233836 20 Left 1092233823 12:6793166-6793188 CCACAGCCTCCTCCACTTAGCAG 0: 1
1: 0
2: 4
3: 46
4: 453
Right 1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG 0: 1
1: 1
2: 5
3: 87
4: 711
1092233824_1092233836 14 Left 1092233824 12:6793172-6793194 CCTCCTCCACTTAGCAGAGCCTT 0: 1
1: 0
2: 1
3: 15
4: 227
Right 1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG 0: 1
1: 1
2: 5
3: 87
4: 711
1092233831_1092233836 -5 Left 1092233831 12:6793191-6793213 CCTTGGGGTGAGATGAGGCAGAA 0: 1
1: 0
2: 1
3: 32
4: 257
Right 1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG 0: 1
1: 1
2: 5
3: 87
4: 711
1092233826_1092233836 11 Left 1092233826 12:6793175-6793197 CCTCCACTTAGCAGAGCCTTGGG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG 0: 1
1: 1
2: 5
3: 87
4: 711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092233836 Original CRISPR CAGAACAGGGAGCTGGAGGC AGG Intronic
900122227 1:1053687-1053709 CAGGACAGGGTGGGGGAGGCGGG - Intronic
900125749 1:1068377-1068399 GGGAAGAGGGAGCTGGGGGCGGG - Intergenic
900204117 1:1424423-1424445 ATGAACACGGAGCTGGAGGCTGG + Intergenic
900238001 1:1601541-1601563 CAGAGGTGGGAGCTGGGGGCAGG - Intergenic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900488478 1:2934804-2934826 CAGGGCTGGGGGCTGGAGGCCGG - Intergenic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900616796 1:3569149-3569171 CTGAACAGGCGGCTGGTGGCGGG - Intronic
900623406 1:3597434-3597456 CAGAACAAGCAGCGGGAGACAGG - Intronic
901159370 1:7163322-7163344 GAGACCAAGGAGCGGGAGGCCGG + Intronic
901453937 1:9352744-9352766 CATAACAGGGAGGTTGAGGGGGG - Intronic
901781638 1:11598313-11598335 CAGAGCAGGGATCTGAAGGCAGG - Intergenic
901930044 1:12591361-12591383 CAAAACAGGGGCCTGGAGCCAGG - Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902727501 1:18346927-18346949 CTGGTCAGGGAGCTGGAGGAAGG + Intronic
902756288 1:18551232-18551254 CAGCCCATGGAGCTGGATGCTGG - Intergenic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
903363286 1:22790568-22790590 GAGAACAGGGATCTGGAGACAGG - Intronic
903663705 1:24994339-24994361 CAGAACCAGGAGCTGGAATCAGG - Intergenic
903682292 1:25105042-25105064 CAGCACAGGGATCTGAAGGAAGG - Intergenic
903790105 1:25886971-25886993 CAGAACAGGGTGGTGGGGACCGG - Intronic
904109332 1:28113112-28113134 CAGAATAGAGAACTGGAGGCGGG + Intergenic
905277334 1:36826969-36826991 CAGAACATGGGGCTGAAGGAGGG - Intronic
905349223 1:37333107-37333129 CAGAGGAGTGAGCTGCAGGCAGG - Intergenic
906360243 1:45150579-45150601 CAGAAAGGGGAGCTGGAAGGTGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906725067 1:48038434-48038456 CTGAACAAAGACCTGGAGGCAGG + Intergenic
906836243 1:49086016-49086038 GAGACCACGGGGCTGGAGGCTGG - Intronic
907241969 1:53085895-53085917 GAGAGCAGGGGACTGGAGGCAGG + Intergenic
907313603 1:53553851-53553873 CAGAACGGGCAGGTGGAGGATGG + Intronic
907828827 1:58044670-58044692 CAGAACTGGGATCTGAAGTCTGG - Intronic
908232505 1:62119691-62119713 CAGCACTGGGAGTTCGAGGCGGG + Intronic
908696959 1:66854553-66854575 CAGCACTGGGAGGCGGAGGCAGG + Intronic
908759724 1:67500591-67500613 CAGGCCAGGGAGCTCGAGCCTGG - Intergenic
909012297 1:70348356-70348378 CAGGACTGGGAGGTGGAGGTTGG - Intronic
910240926 1:85085412-85085434 CTGAACAGGGATATGGAGGAAGG + Intronic
912322550 1:108727797-108727819 GACAACAGGGAGCTGAAAGCAGG - Exonic
912390350 1:109298310-109298332 CACAGCAGGCAGCTGGATGCAGG - Intronic
912630468 1:111242409-111242431 CAGAACAGGGCACAGGAGACTGG + Intronic
912865217 1:113250408-113250430 CAGAAAAGGGGAGTGGAGGCTGG + Intergenic
913971889 1:143422662-143422684 CACCACAGGGAGCTGGCGGGAGG + Intergenic
914066268 1:144248275-144248297 CACCACAGGGAGCTGGCGGGAGG + Intergenic
914112885 1:144718079-144718101 CACCACAGGGAGCTGGCGGGAGG - Intergenic
914342806 1:146774684-146774706 AAAACCAGGCAGCTGGAGGCTGG - Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
914350531 1:146835967-146835989 CAGGAGAGGGAGCTGGGAGCTGG - Intergenic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915468080 1:156109393-156109415 GAGAAGTGGGAGGTGGAGGCAGG - Intronic
915588527 1:156858055-156858077 CAGGACAGGGCCCTGGAGGCAGG + Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916163060 1:161938920-161938942 CAGAAAAGTGAGCTGGTGACTGG - Intronic
916979213 1:170115541-170115563 CAGAAGTGGAAGCTGAAGGCAGG - Intergenic
917336797 1:173931918-173931940 CTGAACAGGGGGGTGGAGGCAGG + Exonic
917854533 1:179090032-179090054 AAGGACAGGCAGCTGGAGGGTGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918126681 1:181590074-181590096 CAACATAGGGAACTGGAGGCAGG - Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919943029 1:202301423-202301445 CAGTTCAGGGAGGTGGAGGGAGG - Intronic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920294502 1:204947556-204947578 CAGCAGTGGGAGCTGGAGGCTGG - Intronic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
921186818 1:212677660-212677682 CAGTGCAGAGAGCTGGAGACAGG + Intergenic
921674424 1:217962422-217962444 GAACACATGGAGCTGGAGGCTGG + Intergenic
922484459 1:225962505-225962527 CAGAAGTAGGGGCTGGAGGCGGG + Intergenic
922528884 1:226327821-226327843 GAGAACAGGGAGCTGAGGACTGG - Intergenic
923126220 1:231036781-231036803 CAGAATGTGGAGCTGGAAGCTGG - Intronic
924050063 1:240071492-240071514 TAGAACAGGAGGCTGGAGGTAGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063869281 10:10400711-10400733 CACAACTGGGAGGTGGATGCAGG + Intergenic
1064081465 10:12311333-12311355 CACTGCAGGCAGCTGGAGGCAGG - Intergenic
1064353284 10:14596251-14596273 CAGTTCAGGGGGCTGGAGTCTGG - Intronic
1064589205 10:16871286-16871308 CAGCACAGGGAGGCTGAGGCAGG - Intronic
1064614886 10:17142666-17142688 CAGAAGAGGGAACTGAAGTCTGG - Intronic
1065126817 10:22581863-22581885 CAGCACTGGGAGGTTGAGGCAGG + Intronic
1065382220 10:25101961-25101983 CAGGAGATGGAGCTGAAGGCAGG + Intergenic
1065493662 10:26307692-26307714 AAGAACAGGGAGCTGGATGAAGG - Intergenic
1066632399 10:37469888-37469910 GACCACAGGCAGCTGGAGGCAGG - Intergenic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1067111228 10:43401948-43401970 CAGAACAGAGAGATGGAAGGAGG + Intronic
1067278595 10:44854905-44854927 CGGGAGAGGGAGCTGGAGCCGGG + Intergenic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1069898072 10:71691128-71691150 CTGAGCTGGGAGCTGGGGGCAGG - Intronic
1069898323 10:71692635-71692657 CTGAGCAGGGAGCTGGGGGTGGG - Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070491296 10:76979321-76979343 CAGAAAAGAGAGCTGGGGTCAGG + Intronic
1070683151 10:78463072-78463094 TTGAACAGGGATCTGAAGGCAGG - Intergenic
1070744057 10:78922131-78922153 CTCAGCAGAGAGCTGGAGGCAGG + Intergenic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1071573702 10:86711458-86711480 CCGGAGAGGGAGGTGGAGGCAGG - Intronic
1072519793 10:96221307-96221329 CTAAACAGAGAGCTGGAGGTGGG - Intronic
1072614091 10:97038068-97038090 CAGAGCAGGGAGGGGAAGGCAGG - Intronic
1072667696 10:97406273-97406295 GAGAAAAGGGAACTGGTGGCTGG + Intronic
1074374517 10:112928273-112928295 CTGACAAAGGAGCTGGAGGCGGG - Intergenic
1074432270 10:113404166-113404188 CAGAGCTGGGAGCTGGGAGCTGG + Intergenic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1074495968 10:113980479-113980501 TAGAACAGAGAGGTGGAGACAGG - Intergenic
1074749559 10:116571564-116571586 CAGAACAGGGAGTTGGGTACAGG - Intergenic
1074829052 10:117235966-117235988 CAGAACAGGGACCCGAAGGTAGG - Intergenic
1075377904 10:121994413-121994435 AAGCACAGAGAGCTGGAGGCTGG + Intronic
1075726577 10:124613616-124613638 CACTACAGGGAGCTGAAGTCAGG - Exonic
1075840647 10:125499525-125499547 CAGAGCACAGAGCTGCAGGCAGG + Intergenic
1076000752 10:126911293-126911315 CAGCACAGGGAGCTGCACGCTGG - Intronic
1076413161 10:130265879-130265901 CAGAGGAGGGAGGTGGAGGGAGG + Intergenic
1076435609 10:130439159-130439181 CAAAACAGGCAGCGGGAGGGGGG - Intergenic
1076550970 10:131277993-131278015 CAAAACAGGGCTCTGGAGGGAGG + Intronic
1076912603 10:133399243-133399265 CAGAGCTGGGAGTGGGAGGCGGG + Intronic
1076941575 10:133613594-133613616 TAGATAAGGGAGCTGGATGCAGG + Intergenic
1077301922 11:1851472-1851494 GAGGACAGGCAGGTGGAGGCTGG - Intergenic
1077384493 11:2262628-2262650 CAGAACAGGGACCCGGAGGCAGG + Intergenic
1077385899 11:2269406-2269428 CAGATTGGGGTGCTGGAGGCGGG - Intronic
1077495110 11:2883173-2883195 AGGAGAAGGGAGCTGGAGGCAGG + Intergenic
1077554084 11:3217720-3217742 CAGAAAATGGAGCTGGAGAGAGG - Intergenic
1078450880 11:11439876-11439898 AAGAACAGGATGATGGAGGCAGG + Intronic
1079119613 11:17672518-17672540 GAGGACAAGGAGCTGGAAGCAGG - Intergenic
1080840005 11:35975431-35975453 CAGAACAGGCATCTGGAAGAAGG + Intronic
1081502551 11:43680843-43680865 CAGTACAGGAAGCCGGCGGCGGG - Exonic
1081525390 11:43924521-43924543 TGGGACAGGGACCTGGAGGCCGG + Intergenic
1081736972 11:45410998-45411020 AAGGGCAGGGAGGTGGAGGCGGG - Intergenic
1081773622 11:45664245-45664267 ATTGACAGGGAGCTGGAGGCTGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083091406 11:60202706-60202728 CAGAACAGGCACCTGGAGTCAGG - Intronic
1083367551 11:62150604-62150626 CAGAACACCAAGCTGGAGCCTGG + Intronic
1083851341 11:65369246-65369268 CTGAACTGAGAGCTGAAGGCTGG + Intergenic
1084013618 11:66366227-66366249 CAGATCTGGGAGCCAGAGGCAGG + Exonic
1084087549 11:66861525-66861547 CAGAACATGCAGCTAGAGGTGGG + Intronic
1084184376 11:67464032-67464054 CAGGCCTGGGACCTGGAGGCTGG - Exonic
1084625422 11:70302482-70302504 CAGAGCTGTGAGCTGGAGACAGG + Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085315969 11:75545117-75545139 CTGTGGAGGGAGCTGGAGGCGGG + Intergenic
1085383202 11:76139242-76139264 GAGAGCAGGGAGCTGGGGCCAGG + Intronic
1085521725 11:77143002-77143024 CAGAACAAGTAGCCTGAGGCAGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086341044 11:85848795-85848817 CAGGACAGTAAGCTGGAGCCAGG - Intergenic
1087924031 11:103899006-103899028 CAGGACAGGTAGGTGGAGACTGG - Intergenic
1088972586 11:114786935-114786957 CAGACCAGGGACCTGGAGGAGGG - Intergenic
1088981931 11:114871795-114871817 CAGAACAATGAGCTGGGGCCGGG + Intergenic
1089200068 11:116719194-116719216 CACAGCAGGAAGCTAGAGGCAGG + Intergenic
1089284372 11:117396174-117396196 TGGAACAGTGAGCTGGGGGCTGG + Exonic
1089303240 11:117511259-117511281 CAGGACAGGGAGGTGGTGCCAGG - Intronic
1089763529 11:120746484-120746506 CAGAAAAGGGGGCTGGAGGAAGG - Intronic
1089772788 11:120815431-120815453 CTGATGATGGAGCTGGAGGCTGG - Exonic
1090238548 11:125166144-125166166 CAGAGCAGAGGGCTGGAGGTCGG + Intronic
1090361745 11:126177519-126177541 CAGAAGAGGGAACCGGTGGCAGG + Intergenic
1091277858 11:134364485-134364507 CAGCGCAGGGAGCTGGACTCAGG + Intronic
1091366127 11:135022180-135022202 CAGAGCAGGGTGGTGGTGGCAGG + Intergenic
1091382601 12:72089-72111 GGAAAGAGGGAGCTGGAGGCTGG - Intronic
1091749936 12:3015927-3015949 CAGCACTGGGAGGTCGAGGCAGG + Intronic
1091962918 12:4714021-4714043 CAGAACGTGGAGGCGGAGGCGGG - Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092452024 12:8611272-8611294 GAGAACAGGGAGCTGGAAACAGG - Intronic
1092466630 12:8739170-8739192 AAGAACAGTGTTCTGGAGGCTGG + Intronic
1092526245 12:9311951-9311973 CAGACCAGCCAGCTGGAGGGAGG + Intergenic
1092541031 12:9419839-9419861 CAGACCAGCCAGCTGGAGGGAGG - Intergenic
1092915420 12:13184829-13184851 CAGGACAGTGAGCTAGAAGCAGG + Intergenic
1094324063 12:29217447-29217469 CAGTACAGGAAGCTGGAGGTGGG + Intronic
1094512014 12:31102647-31102669 CAGACCAGCCAGCTGGAGGGAGG + Intronic
1094780118 12:33781508-33781530 CAGAAAAGGTAGCTGGAGAGGGG - Intergenic
1095511113 12:42952752-42952774 CAGCACAGGGACCTGGGGCCTGG - Intergenic
1095832358 12:46601553-46601575 CAGGAAAGGGGGCTGAAGGCAGG - Intergenic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096750507 12:53756032-53756054 CAAGCCAGGGAGCTGGGGGCAGG - Intergenic
1096814937 12:54196041-54196063 TTGAAGAGGGAGCTGGAGGGTGG - Intergenic
1097198446 12:57258074-57258096 CAGGAGAGGGTGCTGGAGACTGG + Exonic
1098157006 12:67609505-67609527 CAGGCCATGGAGCTGGAGGTAGG - Intergenic
1100315585 12:93441819-93441841 CAGAGCGAAGAGCTGGAGGCCGG + Intronic
1100871471 12:98914617-98914639 GAGGCCAGTGAGCTGGAGGCAGG - Intronic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1103007757 12:117435630-117435652 CAGAAATGGCTGCTGGAGGCAGG - Intronic
1103345633 12:120248241-120248263 TAGAAGAGGGGGCTGGAGGATGG + Intronic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103477259 12:121227837-121227859 CAGCACAGGGAGGCGGAGGTAGG + Intronic
1103530296 12:121596439-121596461 CAGAACAGGGAACAAGGGGCCGG - Intergenic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103556273 12:121768617-121768639 CAGGACTGGGAGGTGGAGGCTGG - Intronic
1103724174 12:122989671-122989693 CCTAACAGGGAGCTGGGGGCTGG - Intronic
1103826064 12:123739579-123739601 AAGAACTGGGATCTGCAGGCTGG - Intronic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1104503020 12:129303950-129303972 CAGAACACAAAGGTGGAGGCAGG - Intronic
1104730673 12:131103723-131103745 CACAGGAGGAAGCTGGAGGCAGG + Intronic
1104757998 12:131280843-131280865 AAGAGGAGGGAGCTGGAAGCTGG - Intergenic
1104917709 12:132274416-132274438 CAGAGCAGCAGGCTGGAGGCCGG - Intronic
1104981985 12:132577279-132577301 CAGAACAGGGAGCCCCAGGGAGG - Intronic
1105260744 13:18777476-18777498 CAGAGCACAGAACTGGAGGCTGG - Intergenic
1105611858 13:21975751-21975773 CAGAACTGAGGGCTGGAGACCGG + Intergenic
1105692549 13:22856485-22856507 CAGCACTGGGGGCTGAAGGCTGG + Intergenic
1106086931 13:26550998-26551020 CAGAGGAGGGACCTGGTGGCAGG + Intergenic
1106106179 13:26735373-26735395 AAGCCCAGTGAGCTGGAGGCAGG - Intergenic
1106120755 13:26858436-26858458 CAGAAAATGGAGCTGGAGCAGGG + Intergenic
1106449317 13:29865471-29865493 CATACCCAGGAGCTGGAGGCAGG - Intergenic
1107806612 13:44159270-44159292 CAGGACAGGGTTCTGGAAGCTGG + Intronic
1107987105 13:45785155-45785177 CGGAGGAGGGAGCTGAAGGCAGG - Intronic
1108601301 13:51997543-51997565 CAGAAAAGGGGGCTGGGGCCAGG + Intronic
1109760583 13:66822754-66822776 CAGCACTGGGAGGTGGAGGCAGG - Intronic
1110019934 13:70457468-70457490 CTGGAAAGGGGGCTGGAGGCAGG + Intergenic
1110287401 13:73765769-73765791 CATAACAGGAAGCTGGCAGCCGG - Intronic
1110580813 13:77122727-77122749 CAGAACAGGGAACTACAGACAGG + Intronic
1111720468 13:91937404-91937426 CAGAAGAGCGAGTTGGAGGTGGG + Intronic
1112283596 13:98084263-98084285 CAGCACTGGGAGGTAGAGGCGGG + Intergenic
1112532059 13:100214534-100214556 GATACCAGGGAGCCGGAGGCAGG - Intronic
1112780653 13:102897506-102897528 CCACACAGGGATCTGGAGGCAGG + Intergenic
1113061690 13:106329190-106329212 GAGAAAAGGGAGCTGGGGACTGG + Intergenic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1114238877 14:20847635-20847657 CAGATCACGGAGCTGGGGCCAGG - Intergenic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114644866 14:24249727-24249749 CAGCACAGGCAGCTGGTGGGTGG - Intronic
1115097065 14:29650012-29650034 CAGGAAAGGGAGCTGGAAGCAGG - Intronic
1115287489 14:31731904-31731926 TTGAAAAGGGAACTGGAGGCCGG + Intronic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1117421773 14:55553838-55553860 CAGTACGGGGAGCTGGAGTTGGG + Intergenic
1118452577 14:65917587-65917609 GAAAAGAGGGAGTTGGAGGCGGG - Intergenic
1118598352 14:67453405-67453427 CAGGACAGGGAGCCCCAGGCAGG - Intronic
1119199540 14:72742464-72742486 AAGAACGGGGAGATGGAGGAAGG - Intronic
1119420629 14:74505908-74505930 CAGCATAGGGAGGTGCAGGCGGG - Intronic
1119535937 14:75402287-75402309 CAGAACCCGGAGGTGCAGGCTGG + Intergenic
1119956128 14:78800233-78800255 CAGAACTGGGAGTTGCATGCAGG - Intronic
1120848536 14:89147695-89147717 CTGTACAGGGAGCATGAGGCTGG + Intronic
1121080467 14:91103884-91103906 CAGAAGTGGGAGCTGGAGGTGGG - Intronic
1121243886 14:92449138-92449160 GTCAACAGTGAGCTGGAGGCTGG + Exonic
1121297376 14:92840100-92840122 CAGCACAGGGAGCTGGAAAGGGG - Intergenic
1121434170 14:93907995-93908017 CAGAACTGGGACCTGAAGCCAGG + Intergenic
1121465832 14:94115038-94115060 CAGCACTGGAAGCTGGAAGCAGG + Intronic
1121525145 14:94614337-94614359 CAGGACAGGGACCAGGACGCAGG + Exonic
1121637184 14:95461822-95461844 CAGAGCAGGGACTGGGAGGCTGG + Intronic
1121684811 14:95827884-95827906 CAGAAAATGGAGCTGGTGACTGG + Intergenic
1121740371 14:96247755-96247777 CAGTACAGGGGCTTGGAGGCAGG + Intronic
1122093221 14:99353445-99353467 AAGAACTGGGGCCTGGAGGCAGG + Intergenic
1122128349 14:99591217-99591239 GAGAACAAGGTGCTGGCGGCTGG + Intronic
1122141335 14:99664612-99664634 CAGAAGTGGGAGCTGAGGGCAGG - Intronic
1122276305 14:100592496-100592518 CAGAGCGTGGAGCCGGAGGCTGG + Intergenic
1122574252 14:102731824-102731846 GAGAAAAGGGAGCTGGAGCCAGG - Intergenic
1122618014 14:103034515-103034537 AAGAAAAGGGAGGTAGAGGCTGG + Intronic
1122630110 14:103103910-103103932 CAGGGCAGGGGGCTGGGGGCGGG - Intronic
1122782571 14:104149843-104149865 CAGAACGGCGAGCTGGGGGCCGG + Intronic
1122801345 14:104231183-104231205 CAGGACTGGGAGCTGGAGCCTGG + Intergenic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123190591 14:106565637-106565659 CAGAAAAGCGCGCAGGAGGCCGG - Intergenic
1123666687 15:22613895-22613917 CAGACCAGGAAGCGGTAGGCAGG + Intergenic
1123820981 15:24030460-24030482 GAGAATAGGGGCCTGGAGGCAGG - Intergenic
1123833059 15:24161562-24161584 CATATCAGGGAGATGGAGACTGG + Intergenic
1123839782 15:24236625-24236647 CATATCAGGGAGATGGAGACTGG + Intergenic
1123852845 15:24378323-24378345 CATATCAGGGAGATGGAGACTGG + Intergenic
1123868698 15:24549740-24549762 CATATCAGGGAGATGGAGACTGG + Intergenic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124221603 15:27854304-27854326 CAGACCAGGAAGCTGCAGCCAGG + Intronic
1124320529 15:28708468-28708490 CAGACCAGGAAGCGGTAGGCAGG + Intronic
1124481966 15:30086881-30086903 CAGACCAGGAAGCGGTAGGCAGG - Intronic
1124488422 15:30138979-30139001 CAGACCAGGAAGCGGTAGGCAGG - Intronic
1124521625 15:30410322-30410344 CAGATCAGGAAGCGGTAGGCAGG + Intronic
1124537036 15:30555897-30555919 CAGATCAGGAAGCGGTAGGCAGG - Intronic
1124622194 15:31280094-31280116 CAGCACATGGAGCTGGAGCTGGG + Intergenic
1124755105 15:32399341-32399363 CAGACCAGGAAGCGGTAGGCAGG + Intronic
1124761612 15:32451694-32451716 CAGATCAGGAAGCGGTAGGCAGG + Intronic
1124777018 15:32597374-32597396 CAGACCAGGAAGCGGTAGGCAGG - Intronic
1125380551 15:39082164-39082186 AAGACCAGGGAGGTGGAGGGTGG - Intergenic
1126004626 15:44244385-44244407 CAGAAAAGTGACCTGTAGGCTGG - Intergenic
1126346246 15:47697256-47697278 CAGAACAGAGAACTGCAGGAAGG + Intronic
1127872116 15:63082433-63082455 CAGCACAGGGAGATCGAGGCAGG + Intergenic
1128285689 15:66435154-66435176 AAGATCAGTGAGCTGGGGGCTGG + Exonic
1128339225 15:66808762-66808784 AAGAACAAGAAGCTGGAGGAAGG + Intergenic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1128975544 15:72150463-72150485 CAAAACTGGGAGCTGTTGGCTGG - Intergenic
1128988530 15:72239184-72239206 CAGAACAGCAATCTGGAGTCAGG + Intergenic
1129029527 15:72608377-72608399 CAGACCAGGAAGCGGTAGGCAGG - Intergenic
1129475181 15:75780255-75780277 CAGACCAGGAAGCGGTAGGCAGG - Intergenic
1129514905 15:76151456-76151478 CAGAACAGGGCCCTGGAGGGTGG - Intronic
1129771017 15:78203702-78203724 AAGAGCAGAGAGCGGGAGGCTGG + Intronic
1130990232 15:88871640-88871662 CAGGACAGGGACCTGGGGGAGGG + Intronic
1131121939 15:89828258-89828280 GAGAAGAGGCAGCTAGAGGCCGG + Intergenic
1131137934 15:89952762-89952784 CAGAGCAGGGAGCTCGTGGAGGG + Intergenic
1131180058 15:90233544-90233566 GAGGAGCGGGAGCTGGAGGCCGG - Intronic
1131294925 15:91139452-91139474 CAGAGCTGGGAAATGGAGGCAGG + Intronic
1132310462 15:100853915-100853937 CATAGCAGGGAGCTGGGGGCAGG - Intergenic
1132669894 16:1098227-1098249 TACAGCAGGGAGCTGAAGGCTGG - Intergenic
1132701685 16:1224820-1224842 CATAAACGGCAGCTGGAGGCCGG + Intronic
1132703496 16:1231550-1231572 GAGCACAGGGAGCTGGGGCCGGG - Intergenic
1132705016 16:1239811-1239833 GAGCACAGGGAGCTGGGGCCGGG + Intergenic
1132708018 16:1254845-1254867 GAGCACAGGGAGCTGGGGCCGGG + Intergenic
1132765282 16:1531410-1531432 CAGAACAGGGACACGGAGGGAGG - Intronic
1133032593 16:3018304-3018326 CAGAGGGGGGCGCTGGAGGCTGG + Exonic
1133040637 16:3058432-3058454 CAGGACCGGCAGCTGGAGGGCGG + Exonic
1133224906 16:4336441-4336463 CAGAACATGGCCTTGGAGGCCGG - Intronic
1133772345 16:8874563-8874585 GAGAACGGGGATCTGGTGGCTGG + Intergenic
1134592062 16:15462574-15462596 CAGAACAGGGAGCTGCACCTGGG + Intronic
1135113819 16:19709788-19709810 CAGAACAGTGAGCTGGAGAGGGG - Intronic
1135175075 16:20220876-20220898 CAGGACAGGGTTATGGAGGCAGG + Intergenic
1135272665 16:21082746-21082768 TTGAACCGGGAGGTGGAGGCAGG + Intronic
1135424197 16:22324257-22324279 CAGGCCTGGGAGCTGGAGCCTGG - Intronic
1135589495 16:23694982-23695004 AAGGACAGGGAGCGGGAGGCAGG + Intronic
1135990214 16:27214175-27214197 CAGATCAGGCAGCTGGAGCGTGG + Intronic
1136537748 16:30910405-30910427 CAGGACAGGGAGCGGGTGGGAGG + Intergenic
1136588186 16:31201398-31201420 AGGGACATGGAGCTGGAGGCTGG + Intergenic
1137227549 16:46529200-46529222 CAGAAGAGGGATCTGGAAGTGGG - Intergenic
1137677341 16:50310228-50310250 GAGAACTGGGAGATGGAGCCGGG + Intronic
1137845449 16:51683694-51683716 AAGATCAGGGAGCTGGGAGCAGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1137980418 16:53064531-53064553 CAGTACAGTGGGCTGGAGGCTGG + Intronic
1138490093 16:57371742-57371764 CAAAGCAGGGAGCGGGAGACCGG + Intergenic
1138642803 16:58398359-58398381 CAACACTGGGAGGTGGAGGCAGG + Intronic
1139470676 16:67176559-67176581 CTCAACAGAGAGCTGGAGGCAGG + Exonic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139596292 16:67960207-67960229 CAAGCCAGGGAGCTGGTGGCGGG - Intronic
1139739775 16:69025315-69025337 CAGAGAAGGGAGCTGGAGAGAGG + Intronic
1139831663 16:69803659-69803681 CAGACCTGGGAGGCGGAGGCAGG + Intronic
1139983507 16:70879572-70879594 CAGGAGAGGGAGCTGGGAGCTGG + Intronic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140038109 16:71386430-71386452 CAGAATCGGGAGCTGGGGGAGGG + Intronic
1140411172 16:74741242-74741264 CATGGCAGGGAGCTGGAAGCTGG + Intronic
1140452166 16:75079762-75079784 CAACACAGGTAGATGGAGGCTGG - Intronic
1141273249 16:82559664-82559686 CAGAAGAGGGGCCTGGTGGCAGG - Intergenic
1141810348 16:86371703-86371725 GAGCACATGGAGCTCGAGGCAGG - Intergenic
1141909908 16:87051732-87051754 CAGGACAGGGCTCTGGAGGAGGG - Intergenic
1142189278 16:88710247-88710269 CAGACCATGGAGCTGGACGAAGG - Exonic
1142189387 16:88710841-88710863 CCGCGCAGGGAGGTGGAGGCGGG + Intronic
1142300139 16:89252682-89252704 CAGCACTGGGAGGTAGAGGCCGG - Intergenic
1142710236 17:1719018-1719040 CAAAACTGGGAGCTGGGGGTGGG - Intronic
1143062266 17:4211944-4211966 GAGAAGAGAGAGCTGAAGGCAGG + Intronic
1143282504 17:5765354-5765376 CAGAGCAGGGGGTTGGAGTCAGG + Intergenic
1143283873 17:5774682-5774704 CAGCAGTGGGAGGTGGAGGCTGG - Intronic
1143634008 17:8154177-8154199 AAAGACAGGGAGATGGAGGCGGG - Intronic
1143705938 17:8697704-8697726 GGGAGCAGGGAGCTGGGGGCGGG + Intergenic
1143771294 17:9170636-9170658 CAGCACAGAGAGGTGGGGGCGGG + Intronic
1144639678 17:16930582-16930604 GAGAAGAGGGAGCTCGAGGCTGG + Intronic
1145229952 17:21166293-21166315 TAAACCAGGGAGCTGAAGGCTGG + Intronic
1145755887 17:27389846-27389868 CAGGCCAGGAGGCTGGAGGCTGG - Intergenic
1147440662 17:40445438-40445460 CAGGACAGGAAGCTTGGGGCTGG - Intronic
1147537864 17:41332647-41332669 GAGAAGAGGGAGGTGGAGGAAGG + Intergenic
1147575063 17:41594270-41594292 CTGAACTGGGAGCTAGCGGCAGG - Intergenic
1147658727 17:42105641-42105663 CAGCACAGAGAGGTGGGGGCAGG - Intronic
1148000424 17:44384403-44384425 CAGAACGGGGAGCGGGAAGTGGG - Intronic
1148051348 17:44771552-44771574 CAGAACAGTGAGCAGAACGCTGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148687338 17:49508239-49508261 CAGACCAGCCAGCTGGGGGCGGG + Intronic
1149114033 17:53070018-53070040 CATAATAGGTAGCTGGTGGCCGG - Intergenic
1149665957 17:58364885-58364907 GAGAACAGAGAGCTGGAGCAAGG - Intronic
1150112825 17:62517198-62517220 CAAAACCTGGTGCTGGAGGCTGG - Intronic
1150132002 17:62674441-62674463 GAGAACAGGGAGGTGGGGGCTGG + Intronic
1150437257 17:65163766-65163788 CAGAACCAGAGGCTGGAGGCAGG + Intronic
1150568545 17:66364543-66364565 AAGAACAGAGACGTGGAGGCCGG + Intronic
1150664471 17:67119459-67119481 CAGGGCTGGGAGCTGGAGGATGG + Intronic
1151130679 17:71893520-71893542 AAGAGGAGGAAGCTGGAGGCTGG - Intergenic
1151282836 17:73089405-73089427 ATGAACAGGGACTTGGAGGCAGG - Intronic
1151546851 17:74798564-74798586 CAGAGCAGGGTGCTGGGGGGTGG + Intronic
1152111762 17:78360651-78360673 CAGACCCGGGAGCCGGAGGTTGG + Intergenic
1152301376 17:79496957-79496979 CAGAACAGGGGTCCCGAGGCAGG - Intronic
1152435508 17:80273914-80273936 AAGAAAAGGAAGGTGGAGGCCGG - Intronic
1152484908 17:80584075-80584097 CCCAGCAGGGAGCTGGAGCCAGG + Intronic
1152566877 17:81104269-81104291 GACAAGAGGGAGCTGGATGCTGG - Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1152817802 17:82418544-82418566 CGTAACAGGGAGCGCGAGGCAGG + Exonic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1153348019 18:4049481-4049503 TAGAACAGGGATATGGTGGCAGG - Intronic
1153814282 18:8779475-8779497 CAGCTCAGGCAGCGGGAGGCTGG - Intronic
1154028326 18:10727170-10727192 CTCAACACAGAGCTGGAGGCAGG - Intronic
1154345920 18:13543433-13543455 CTGAAGAGTGTGCTGGAGGCAGG + Intronic
1154484987 18:14866234-14866256 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1155910432 18:31498551-31498573 CAGAAAAGGGCGCTGGGGCCTGG - Intronic
1156360090 18:36377375-36377397 CAGAAAAGGAAGCTAGAGGGGGG - Intronic
1156445262 18:37231875-37231897 GAGATGAGGGAGCTGGAGGAGGG + Intronic
1156449414 18:37258641-37258663 CAGGACAGAGAGCTGGAGAGAGG + Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156945937 18:42831628-42831650 AAGAAGAGAGAACTGGAGGCAGG + Intronic
1157332554 18:46714316-46714338 AAGAAAAGGGAGTTGGAGTCGGG - Intronic
1157368102 18:47085044-47085066 CAGCATAGGGAGCTGGGGCCGGG - Intronic
1157700640 18:49759822-49759844 CAGTACCGGGGGCTGGGGGCGGG + Intergenic
1157799010 18:50603273-50603295 CACACCAGGGAGATGGAAGCTGG - Intronic
1158243644 18:55406095-55406117 CAGCACAGCCAGCAGGAGGCTGG + Intronic
1158742372 18:60157899-60157921 CAGAACTGGAATTTGGAGGCAGG - Intergenic
1158941922 18:62412496-62412518 TAGAAGAGGGAGGTGGAGGCTGG - Intergenic
1159006803 18:63020471-63020493 GAGAACTGGGAGCTGGGGACAGG - Intergenic
1160184090 18:76661051-76661073 CAATACAGGGGGCTGGATGCTGG - Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160392266 18:78543130-78543152 CAGAGCAGGAGGCTGGAGGCAGG + Intergenic
1160608059 18:80066982-80067004 CAGAGGAGGGTGCTGGAGGGAGG + Intronic
1160824783 19:1074529-1074551 GGGACCAGGGAGCTGGTGGCTGG + Intronic
1160991379 19:1861697-1861719 CAGAACAGAGAGGGGGCGGCCGG + Intronic
1161122574 19:2537635-2537657 TGGGACAGGAAGCTGGAGGCGGG + Intronic
1161227806 19:3155293-3155315 GAGAACAGGAAGGTGGGGGCAGG + Intronic
1161335433 19:3710406-3710428 GAGGACAGGGAGCTGGTGGCGGG + Intronic
1161382185 19:3971211-3971233 CCGAAAAGGCAGCTGGGGGCGGG - Intergenic
1161445409 19:4316010-4316032 CACATCTGGGAGGTGGAGGCAGG - Intronic
1161487807 19:4545019-4545041 ACAAACAGGTAGCTGGAGGCAGG - Intronic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1161662794 19:5557640-5557662 GAGAACAGAGAGATAGAGGCAGG + Intergenic
1161667483 19:5586037-5586059 CAGAACCGGCAGTTGGAGGAGGG + Intergenic
1162403395 19:10459538-10459560 CATAGCGGGGCGCTGGAGGCCGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162549570 19:11351055-11351077 CAGAACTGGGGAATGGAGGCAGG + Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163193428 19:15696714-15696736 CTGAGCTGGGAGCTGGAGTCAGG + Intronic
1163200075 19:15760592-15760614 CTGAGCTGGGAGCTGGAGTCTGG - Intergenic
1163358517 19:16830105-16830127 CAGGACAGGGATCTGGGGGGAGG + Intronic
1163505440 19:17703249-17703271 CAGCACAGGGAATTGGAGGAAGG + Intergenic
1163570828 19:18081390-18081412 CAGAAAAGGATGCTGGGGGCTGG - Intronic
1164598135 19:29543599-29543621 CAGGACAAGGAGCTGAAGCCTGG + Intronic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1165012598 19:32859684-32859706 CACGGCATGGAGCTGGAGGCAGG - Intronic
1165423072 19:35732026-35732048 AAGAACGGGGGGCTGGAGGAGGG - Exonic
1165496160 19:36152798-36152820 CAGAACAGGGAGTTGGAACACGG - Exonic
1165564334 19:36711321-36711343 CAGAAACGAGAGCTTGAGGCTGG - Exonic
1165826378 19:38708285-38708307 CAGAACCCAGATCTGGAGGCTGG - Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166195555 19:41203467-41203489 CTGAATCGGGAGCTGGGGGCTGG + Exonic
1166416611 19:42599881-42599903 CAGAAGAGGGAGGTGCAGGGCGG + Intronic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166599537 19:44081835-44081857 CATAAGAGGGAGCTGGTGGGAGG - Intronic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167444302 19:49528353-49528375 CAGGACAGGGAGTTGGAAGTTGG - Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1168115540 19:54219926-54219948 CAGGACAGGGAGGTGAAGGCTGG + Intronic
1168118531 19:54239670-54239692 CAGGACAGGGAGGTGAAGCCTGG + Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
1168643451 19:58044974-58044996 AAGAACAAGAAGCTGGAGGAAGG + Intronic
925284965 2:2709785-2709807 CAGAGCAGGCAGCTGGATGTGGG + Intergenic
925401571 2:3576796-3576818 CAGCACGGGGAGGTGGAGGCGGG + Intronic
925843675 2:8016795-8016817 AAGAACACAGAGCTGGAGGTAGG - Intergenic
925913222 2:8586781-8586803 CAGGACAGGGGCCTGGAGCCAGG + Intergenic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926620029 2:15039307-15039329 TAGCACAGGAAGCTGGGGGCTGG - Intergenic
926831225 2:16964404-16964426 CTGTACAGGGAGCTTGATGCTGG - Intergenic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
929217577 2:39431903-39431925 GAGAACAGGGTTCTGGAGCCAGG - Intronic
929489889 2:42386637-42386659 TAGAAGAGAGTGCTGGAGGCTGG - Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
929534071 2:42769753-42769775 CACCACAGGGAGCTGCAGGCAGG - Exonic
929792337 2:45032825-45032847 TAGGACTGGGGGCTGGAGGCAGG - Intergenic
929889336 2:45906318-45906340 GAGAACAGGTTTCTGGAGGCAGG + Intronic
931783014 2:65596155-65596177 GAGAACAGAGAGTTGGAGGAAGG - Intergenic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932397889 2:71460653-71460675 CAGACTAGGAAGTTGGAGGCTGG + Intronic
932577652 2:72971631-72971653 CGGTACGGGGAGCTGGAGGAAGG - Exonic
932742905 2:74305696-74305718 AAGAAAAGGGAGTTGGAGGGAGG - Intronic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933703911 2:85275670-85275692 CAGAATTGGGAGGTGAAGGCGGG + Intronic
933812612 2:86042545-86042567 CACACCTGGGAGCTGGAAGCAGG - Intronic
934176580 2:89583594-89583616 CACCACAGGGAGCTGGCGGGAGG + Intergenic
934286890 2:91657955-91657977 CACCACAGGGAGCTGGCGGGAGG + Intergenic
934718686 2:96558115-96558137 CAGGCCAGGGAGCTGGAGTGGGG - Intergenic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937222962 2:120352690-120352712 CAGCACAGCCAGCTGGTGGCAGG + Intergenic
937360199 2:121224300-121224322 CAGGGCTGGGAGCTGGAGACAGG + Exonic
937927915 2:127182141-127182163 CAGCTCAGGGCGGTGGAGGCTGG - Intergenic
938070108 2:128303942-128303964 CAGAACAGGAAGGTGGAGGAAGG + Intronic
938169218 2:129059884-129059906 CAGCACAGGAGACTGGAGGCAGG - Intergenic
938384522 2:130854763-130854785 CAGAACACAGAGCTGGGGGTGGG - Intronic
938555390 2:132418721-132418743 CAGAAGAGGGACCTAGTGGCTGG + Intronic
938705296 2:133919340-133919362 CAGAACAGGGACTTGGACACAGG + Intergenic
939161105 2:138589860-138589882 CAGATAAGTGAGCTGGAGGTGGG + Intergenic
940815211 2:158290150-158290172 CAGGAGAGGGAGCTGAAGGATGG + Intronic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
942407505 2:175671198-175671220 CAGCACTGGGAGCCTGAGGCGGG + Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
944115006 2:196176542-196176564 CAGAACTGGGACTTGAAGGCAGG - Intergenic
944125747 2:196290791-196290813 CAGAACACTGAGCTGGAAGCAGG - Intronic
944213159 2:197227348-197227370 TAGAGCAGGGACCTGGAAGCAGG + Intronic
944361764 2:198865406-198865428 CAGAACACTGGCCTGGAGGCTGG - Intergenic
945649493 2:212539770-212539792 CATAACTGGGGGCGGGAGGCGGG - Intergenic
946158041 2:217819869-217819891 CAAAACCTGGAGCTGCAGGCTGG + Intronic
946167762 2:217875855-217875877 CAGAACCGGGGGCTGGTGACAGG - Intronic
946401010 2:219468476-219468498 CTGAGCAGGAAGCTGGAGCCTGG - Intronic
947450909 2:230207956-230207978 TACAAGAGGAAGCTGGAGGCTGG - Intronic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947666249 2:231907587-231907609 CAGAACAGTGGGCTCCAGGCAGG + Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948649471 2:239431581-239431603 CAGAGCATGGAACTGGAGGTAGG - Intergenic
948892308 2:240913404-240913426 CAGAACAAGGAACTCGAGGAGGG - Intergenic
1168947997 20:1777399-1777421 CACAAGAGGGAGCTGTCGGCCGG - Intergenic
1170155472 20:13265209-13265231 GAGAACAGGGAGCTGGGGAGGGG - Intronic
1170531018 20:17291766-17291788 CAGAAATGGAATCTGGAGGCAGG + Intronic
1170837675 20:19898659-19898681 CAGAACAGAAATCTGCAGGCTGG + Intronic
1171329164 20:24322295-24322317 TAGATGAGGAAGCTGGAGGCTGG - Intergenic
1171423245 20:25032898-25032920 CAGAAGAGGCCGCTGGAGCCAGG - Intronic
1171785150 20:29457211-29457233 GAGCACAGGGTGCGGGAGGCAGG + Intergenic
1173000001 20:39098827-39098849 GAGCAGAGGGAGGTGGAGGCAGG - Intergenic
1173998405 20:47357232-47357254 CAGAAAAAGGGGCTTGAGGCAGG + Intergenic
1174102499 20:48138276-48138298 CAGGACAGAGAGCGGGAGGGAGG - Intergenic
1174292622 20:49519735-49519757 CAGAAGAGGGAGATGGCGGGAGG - Intronic
1174554476 20:51383936-51383958 CAGAAAAGAGACCTGGAGGCTGG + Intergenic
1175529702 20:59666069-59666091 CACAACAGGCAGATGGAAGCTGG - Intronic
1175765679 20:61590899-61590921 CATCACATGGAGCTGGAGCCTGG - Intronic
1176198300 20:63847986-63848008 GAGAGGAGGGAGCTGGGGGCTGG + Intergenic
1176282601 20:64322746-64322768 GGGAAGAGGGAGCTGGAGGCTGG + Intergenic
1176723748 21:10413582-10413604 GAGAAGGGGGAGTTGGAGGCTGG + Intergenic
1176796342 21:13373241-13373263 GAGAAGGGGGAGCTGGAGGCTGG - Intergenic
1178376221 21:32069826-32069848 CAGAACGGTGAGCTGGGAGCAGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178885159 21:36479324-36479346 CAGGAAAGGAAGCTGCAGGCTGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179228872 21:39482143-39482165 TAGAACTTGGAGCTGGAGACTGG - Intronic
1179338801 21:40484916-40484938 CAGAGCAGGAAGCTACAGGCTGG - Intronic
1179444904 21:41424389-41424411 CAGCACAGGGAGCTGGCTGGGGG + Intronic
1179485379 21:41706714-41706736 CAGGGGAGGGAGCTGGAGGTGGG - Intergenic
1179910188 21:44443340-44443362 CAGGAGAGGGAGCTGGAGAGGGG - Intergenic
1180304902 22:11066363-11066385 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1181025335 22:20124448-20124470 CTGAACTGGGAGCTGGGGGGGGG - Intronic
1181043391 22:20203473-20203495 CAGTGCTGGGAGGTGGAGGCTGG + Intergenic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181376711 22:22464526-22464548 CAGAGCAGGCCGTTGGAGGCTGG + Intergenic
1181485570 22:23229707-23229729 GAGAAGAGGGAGCTGGAGAAGGG - Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1182353322 22:29710929-29710951 GAGTGCAGGGAGCTGGAGGTGGG - Intergenic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182936677 22:34229399-34229421 CAGATGAGGGAGCTGGAAGAGGG - Intergenic
1182984282 22:34701757-34701779 CAGCACTGGGAGGTCGAGGCGGG + Intergenic
1183411375 22:37656738-37656760 CAGCACTGGGAGCCTGAGGCAGG + Intronic
1183677803 22:39309538-39309560 GGGAACAGGGAGGTGGTGGCGGG - Intergenic
1183971996 22:41484398-41484420 CAGGCCAGGGAGCTGGTGGATGG + Intronic
1184035899 22:41917942-41917964 CAGCATTGGGAGCTGGGGGCGGG - Intergenic
1184092350 22:42299324-42299346 CAGAGCAGGGGGCTGGATGTGGG - Intronic
1184403901 22:44289253-44289275 CAGCACTGGGAGCTGGACCCAGG + Intronic
1184450258 22:44578312-44578334 TTGAACAGGGAGCTGGGAGCAGG + Intergenic
1184455399 22:44607188-44607210 CAGAACAGTCAGGTGCAGGCAGG + Intergenic
1184499159 22:44861546-44861568 CAGAGCAGAGAACTGGAGGGAGG - Intronic
1184555917 22:45233040-45233062 CAGATCAGGAAGGTGGAGGAAGG + Intronic
1184576623 22:45373095-45373117 AAGAACTGGGAGCTGGGGGTTGG - Intronic
1184766546 22:46575518-46575540 CAGAGTAGGGAGCGGTAGGCAGG + Intergenic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185132112 22:49045093-49045115 AAGCCCATGGAGCTGGAGGCAGG - Intergenic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
1185334674 22:50266188-50266210 CAGGAGAGGGAGCTGCTGGCTGG + Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1185384468 22:50525518-50525540 GAGCGCAGGGAGCTGGAGGTCGG - Intronic
950479022 3:13233404-13233426 CAGAACAGGGGCCTGAAGCCAGG - Intergenic
950572169 3:13808090-13808112 CACATCAGGGAGCTAGAGGCAGG - Intergenic
950683643 3:14602133-14602155 CAGAACTGGGAGTCGGGGGCAGG - Intergenic
950790892 3:15470915-15470937 CAGAACAGGCAGTGAGAGGCTGG + Intronic
951500411 3:23380470-23380492 CAGCACTGGCAGGTGGAGGCGGG - Intronic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954389640 3:50261833-50261855 CTGACCAGGCAGCTGGAGTCAGG - Intergenic
954605864 3:51908728-51908750 CAGCACAGGGAGCCAGGGGCTGG + Intergenic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955497960 3:59556134-59556156 CAGAACAGGAAGCTGGAAGAAGG - Intergenic
955719773 3:61868427-61868449 GAGGCCAGGGAGCTGGGGGCAGG - Intronic
956011924 3:64841217-64841239 CAGAACTGGGATTTTGAGGCAGG + Intergenic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
956860220 3:73315871-73315893 CAGAGCAGGGGGCTGGAGGGAGG - Intergenic
958193231 3:90210127-90210149 CAGAACTGGGAGGCTGAGGCAGG + Intergenic
958807107 3:98824366-98824388 CAGATCATGGAGCTGGAGAGTGG + Intronic
959291870 3:104485112-104485134 CTGAAAAGGGAGCTGAAGCCAGG + Intergenic
959674473 3:109019204-109019226 CAGAGCTGGGACCTGAAGGCAGG + Intronic
961175021 3:124827991-124828013 CAGCGAAGGGAGCTGGCGGCGGG - Intronic
961406291 3:126682134-126682156 CAGGGCTGGGAGCTGGGGGCAGG + Intergenic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961598920 3:128043512-128043534 CAGAGAAGGGAGCTGGAGAGGGG + Intergenic
961690100 3:128663174-128663196 AACAACAGGTAGCTGGAGGCAGG - Intronic
962394299 3:135001393-135001415 CAGCCCTGGGAGATGGAGGCAGG - Intronic
962607383 3:137044220-137044242 AAGAACTGGGACCTGGAGGCTGG + Intergenic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
962880948 3:139575867-139575889 CAAAACAGGGATCTGCAGGCTGG - Intronic
963603015 3:147393413-147393435 CAGTGCAGGGAGCTGGAGGGAGG - Intronic
963693899 3:148540586-148540608 CAGAAAATGGAGCTGGAGTTGGG + Intergenic
963757079 3:149246159-149246181 CAGATTTGGGAGCTGGAGGTGGG - Intergenic
963851761 3:150216691-150216713 CACCACAGGGTGCTGCAGGCTGG - Intergenic
964775219 3:160268075-160268097 CAGAAGAGGCAGCTTGTGGCAGG + Intronic
965233850 3:166090411-166090433 CAGAGGAGGGATCTGGAGACAGG - Intergenic
965287405 3:166834227-166834249 CAGAACTGGGAGATCAAGGCGGG + Intergenic
965566915 3:170129337-170129359 CATTACTGGGAGCTGGAGGAAGG + Exonic
966762305 3:183428758-183428780 CAGGACCCGGAGCGGGAGGCTGG + Intronic
967017712 3:185496823-185496845 CTGACCAGGAAGCTGGAGCCGGG + Exonic
967106199 3:186256723-186256745 CAGGCCAGGCTGCTGGAGGCAGG - Intronic
967186685 3:186950113-186950135 CTGTGGAGGGAGCTGGAGGCAGG + Intronic
967877680 3:194277882-194277904 TAGACCAGGGTGCTGGAGTCAGG - Intergenic
967972428 3:195009142-195009164 CAGAACAGCAAGCTGGTGTCAGG - Intergenic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968660369 4:1796320-1796342 GAAAAAAGGGATCTGGAGGCTGG - Intronic
968669522 4:1841531-1841553 AAGAACAAGAAGCTGGAGGAAGG - Exonic
968974351 4:3813321-3813343 CAGCACAGGAAGCTGGAGAGAGG + Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969116647 4:4874433-4874455 GGGGACAGGGAGCTGGAGGCTGG - Intergenic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969480398 4:7443889-7443911 CAGGCCAGGGAGGTGGAGGCTGG - Intronic
969948062 4:10805227-10805249 CAGAACAGAAAGGTGGAGGAAGG + Intergenic
970223584 4:13834964-13834986 CAGAGCAGGGAGCTGGTCGAAGG - Intergenic
970498666 4:16654270-16654292 CAAAACAGGGATTTGGAGGGAGG - Intronic
970887935 4:21008097-21008119 CAGAACTGAGACCTGCAGGCAGG + Intronic
972760870 4:42102687-42102709 CAGAAAAGAAAACTGGAGGCTGG + Intergenic
973169587 4:47122857-47122879 CAGTAGAGGGAGCTAGAGGAAGG - Intronic
974914431 4:68162304-68162326 TGGAATAGGGTGCTGGAGGCAGG - Intergenic
976137411 4:81953725-81953747 CAGATCCAGGAGCTGGAAGCAGG - Intronic
976478829 4:85515107-85515129 TAGAATAGAAAGCTGGAGGCTGG + Intronic
978919499 4:114165565-114165587 ATGAACTGGGAGGTGGAGGCTGG - Intergenic
979965998 4:127077317-127077339 CAGGAAAGGGGGCTGGAGCCAGG - Intergenic
980474323 4:133291991-133292013 TAGAACAGGGAGATAGAGCCTGG + Intergenic
980678986 4:136130301-136130323 CAGAAAAGGAGGCTGTAGGCAGG + Intergenic
980985303 4:139689362-139689384 CACAATAGGGAGGTGGCGGCTGG - Intronic
981045030 4:140256907-140256929 CAGAGCAGGTGGCTAGAGGCAGG + Intergenic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
982722780 4:158876583-158876605 CAGAACAGGGATATGGGGCCTGG - Intronic
983650778 4:170034467-170034489 CAGAACAGGGAGCTGGCGCTAGG - Intergenic
984021866 4:174495153-174495175 GAGAACATGGAGCTGGAAGGAGG - Intronic
985663159 5:1167405-1167427 CTGGCCAGGAAGCTGGAGGCAGG - Intergenic
985693384 5:1325958-1325980 CAGGCCAGAGCGCTGGAGGCTGG + Intronic
985816164 5:2129861-2129883 CGGAAAGGGCAGCTGGAGGCCGG - Intergenic
986043264 5:4013275-4013297 CAGGACGGGGACCTGGAGGGAGG - Intergenic
986272539 5:6246376-6246398 AAGAAGAGGAAGCTAGAGGCAGG + Intergenic
986420075 5:7571411-7571433 CAGAACAGAAAGGTGGAGGAAGG - Intronic
987292578 5:16522647-16522669 TAGAAGAGGGGGCTGGATGCTGG - Intronic
987301355 5:16600485-16600507 GAGAACAGGGAGCTGATGCCAGG + Intronic
988498950 5:31768098-31768120 CAGAACTGGGACCTGGAGTTAGG + Intronic
988796707 5:34657861-34657883 GCGAACAGGGACCTGCAGGCTGG - Intronic
990499022 5:56376535-56376557 CAGAATGGGGAGCTGGAGAGGGG + Intergenic
991485837 5:67135819-67135841 CAGCAGAGGAAGCTAGAGGCAGG + Intronic
994097097 5:95857278-95857300 CAGAACTGGGAGCTGAATCCAGG + Intronic
994868662 5:105315445-105315467 CAGAAAAGGGAGTTAGAGGGAGG - Intergenic
995146125 5:108788254-108788276 CAGGACAGGCAGCTCCAGGCAGG - Intronic
995684480 5:114757351-114757373 CAGAACTGGGGGCTAGAGGGTGG - Intergenic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
996388366 5:122933398-122933420 GAGAACAGGGAGCTGCACCCTGG - Intronic
997045545 5:130312524-130312546 AAGATTAGGGAACTGGAGGCTGG - Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
998143176 5:139711138-139711160 CAGCCCAGGGAGCTGGAGACAGG + Intergenic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000906892 5:166975171-166975193 CAGAACAGCGAGATGAATGCTGG + Intergenic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1001980872 5:176036263-176036285 GAGAAGGGGGAGCTGGATGCTGG - Intergenic
1002194563 5:177495007-177495029 CTGACCAGGGAGCTGGAGCCCGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002236590 5:177807802-177807824 GAGAAGGGGGAGCTGGATGCTGG + Intergenic
1002723686 5:181281461-181281483 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1002763620 6:220071-220093 CAGAATGGGGAACTGGAGCCGGG + Intergenic
1003213737 6:4090226-4090248 CTGCACTGGGAGCTGCAGGCCGG + Intronic
1003378924 6:5604557-5604579 CAGAACTGTGAGCTGCAGGCAGG + Intronic
1003687859 6:8322637-8322659 CAGGATAGGGAGCTGGAGAGGGG + Intergenic
1004395507 6:15244474-15244496 CACGACAGGGGGCTGGAGGCAGG + Intergenic
1004564069 6:16779316-16779338 GGGGACAGGGAGCTTGAGGCAGG + Intergenic
1005020079 6:21409296-21409318 AAGAAAAGGGAGCTGGATGAGGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005136091 6:22570583-22570605 GAGAAGAGGGAGCCGGAAGCTGG - Exonic
1005511250 6:26513372-26513394 CAGGACAGGGAGCCAAAGGCAGG - Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006518831 6:34559859-34559881 CAGCCCAGGGAGCTGGAGGCAGG - Intergenic
1006629957 6:35423975-35423997 GAGAAGAGGAAGCTGGTGGCAGG + Exonic
1006749548 6:36368090-36368112 CAGAACAGGGAGTTGAACCCAGG - Intronic
1007109377 6:39304185-39304207 GAGCCGAGGGAGCTGGAGGCAGG + Intronic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007697868 6:43744948-43744970 CATGAAAGGGAGCTGGAGGAGGG + Intergenic
1008274108 6:49523544-49523566 GAGAACATGGATCTGGAGGGGGG - Intronic
1009303558 6:62059252-62059274 CTGAATAGGGAGCTTGAAGCTGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1012534880 6:100283511-100283533 CAGCAGAGGCTGCTGGAGGCTGG - Intergenic
1012980975 6:105830806-105830828 CAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1014251299 6:119117945-119117967 GGGACCAGAGAGCTGGAGGCAGG + Intronic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016676978 6:146782345-146782367 TAGAAAAGGGAGCTTGAGGAAGG - Intronic
1017197427 6:151716807-151716829 CAGAAAAGGGGGCTGAAGCCAGG - Intronic
1017281164 6:152627575-152627597 TTGAACAGGGAGATGGAGGTTGG + Intronic
1017581802 6:155873014-155873036 CAGAACAGAGAGGGGCAGGCTGG + Intergenic
1017736205 6:157366886-157366908 CAGTACAGGAAGCTGGCAGCGGG + Intergenic
1017770057 6:157638087-157638109 GAGGAGAGGGAGGTGGAGGCAGG + Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1018765895 6:166932440-166932462 CAGAGCTGGGGGCTGGGGGCTGG - Intronic
1018889524 6:167973527-167973549 CAGAACAGGAGGGTGCAGGCAGG + Intergenic
1019014953 6:168873474-168873496 CAGAACCCCGAGCTGGCGGCCGG + Intergenic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019466448 7:1192191-1192213 AGGGACAGGGAGCTGCAGGCAGG - Intergenic
1019533215 7:1513953-1513975 CATCACGGGGAGCGGGAGGCGGG + Intergenic
1019674221 7:2301787-2301809 CAGAACTCGACGCTGGAGGCAGG - Intronic
1019722673 7:2582676-2582698 CAGAACACGGGGCGGAAGGCAGG - Intronic
1019748051 7:2711665-2711687 CAGCACAGGGAGGCAGAGGCAGG - Intronic
1019795320 7:3044074-3044096 CAGATCAGGGAGCCGGAGATGGG + Intergenic
1021085884 7:16421004-16421026 CAGGGCGGGGAGCGGGAGGCCGG + Intronic
1021100657 7:16584170-16584192 CAGGACTGGGGGCTGCAGGCTGG + Intergenic
1021911525 7:25390061-25390083 CAGAGGAGGCACCTGGAGGCAGG - Intergenic
1022415278 7:30171951-30171973 CAGAGCAGTGAGCAGGAGCCTGG - Intergenic
1022465321 7:30649430-30649452 CAGGGCAGGGGGCTGGGGGCAGG + Intergenic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1023937448 7:44749522-44749544 CAAAACTGGCAGCTGGGGGCTGG - Intronic
1023985513 7:45092314-45092336 CACAACAGGCAGCTGGGAGCAGG - Intergenic
1024059153 7:45685486-45685508 AACAAGATGGAGCTGGAGGCAGG + Intronic
1024279286 7:47706176-47706198 CAGAATAGAGAGCTGGGTGCAGG + Intronic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1026922360 7:74165541-74165563 CACAACAGGGAGGTTGAGACAGG + Intergenic
1029448319 7:100627034-100627056 GAGGACAGAGTGCTGGAGGCAGG + Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1030532426 7:110727988-110728010 CAGCACAGGAAGCTTGAGTCTGG + Intronic
1032042028 7:128571119-128571141 CAAAACCTGGTGCTGGAGGCTGG - Intergenic
1032191177 7:129766880-129766902 CAGGTCAGGCAGCTGGAGCCCGG - Intergenic
1032651179 7:133880108-133880130 CTGAACTGGGATCTGGAGGACGG - Intronic
1033309119 7:140247160-140247182 CAGAACAGGGCTGTGGAGGGGGG - Intergenic
1033478589 7:141715763-141715785 CAGAACTGGGACTTGGAGCCAGG - Intronic
1033657278 7:143382255-143382277 CAGCAAGGGGAGGTGGAGGCAGG - Exonic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034890496 7:154835073-154835095 CACAAAAGGGAGCTAGAGGTAGG - Intronic
1035050156 7:155994136-155994158 GGGAAGAGGGAGCTGGAGTCAGG - Intergenic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1035076512 7:156181101-156181123 CAGAGCAAGGAGCTGGCCGCGGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1035375555 7:158404785-158404807 GGGGCCAGGGAGCTGGAGGCCGG - Intronic
1035375588 7:158404859-158404881 GAGGCCAGGGAGCTGGGGGCTGG - Intronic
1035375658 7:158405048-158405070 GAGGCCAGGGAGCTGGGGGCCGG - Intronic
1035611657 8:969700-969722 CTGAACAGGGAGCTGAGGGGAGG - Intergenic
1035727467 8:1833796-1833818 CAGCACAGGGAGCTGGGGATGGG - Intronic
1036640302 8:10579459-10579481 GAGAACTGAGAGCAGGAGGCAGG + Intergenic
1036747319 8:11419090-11419112 CAGAATAGGGGACTTGAGGCTGG + Intronic
1037323339 8:17664563-17664585 CAGAACTGAGAGGAGGAGGCCGG - Intronic
1037515378 8:19625778-19625800 CAGAACAAGGAGTTTGAGGCTGG + Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037819069 8:22127104-22127126 CAGAACAGGGGGCTGGGGGTTGG - Exonic
1038174718 8:25170045-25170067 CAGGACAGGGAGCTGGTGAGTGG - Intergenic
1038293621 8:26271430-26271452 CAGCACTGGGAGGTTGAGGCAGG - Intergenic
1038720152 8:30027924-30027946 AAGATCAGTGAGCTGGGGGCTGG + Intergenic
1039793971 8:40896855-40896877 CAGCTCTGGGAGGTGGAGGCTGG - Intronic
1039797034 8:40924521-40924543 CAGAACAGAGGGCAGGTGGCTGG + Intergenic
1041583978 8:59495065-59495087 CTGAAAAGGGAGCTGAAGCCAGG - Intergenic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041838355 8:62242213-62242235 CAGAAAAGGGGGCTGAAGCCAGG - Intergenic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1044631025 8:94278704-94278726 CAGAGAGGGGAGCTGGAGACGGG + Intergenic
1044704037 8:94991236-94991258 CAAATCAGGGAGCTGGAGATTGG - Intronic
1044743727 8:95352566-95352588 CAGGACAGGGATCCTGAGGCAGG + Intergenic
1044885350 8:96771015-96771037 GAGAAGAGGAGGCTGGAGGCAGG + Intronic
1044885450 8:96772139-96772161 GAGAAGAGGAGGCTGGAGGCAGG + Intronic
1045696722 8:104817475-104817497 AAGGACAGGCAGCTGGAGCCAGG - Intronic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1047206406 8:122805823-122805845 CAGAGCAGAGAACTCGAGGCAGG - Intronic
1047522559 8:125606448-125606470 CAGACCAGGGGACTGGGGGCAGG - Intergenic
1047643283 8:126843742-126843764 CAGACCAGGGAGCAAGGGGCTGG - Intergenic
1048006365 8:130422449-130422471 CAGCCCAGGGAGCAGGAGCCAGG - Intronic
1048034670 8:130666161-130666183 CAGGACAGACACCTGGAGGCGGG - Intergenic
1048193073 8:132308067-132308089 CCCAGCAGGGAGCTGCAGGCAGG + Intronic
1048888125 8:138924804-138924826 GAGAATAGGGGCCTGGAGGCAGG + Intergenic
1048893077 8:138965087-138965109 CTGCCCAGGGTGCTGGAGGCAGG - Intergenic
1049236135 8:141513311-141513333 CAGCGGAGGGAGCTGGAGCCTGG + Intergenic
1049408587 8:142462539-142462561 CAGAGCAGGGAGCTGGGCCCAGG - Intronic
1049667601 8:143853433-143853455 CAGAGCAGCGACCTGGAGGAGGG + Intergenic
1049818695 8:144621110-144621132 CAGGGCAGGCAGCTGCAGGCTGG - Intergenic
1050042532 9:1511143-1511165 TAGGAAAGGGAACTGGAGGCTGG - Intergenic
1051937782 9:22465511-22465533 CAGGAGAGGGAACTGGTGGCGGG + Intergenic
1052323497 9:27193155-27193177 CAGGACTGGGAGGTGGAGGGTGG - Intronic
1052520472 9:29541536-29541558 AAGGACAGAGAGATGGAGGCAGG - Intergenic
1052834378 9:33239801-33239823 CAGAGAAGGGGGCTGGAGCCTGG - Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053283622 9:36837034-36837056 AAGAACAGGGACCCAGAGGCTGG - Exonic
1053784162 9:41641270-41641292 CAGAAGAGGCAGTTAGAGGCTGG + Intergenic
1053885901 9:42645087-42645109 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1054224919 9:62452536-62452558 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1055419515 9:76124148-76124170 CAGAACAGGAATTTGAAGGCAGG - Intronic
1056827025 9:89883598-89883620 CAGGGCAGGGAGGTGGAGGGAGG - Intergenic
1057217537 9:93237737-93237759 AACCACAGGGAGCTGCAGGCAGG - Intronic
1057558461 9:96108250-96108272 AGCAACAGGGAGCTGGGGGCAGG + Exonic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057793557 9:98140085-98140107 CAGAACAGGGACCAGGACCCAGG + Intronic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1059750434 9:117242455-117242477 CAGAACAGGGATATGCTGGCTGG + Intronic
1060302474 9:122383412-122383434 GGGAACTGGCAGCTGGAGGCAGG + Intronic
1060332280 9:122683710-122683732 CACCACAGGGACCTGGAGACTGG + Intergenic
1060816417 9:126637831-126637853 CAGTACAGAGAGCGGGGGGCGGG - Intronic
1061054423 9:128214875-128214897 CCTAACCAGGAGCTGGAGGCTGG + Intronic
1061840572 9:133356530-133356552 CAGAACCTGGAGCCGGGGGCGGG - Exonic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061858519 9:133456046-133456068 CTGAAAAGGGAGCAGGAGACAGG - Intronic
1061992566 9:134167551-134167573 CAGCACTGAGAGCTGGGGGCCGG - Intergenic
1062212186 9:135371153-135371175 CAGCAGGGGGAGCTGGAGGCAGG - Intergenic
1062405786 9:136395598-136395620 CAGAACCGGGAGCAGCAGGTGGG - Exonic
1062585523 9:137247753-137247775 CAGGGAAGGGAGCTGGATGCCGG - Exonic
1062619291 9:137412134-137412156 AAGGACAGGGGGCTGGAGGCCGG + Intronic
1203445936 Un_GL000219v1:56443-56465 GAGCACAGGGTGCGGGAGGCAGG + Intergenic
1186657796 X:11633843-11633865 CAGAGCTGGGAGCTGGAGACAGG - Intronic
1188438137 X:30185886-30185908 CTGAACAGGGACCTGGATGCAGG + Intergenic
1188444607 X:30243067-30243089 AAGAAGAGAGAGCTGGAGCCCGG + Exonic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189003788 X:36973853-36973875 CAGAATAGGGAGTTGGAGTGGGG + Intergenic
1192447684 X:71223051-71223073 CAGAACAGGTGGGTGCAGGCTGG + Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192765260 X:74133351-74133373 CAGAACAGGCTATTGGAGGCTGG - Intergenic
1193150207 X:78116999-78117021 CAGAACCTTGAGCTGAAGGCTGG + Intronic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic