ID: 1092234779

View in Genome Browser
Species Human (GRCh38)
Location 12:6799883-6799905
Sequence CAGAAGCAAGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1971
Summary {0: 1, 1: 1, 2: 33, 3: 290, 4: 1646}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092234779 Original CRISPR CAGAAGCAAGAGAAAGAGGC AGG (reversed) Intronic
900273570 1:1808003-1808025 CAAAAACAAAAAAAAGAGGCCGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900509821 1:3053379-3053401 CAGGAGCAAGAGAGAGAGCGGGG + Intergenic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
900837316 1:5015035-5015057 CAGGAGCCAGAGAGAGAGGGGGG - Intergenic
900858262 1:5203709-5203731 CAGGAGCAGGAGGAAGAGGGTGG + Intergenic
901117046 1:6855457-6855479 CAGGAGCAAGAGAGAGAGAGAGG + Intronic
901144343 1:7054979-7055001 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
901152488 1:7113192-7113214 CAGAAGCCACAGACAGAGGCTGG + Intronic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
901780029 1:11587859-11587881 CAGGAGGAAGAGAGAGAGACAGG - Intergenic
902192851 1:14775729-14775751 TTGAAGCAGGAGAAAGGGGCAGG + Intronic
902837808 1:19058165-19058187 GAGGGGGAAGAGAAAGAGGCTGG + Intergenic
902996037 1:20225897-20225919 CAGGAGGAAGAGAAAGAAGGGGG + Intergenic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903385297 1:22922234-22922256 CAGGGGCAAGAGAGAGAGGGAGG + Intergenic
903682181 1:25104451-25104473 GAATAGCAAGAGAAAGAGGAGGG - Intergenic
903818712 1:26084417-26084439 CAGAAGTGAGAGAATGAGGAAGG + Intergenic
903923248 1:26816210-26816232 AGGAAGAAAGAGAAAGAGGGAGG + Intergenic
904004718 1:27357703-27357725 CAGAAGCAAGAGCAGGTGGGCGG - Exonic
904868714 1:33602788-33602810 CATAAGAAAGAGAAAGAGGGAGG - Intronic
904933215 1:34107062-34107084 CAGCAGCAAGAGAAAGGGCCAGG + Intronic
905042431 1:34971144-34971166 GAGAAGCAAGAGAGAGAAGCAGG - Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905080163 1:35312046-35312068 CAAAAGAAAGAAAAACAGGCAGG - Intronic
905146168 1:35888407-35888429 CAGCTACAAGACAAAGAGGCTGG - Exonic
905489787 1:38334378-38334400 GAGAATCAAGAGAATTAGGCGGG - Intergenic
905638212 1:39570155-39570177 CAGCAGAAAGAGAAAAAGGCAGG + Intronic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
905686773 1:39913915-39913937 CTGAGGCAAGAGAATCAGGCAGG + Intergenic
906180216 1:43811514-43811536 CAGAAGCAACAGGTAGATGCTGG - Intronic
906588718 1:47003639-47003661 CAGGAGCAAGAGAGAGAGTAGGG + Intergenic
906662808 1:47594453-47594475 CAAAAGCACTAGAGAGAGGCTGG + Intergenic
906707566 1:47905920-47905942 CAGGTGCAAGGGATAGAGGCTGG - Intronic
906857661 1:49325871-49325893 CAGGAGCAAGAGAGAGAGAAGGG - Intronic
907073938 1:51562305-51562327 CAGGAGCAAGAGAGAAAGGGGGG - Intergenic
907243639 1:53093901-53093923 CAGGAGCAGGAGGGAGAGGCAGG - Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907448022 1:54521808-54521830 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
907485900 1:54777943-54777965 AAGGAGCAAGAGAGAGGGGCGGG - Intergenic
907572750 1:55498890-55498912 CACAAGCAAGTGGCAGAGGCAGG - Intergenic
907703229 1:56810042-56810064 GAGAAGGAAGAGAAAGAGGAGGG + Intronic
907813656 1:57897328-57897350 CAGGAACAAGAGAACGAGACAGG + Intronic
907858495 1:58327318-58327340 GAGAAGGAAGAGGAGGAGGCAGG + Intronic
907984666 1:59518670-59518692 CAGAAGCAAGAGAGAGAGTGGGG - Intronic
908083761 1:60608656-60608678 CAGGAGGATGAGAAAGAGCCTGG - Intergenic
908453630 1:64280789-64280811 ATGAGGTAAGAGAAAGAGGCAGG + Intergenic
908735009 1:67267346-67267368 CAGAAGCAAGAGAGAGAGAAGGG - Intergenic
908865666 1:68546740-68546762 CAGAGGCAAGAGAAAGAGTGGGG + Intergenic
908930760 1:69313949-69313971 CAGAAGAAAGAGAAAGGAGAAGG + Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
909180309 1:72415673-72415695 CAGGAGCAGGACCAAGAGGCAGG - Intergenic
909371598 1:74889079-74889101 CAAAAGCAAGAGGAAGAGTCAGG - Intergenic
909377791 1:74960038-74960060 CAGAAGCAAAAGAAAGAGGGAGG - Intergenic
909588454 1:77318249-77318271 CAGGAGGAAGAAAGAGAGGCGGG + Intronic
910138010 1:83995453-83995475 CAGGAGCAAGAGAGAGAGTGAGG - Intronic
910277095 1:85461491-85461513 CAATAACAATAGAAAGAGGCAGG + Intronic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
910512306 1:88021145-88021167 CAGGAGCAAGAGAGAGAGAGAGG + Intergenic
910693991 1:89993552-89993574 CAAAAGGAAGAGGAAGAGGCTGG + Intergenic
910839862 1:91550633-91550655 CAGGAGCAAGAGAGAGAGAAGGG - Intergenic
910891393 1:92024104-92024126 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
911189797 1:94936405-94936427 CATGAGAAAGAGAAAGTGGCAGG - Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911537488 1:99117942-99117964 CAGACACAAGAGAAAGTAGCTGG + Intergenic
912102815 1:106232914-106232936 CAGGAGCAAGAGCAAGAGTGTGG - Intergenic
912250740 1:108010238-108010260 TGGAAGAAAGAGAAATAGGCGGG - Intergenic
912373902 1:109194647-109194669 CAGAAGCCAGAGACAGACACAGG + Intronic
912409509 1:109470482-109470504 CAGAAGCAAGAGGAGGCGGAGGG + Intronic
912549800 1:110477890-110477912 AAGAAGCAAGAGAGACAGGCAGG - Intergenic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912772251 1:112474902-112474924 CAGGAGCAAGAGAGAGAGCTGGG - Intronic
912810378 1:112789768-112789790 GAAATGCAAGAGGAAGAGGCCGG - Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913139928 1:115931040-115931062 CAGGAGGAAGAGAGAGTGGCGGG - Intergenic
913181294 1:116324704-116324726 GAGAAGCAATAGGAAGAGACTGG - Intergenic
913216028 1:116621127-116621149 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
913288500 1:117250170-117250192 AGGGAGCAAGAGAGAGAGGCAGG + Intergenic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
913667030 1:121058032-121058054 CAAAAGAAAGAGAAAGGGCCGGG + Intergenic
913669561 1:121083328-121083350 CAGCAGCAAGAGGAAAAGGATGG - Intergenic
914021318 1:143870727-143870749 CAGCAGCAAGAGGAAAAGGATGG - Intergenic
914360858 1:146934795-146934817 CGGAAGCAGGATAAAGAGGTGGG - Intergenic
914439082 1:147687268-147687290 AGGAAGCAAGAGAGAGAGGCAGG - Intergenic
914491727 1:148155842-148155864 CGGAAGCAGGATAAAGAGGTGGG + Intergenic
914514163 1:148359937-148359959 CAAAAGAAAAAGAAAAAGGCCGG - Intergenic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914659809 1:149778645-149778667 CAGCAGCAAGAGGAAAAGGATGG - Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915488204 1:156236497-156236519 GAGAAGGAAGAGGAAGAGGCAGG - Intronic
915653399 1:157336432-157336454 CAGGAGCAAGAGAGAGAGAGGGG - Intergenic
915684171 1:157615112-157615134 CAGGAGCAAGAGAGAGAGAAGGG + Intergenic
915694279 1:157723079-157723101 CAGGAACAAGAAAAAGAGGCAGG + Intergenic
915726250 1:158019731-158019753 GCAGAGCAAGAGAAAGAGGCAGG + Intronic
915777344 1:158504474-158504496 CAGGAGCAAGAGACAGAGTGAGG + Intergenic
915874918 1:159602260-159602282 CAGGAGCAAGACAGTGAGGCGGG - Intergenic
916037191 1:160932758-160932780 CTGAGGCAGGAGAAAAAGGCAGG - Intergenic
916093869 1:161331100-161331122 CAGAAGGCAGAAACAGAGGCAGG - Intronic
916185439 1:162127679-162127701 CAGAAGCAATAGAGAGACGAAGG + Intronic
916288151 1:163133248-163133270 CAGAAGCAAGAGGGAGAGAAGGG - Intronic
916291002 1:163166108-163166130 TAGAAGCAGGAGAGAAAGGCGGG + Intronic
916693917 1:167218148-167218170 CAGGAGCAAGAGAAAGGGTAGGG - Intergenic
916759054 1:167800452-167800474 CAGAAGCATGTGAAAGACTCTGG + Intergenic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917101102 1:171446199-171446221 CAGGGGCAAGAGAGAGAGGGAGG - Intergenic
917389805 1:174522773-174522795 CAGGAACAAGAGAGAGAGGTGGG + Intronic
917516479 1:175712697-175712719 CAGAAGCAAGAGAGAGAGGGTGG - Intronic
917841500 1:178983608-178983630 CAGGAGCAAGTGAGAGAGGGAGG - Intergenic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
917905048 1:179580236-179580258 CAGCAGCTAGTGAAAGAGTCAGG - Intergenic
917968524 1:180193377-180193399 CAGAGGAGAGAGAGAGAGGCAGG + Intronic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918039146 1:180901655-180901677 CAGCTGTAAGAGAAGGAGGCAGG + Intergenic
918094170 1:181321061-181321083 GAGAAGCAAGAGAGAGAGGAGGG + Intergenic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918635613 1:186770889-186770911 AAGAAGAGAGAGAAAGAGTCAGG - Intergenic
918865011 1:189884579-189884601 GTGAAGCAAGAGAAAGAGAATGG + Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919679260 1:200418198-200418220 CAGAAACAAGTGAGACAGGCTGG + Intergenic
919745773 1:201008388-201008410 CAGAAGGAAGGGAGAGAGCCAGG + Intronic
919888732 1:201954792-201954814 AAGAAGAGAAAGAAAGAGGCCGG + Intergenic
919950788 1:202361410-202361432 CAGGAGAAAGAGAGAGAGGTGGG + Intronic
919984791 1:202665725-202665747 AAGGAGCAAGAGACAGATGCGGG - Intronic
920008429 1:202850446-202850468 CAGAAGGAAGGGAAAGAGGTTGG - Intergenic
920041070 1:203097694-203097716 CAAAAGCAAGAGGAAGAGGAGGG + Intronic
920062107 1:203234015-203234037 CAGAGGCAAGAGAATTAGGAAGG - Intronic
920162604 1:204010805-204010827 CAGGAGCAAGAGAGTGAGGGAGG - Intergenic
920193033 1:204207060-204207082 CAGAAGCAAGAGGCAAAGGCGGG - Intronic
920449759 1:206051087-206051109 AAGAAGGAAGAGAAAGAGCAGGG - Intronic
920457871 1:206114878-206114900 CAGAAGCAGGATAAAGAGGAGGG + Intronic
921134160 1:212245239-212245261 CAGGAGCAAGAGAGCGAGCCAGG - Intergenic
921307961 1:213816012-213816034 CAGAGGAGAGAGAAAGAGACAGG + Intergenic
921344645 1:214169885-214169907 CAGAAGCAAGAGACAGAGTGGGG + Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921601197 1:217108652-217108674 CAGAAGCAAGAGAGAGGGAGAGG - Intronic
921694792 1:218195928-218195950 CAGAAGCCAGAGGAAGTGTCTGG + Intergenic
921750124 1:218782533-218782555 CAGGAGCAAGAGAGAGAGAGGGG - Intergenic
921895395 1:220394838-220394860 GAGAAGCAAGGAAAAGAGTCTGG - Intergenic
921906601 1:220501997-220502019 CAGGAACAAGAGCAAGAGGCAGG - Intergenic
922356291 1:224779521-224779543 CAGGAGCAGGAGAGAGAGGGTGG + Intergenic
922433697 1:225582161-225582183 CAGGAGCAAGAGAGAGAGAGGGG - Intronic
922525676 1:226301470-226301492 CAGAAGAAAGAGGAAGAGTGGGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922660552 1:227426386-227426408 CAGGAGCAAGAGAGAGAGGGCGG + Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922746135 1:228045242-228045264 CAGGAGCAAGAGGGAGGGGCTGG + Intronic
922953383 1:229578346-229578368 CGGAAGGAAAAGAAAGAGGAAGG - Intergenic
923555531 1:234997808-234997830 CAGGAGGAAGAGGAAGAGGGGGG - Intergenic
923619328 1:235565193-235565215 CAGAGGCTAAAGAAAGAGGGTGG + Intronic
923856736 1:237853128-237853150 CAGAAACAAGAAAAAGATGCAGG - Intergenic
923990282 1:239428256-239428278 CAGATGCAAGAGCAAGAGTTTGG + Intronic
924183902 1:241466680-241466702 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924238794 1:242021833-242021855 CAGAAGCAGAAGTCAGAGGCTGG - Intergenic
924313973 1:242776570-242776592 CAGAAGCAGGAGCAAGAGAAAGG + Intergenic
924313975 1:242776576-242776598 CAGGAGCAAGAGAAAGGAGAGGG + Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924715541 1:246569722-246569744 CAACACTAAGAGAAAGAGGCTGG - Intronic
924793227 1:247272292-247272314 CAGCAGCAAGAGAAAGATGGGGG + Intergenic
924943605 1:248829867-248829889 CTGAGGCAAGAGAATCAGGCAGG - Intergenic
1062873195 10:924578-924600 CTGAAGGAAGAGAACGCGGCTGG - Intronic
1063160294 10:3413689-3413711 CATAAGGAAGAAACAGAGGCTGG + Intergenic
1063169156 10:3490814-3490836 GAGAGGCCAAAGAAAGAGGCTGG - Intergenic
1063375023 10:5549179-5549201 CAGAAGTAAGAGAGAAAGGAAGG + Intergenic
1064002621 10:11676108-11676130 CAGGAGGAAGAGAGCGAGGCAGG - Intergenic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064464217 10:15563058-15563080 CAGAACCAAGAGAGAGAGGGTGG - Intronic
1064976086 10:21117300-21117322 CTGAGGCTAGAGAAAGATGCAGG - Intronic
1065002381 10:21348610-21348632 CAGAAGCAAGAGAGAGGAGGAGG + Intergenic
1065059868 10:21889200-21889222 CAGAAACGAGAGAGAGAGGGAGG + Intronic
1065176923 10:23086540-23086562 CAGAAGGAAGAGAGAGAGGTGGG + Intergenic
1065180643 10:23121310-23121332 CAGGAGCAAGAGAGAGTGGTAGG + Exonic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065437261 10:25716329-25716351 CAGAAGGAAGAAAGGGAGGCAGG + Intergenic
1065444106 10:25780044-25780066 CAGAAGCAGGAGCAAGGGGTTGG + Intergenic
1065473186 10:26104387-26104409 CAGAAGCAAAGGAATGAAGCTGG - Intronic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1065738536 10:28775730-28775752 CAGGAGGAAGAGAGAGAGGCAGG + Intergenic
1065863064 10:29887648-29887670 AGGAAGCAAGAGAAAGAAGGAGG - Intergenic
1065872932 10:29971480-29971502 CAGGAGCACGAGAGAGAGGGGGG + Intergenic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066160819 10:32725710-32725732 GAGAAGCAAGAGAGAGATGGGGG + Intronic
1066167706 10:32805974-32805996 CAGGAGCAAGAGAAAGAAGGGGG + Intronic
1066213885 10:33267071-33267093 CAGGAGCAAGAGAGAGGGGAGGG - Intronic
1066303426 10:34117040-34117062 AAGAGGCAAAAGACAGAGGCAGG - Intronic
1066499027 10:35972180-35972202 CAGGAGCAAGAGAGAGAGGTAGG + Intergenic
1066608517 10:37209416-37209438 CAGGAGCAAGAGAGAGAGGTGGG + Intronic
1067084838 10:43232310-43232332 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067302378 10:45023694-45023716 CAGAAGCAAGACTGAGAGGATGG + Intergenic
1067582299 10:47453277-47453299 GAGAAGCCAGAGAAACAGCCAGG + Intergenic
1067850797 10:49752444-49752466 CACAAGCTAGGGAAAGTGGCAGG + Intronic
1067942771 10:50670055-50670077 CAGAAGCCAGACACAGAGCCTGG - Intergenic
1068147861 10:53093940-53093962 CAGGAGCGAGAGAGAGAGGAGGG - Intergenic
1068273509 10:54761078-54761100 AGGAAGCCAGACAAAGAGGCAGG - Intronic
1068352718 10:55869519-55869541 CAGAAATAAGGGAAACAGGCCGG - Intergenic
1068460895 10:57327000-57327022 GAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1068654614 10:59561993-59562015 CAGGAGCAAGAGGAAGAGAGTGG + Intergenic
1068658949 10:59603676-59603698 CAGGAGCAAGAGAGTGAGGGGGG + Intergenic
1069116796 10:64517098-64517120 CAGGAGCAACATAAAGATGCTGG + Intergenic
1069409476 10:68138396-68138418 AACAAGAAAGAAAAAGAGGCCGG - Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1069992725 10:72325110-72325132 CACCAGCAACAGAAAGAGGCAGG + Intergenic
1070001150 10:72378427-72378449 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070350086 10:75583428-75583450 CAGAAGGAAGAGAGAGAGAAGGG + Intronic
1070394896 10:76003382-76003404 CAGAAGGAAGGGAGAGAGGATGG - Intronic
1070403761 10:76076392-76076414 AAGAAGAAAGAGAAAGAGAGAGG - Intronic
1070698867 10:78584383-78584405 CAGGAGAAAGACACAGAGGCAGG + Intergenic
1070864014 10:79695018-79695040 CAGAAGCCAGACACAGAGCCTGG - Intergenic
1071119588 10:82261967-82261989 CAGGAGTAAGAGAAAGAAGGGGG - Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072759051 10:98040809-98040831 CAGAAGGAATAGAAATGGGCTGG + Intergenic
1072783053 10:98262978-98263000 CAGCAGGAACAGAAAGAGGGTGG + Exonic
1072833247 10:98682210-98682232 CAGAAACAAGAGACAGAGAAGGG - Intronic
1072857975 10:98969926-98969948 CAAAAGCAGGAGCAAGAGGTGGG + Intronic
1072873681 10:99148864-99148886 CAGAGGGAAGGGCAAGAGGCAGG + Intronic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1073416957 10:103391802-103391824 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073701597 10:105933972-105933994 CAGAAGCAAGAGAGAGTGATGGG - Intergenic
1073935944 10:108632076-108632098 CCTAAGCAAGAGAAAGGGGATGG - Intergenic
1073990264 10:109254274-109254296 CAGGAGCAAGAAAGAGAGGTGGG + Intergenic
1074183994 10:111085711-111085733 CAGAAGAAAGAGTAAGGGGGCGG + Intergenic
1074487398 10:113899120-113899142 GAGAAGAGAGAGAAAGAGGAAGG - Intronic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1074496702 10:113985924-113985946 CAGAGGCAGGAGAGAGAGACAGG + Intergenic
1074592497 10:114826336-114826358 TAGAAGGAAGGGACAGAGGCAGG - Intronic
1074702722 10:116106628-116106650 CAGAACCAAGAGAAAGTGGAGGG - Intronic
1074770749 10:116732033-116732055 CAGAAGTAAGAGACAGGGCCAGG + Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074905702 10:117861711-117861733 CAGGAGCAAGAGAGAGAGTCGGG + Intergenic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075016647 10:118914537-118914559 CAGGAGCAAGAGAAAGAGTTGGG + Intergenic
1075148042 10:119899992-119900014 GAGAAGCAGGAGGAAGGGGCAGG - Intronic
1075553542 10:123412139-123412161 CAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1076188243 10:128465162-128465184 CTGAATCAAGAGATAGAAGCCGG - Intergenic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076736485 10:132461406-132461428 GGGAAGCAAGAGAGAGGGGCTGG - Intergenic
1076748023 10:132524128-132524150 GAGAAGCAAGAGAAAGAGACGGG - Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1077165202 11:1131666-1131688 GAGAAGCAAGAGGAAAGGGCAGG - Intergenic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077339775 11:2021139-2021161 CAGAAGCAATTGGAAGAGTCTGG + Intergenic
1077381374 11:2240623-2240645 CAGGAGCAAGAGAGACAGGGAGG + Intergenic
1077891562 11:6421698-6421720 CAGAAGCAAGAGAGTGTGGGGGG - Intergenic
1077959973 11:7065406-7065428 AATAAGCAAGAGAATGTGGCAGG - Intronic
1078467679 11:11562239-11562261 CAGAAGCCAAAGAGAGAGCCTGG - Intronic
1078516963 11:12030800-12030822 CAGGAGGAAGAGACAGAGGGAGG - Intergenic
1078534608 11:12163022-12163044 CAGGAGGAAGAGAAAGAGACAGG - Intronic
1078646745 11:13147820-13147842 CAGGAGCAAGAGAGAGAAGGAGG + Intergenic
1078777007 11:14403044-14403066 GAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1078824818 11:14919292-14919314 CAGGAGCAAGAGAGAGGGGAAGG - Intronic
1078873900 11:15375180-15375202 AAGAAGGAAGAGAGAGAGGGAGG - Intergenic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079178758 11:18169652-18169674 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1079270076 11:18976265-18976287 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1079288704 11:19165835-19165857 CAGAAGTAAGGGAACCAGGCGGG - Intronic
1079432374 11:20405105-20405127 AAGAAGGAAGAAAAGGAGGCTGG - Intronic
1079623457 11:22584271-22584293 AGGGAGCAAGAGAAAGAGGCAGG - Intergenic
1079739462 11:24038432-24038454 CAGGAGCAAGAGAGAGAGGGTGG + Intergenic
1079873027 11:25823242-25823264 CAGGAGCAAGAGCAAGAGAGTGG - Intergenic
1080061096 11:27957672-27957694 CAGGAGCAAGAGAGAGAGAGTGG + Intergenic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1080273291 11:30473717-30473739 CAGAAGGAGCAGAAAGATGCAGG - Intronic
1080318150 11:30973301-30973323 CAGGAGGAAGAGAGAGAGGGGGG - Intronic
1080362980 11:31537651-31537673 CAGGAGGAAGAGAAAGAGTGGGG + Intronic
1080442995 11:32312646-32312668 CATAAGGAAAATAAAGAGGCAGG + Intergenic
1080471069 11:32546242-32546264 AGGAAGCAAGAGAGAGAGGTGGG + Intergenic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1080951207 11:37035308-37035330 AAGAAGAGAGAGAAAGAGGGAGG - Intergenic
1081180274 11:39976596-39976618 CAGAAACTAGAGAAACAGGGAGG - Intergenic
1081674488 11:44960531-44960553 CAGAAGGAAGAGAAAGAAAAAGG - Intergenic
1081783808 11:45732425-45732447 CAGGAGGAAGAGAGAGAGGGTGG + Intergenic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082260028 11:50071626-50071648 CAGAAGGAAGAGGAAGAGCTGGG + Intergenic
1082282425 11:50284185-50284207 GAGAAGCAAGAGAGAGAAGTGGG + Intergenic
1082644799 11:55709418-55709440 CTGAAGCAAGAGGAAGAGATGGG - Intergenic
1082943667 11:58735349-58735371 AGGAAGCAAGAGATAGAGACGGG - Intergenic
1082985582 11:59167822-59167844 GAGAGGCAAGAGAAAAAGCCAGG - Intergenic
1083978627 11:66145413-66145435 CAGTAGCAAGAGAACAAGGAAGG + Intronic
1084148807 11:67278629-67278651 CAGCAGCCTGAGAAACAGGCAGG - Intronic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084496244 11:69505335-69505357 GAGGAGCAAGAGAGAGAGGGCGG + Intergenic
1084577330 11:69997790-69997812 CAGGAGCAAGAGAGAGAGAAAGG - Intergenic
1084653207 11:70500966-70500988 AAGAAACAACAGAATGAGGCAGG - Intronic
1085050115 11:73376103-73376125 GCGAAGCAAGATAAAGAGACTGG - Intergenic
1085152355 11:74262395-74262417 GAGAAAGAAGGGAAAGAGGCAGG + Intronic
1085241798 11:75062642-75062664 CAGGAGCAAGAGAGAGAGCAAGG - Intergenic
1085439485 11:76545603-76545625 CAAAACCTAGAGAAAGAGGAGGG - Intronic
1085827487 11:79863689-79863711 CAGGAGCAAGAGATAGAGAGGGG - Intergenic
1085986925 11:81799117-81799139 CAAAAGCATGAGCAAGAGGGAGG - Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086084482 11:82940697-82940719 CAGGAGCAAGAGTAGGGGGCAGG + Intronic
1086365790 11:86109293-86109315 CAGGAGCAAGAGAGAGAGTTGGG + Intergenic
1086543567 11:87941949-87941971 AAGGAGCAAGAGAGAGGGGCAGG - Intergenic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086753436 11:90528628-90528650 CAGAAGTAAGGGAAAGAGAAAGG + Intergenic
1086764451 11:90676784-90676806 CAGCAGCAAGAGAGAGGAGCTGG - Intergenic
1086788173 11:90998880-90998902 CAGAAGGAAGAGAAAAATGCAGG + Intergenic
1087302845 11:96456043-96456065 CAGAAGCAAGAAAGAGAGTAGGG - Intronic
1087377869 11:97367337-97367359 CAGAAGGAAGACACAGAAGCTGG + Intergenic
1088073745 11:105821529-105821551 CAGGAGCAAGAGAGAGAGGGCGG + Intronic
1088096072 11:106102743-106102765 CAGAAGCAAGTGAGAGAGTGAGG - Intergenic
1088528612 11:110784651-110784673 CAGAAGCAAGAGAGCAAGGAGGG - Intergenic
1088545513 11:110954972-110954994 CAGAAGCAAGAGAGTGAGGTGGG + Intergenic
1088551872 11:111021444-111021466 TAGAACCAAAACAAAGAGGCAGG + Intergenic
1088686993 11:112292352-112292374 CAGAAACAAAAGAAAAAGGAAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1088883069 11:113986787-113986809 CAGAGGCAAGAGACACATGCAGG - Exonic
1088891442 11:114047896-114047918 TAGAGGAAAGAAAAAGAGGCTGG + Intergenic
1089005721 11:115089142-115089164 CAGAAGCAAGAGAGAGTGAGGGG - Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089106989 11:116018678-116018700 CAGGAGCAAGAGAGTGAGGTGGG + Intergenic
1089413318 11:118265451-118265473 CAGGAACAAGAGAAGGCGGCAGG + Intergenic
1089764213 11:120751273-120751295 CAGAGGGCAGAGGAAGAGGCAGG + Intronic
1089773715 11:120821355-120821377 GAGGAGCAAGAGAGGGAGGCAGG + Intronic
1089951820 11:122535040-122535062 CAAGAGCAAGAGCAAGAGGGCGG - Intergenic
1090394416 11:126409230-126409252 CAGAAGAGAGAGACAGAAGCGGG - Intronic
1090638749 11:128712213-128712235 CAGGAGCAAGAGAGAGAAGGAGG - Intronic
1090736743 11:129617480-129617502 CAGGAGAAAGAGAGAGTGGCAGG - Intergenic
1090815054 11:130285586-130285608 CAGAAGAACAAAAAAGAGGCTGG - Intronic
1090883425 11:130854797-130854819 CCGAAGAAAGAGACAGAGACTGG - Intergenic
1091165129 11:133468765-133468787 CACAAGGTAGAGAAAGGGGCTGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1202822760 11_KI270721v1_random:76328-76350 CAGAAGCAATTGGAAGAGTCTGG + Intergenic
1091386690 12:100523-100545 CAGAGGTCAGAGAAAGAGGCGGG + Intronic
1091420673 12:337126-337148 CAGGAGGAAGAGAGAGAAGCGGG - Intronic
1091471315 12:730609-730631 CAGAAGGAAGAGAGAGAGTTGGG + Intergenic
1091500740 12:1015058-1015080 AAAAAGAAAGAAAAAGAGGCAGG - Intronic
1091632053 12:2169673-2169695 CAGAACCAACAAACAGAGGCTGG - Intronic
1091652837 12:2322646-2322668 CAGAAGGAAGGGAGAGAGGGAGG - Intronic
1091737663 12:2936452-2936474 AAGACTCAAGAGTAAGAGGCCGG + Intronic
1091978203 12:4843735-4843757 CAGAAGCAAGAGAGCGAGGTGGG + Intronic
1092005852 12:5069933-5069955 CTCAAGCAAGTGACAGAGGCGGG - Intergenic
1092076086 12:5674721-5674743 CAGAATCAAGTGACAGAGACAGG - Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092476610 12:8824050-8824072 CACAAGCAAGAGAAGTAGGTGGG + Intronic
1092674151 12:10897695-10897717 CAGGAGGAAGAGAAAGATGGGGG + Intronic
1092776374 12:11948143-11948165 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1093322406 12:17729009-17729031 CAGAAGCCAGATAAAGAGGTGGG - Intergenic
1094075233 12:26465158-26465180 CAGAAGCCAGAGAAAGAAATAGG + Intronic
1094169937 12:27480706-27480728 CAGGAGCAAGAGAGAGAGAGGGG - Intronic
1094242354 12:28242892-28242914 CAGAAGTAGGAGCAAGAGGGGGG - Intronic
1095311692 12:40705864-40705886 CAGGATCAAGAGAGAGTGGCGGG + Intronic
1095528603 12:43157946-43157968 CAGAAGCAAGAGAGAGAGCGGGG + Intergenic
1095610523 12:44122338-44122360 CACAAAAAAGAAAAAGAGGCTGG - Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095717985 12:45369418-45369440 CAGAAGAAAGAAGAAGAGGTGGG - Intronic
1095730194 12:45498231-45498253 CAGGAGCAAGAGCGAGAGGGTGG + Intergenic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096051013 12:48607436-48607458 CAGAAGGAAGAGAGAGAGGGAGG + Intergenic
1096136520 12:49206954-49206976 AAAAAGAAAGAGAGAGAGGCCGG + Intronic
1096160377 12:49371735-49371757 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1096491673 12:52015998-52016020 CTGAAGCCAGGGAAATAGGCTGG + Intergenic
1096565821 12:52477950-52477972 CAGAAGGAAGAGAGAGAGAAGGG - Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1096967318 12:55638585-55638607 CAGAAGCAAGACAAGGTGGAAGG + Intergenic
1097259360 12:57707452-57707474 CAGGAGCAAAAGAGAGAGGGGGG + Intronic
1097361736 12:58665924-58665946 CAGAAGCAAGAGAAAGAAGAGGG - Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097622516 12:61957827-61957849 AAGAAATAAGGGAAAGAGGCAGG - Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097928280 12:65155905-65155927 CAGGAGCAAGAGAGTGAGGGGGG + Intergenic
1098052228 12:66466457-66466479 CAGACACAAGGGAAAGAGTCTGG + Intronic
1098055906 12:66504965-66504987 CAAAATCAAGACAAAGAGACAGG - Intronic
1098183851 12:67876333-67876355 CAGGAGCAAGAGAGAAAGGGTGG - Intergenic
1098395033 12:70008021-70008043 AAGAAGCAGGAAAAAGAGGCGGG - Intergenic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098465078 12:70777680-70777702 CAGAAGGAAGAAAGAGAGGGTGG - Intronic
1098644268 12:72879525-72879547 CAGGAGCAAGAGAGAGAGAGGGG + Intergenic
1098670988 12:73231378-73231400 CAGAAGGAAGTGAAGCAGGCAGG + Intergenic
1098763148 12:74450193-74450215 CTGAAGCAAGAAAAAAATGCAGG + Intergenic
1098911644 12:76215107-76215129 CAGAAGCAAGATAATGAGGGGGG + Intergenic
1098939407 12:76517795-76517817 TAGGAGCAAGAGAGAGAGGTGGG + Intronic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099220381 12:79907107-79907129 TATTAGTAAGAGAAAGAGGCAGG + Intronic
1099689130 12:85927887-85927909 TGGAAGCAAGAGAAAGGGGAAGG - Intergenic
1099695631 12:86015103-86015125 CAGAAGTAGGACACAGAGGCCGG - Intronic
1100064302 12:90622686-90622708 CAGTAGCATGAGAAACAGTCGGG + Intergenic
1100142637 12:91636929-91636951 CAGGAGCAAGAGAGAGAGAGGGG - Intergenic
1100226450 12:92561251-92561273 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1100316654 12:93450781-93450803 CAGAAGCATAAGAAAAAGTCGGG - Intergenic
1100432566 12:94543659-94543681 AAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1100715564 12:97301887-97301909 TGGATGCAAGGGAAAGAGGCAGG - Intergenic
1100773233 12:97947109-97947131 GGGAAGAAAGAAAAAGAGGCTGG + Intergenic
1100774227 12:97956579-97956601 AAGAAGCAAGGAAAACAGGCAGG + Intergenic
1100910092 12:99350167-99350189 CAGGAGGAAGAGAAAGAAGGGGG - Intronic
1100915934 12:99421925-99421947 CAGGAGCAAGAGAGAGAGTGGGG - Intronic
1101413708 12:104490593-104490615 CAAAAGCAAGAGAGAGAGATTGG + Intronic
1101494271 12:105238595-105238617 CAGGAGTAAGAGAGAAAGGCAGG + Intronic
1101741127 12:107500833-107500855 CAGAGGCAAGAGAAATAATCTGG - Intronic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1101977992 12:109378778-109378800 AGGAAGCAAGAGAGAGAGGGAGG + Intronic
1102031424 12:109742048-109742070 CAGGGGCCACAGAAAGAGGCTGG + Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102325720 12:111981676-111981698 CAAAAGCCTGGGAAAGAGGCTGG + Intronic
1102448667 12:113023921-113023943 GAGAGGCCAAAGAAAGAGGCTGG - Intergenic
1102760495 12:115380721-115380743 CAGGAGGAAGTGAAAGAGGGAGG + Intergenic
1102872116 12:116422047-116422069 CAGAAGAGAGATACAGAGGCTGG - Intergenic
1102893639 12:116581136-116581158 CAGGAGCAAGAGAGAGAGTGAGG - Intergenic
1102940194 12:116934174-116934196 CAAAAGCAAAAAAAAGAGGAGGG - Intronic
1102983908 12:117263818-117263840 GAGAACCCAGAGAAGGAGGCTGG - Intronic
1103175933 12:118863083-118863105 AACAAGGAAGAGAACGAGGCTGG - Intergenic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1103238164 12:119391789-119391811 CAGAAGGAAGAAAAAGATACTGG - Intronic
1103317610 12:120069138-120069160 AAAAATCAAGAGAGAGAGGCTGG + Intronic
1103453867 12:121049522-121049544 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1103746402 12:123127593-123127615 AAAAAGAAAGAAAAAGAGGCAGG - Intronic
1103825093 12:123731674-123731696 TAGAACCAGGAAAAAGAGGCTGG - Intronic
1104219038 12:126764112-126764134 CAGGAGCAAGAGACAGAGAGGGG - Intergenic
1104366418 12:128182027-128182049 CAGAAGCAAGGGAATCAGGTAGG + Intergenic
1104507343 12:129344689-129344711 ATGCAGCAAGAGAAAAAGGCAGG - Intronic
1104725536 12:131073251-131073273 AAGCACCAAGAGATAGAGGCTGG + Intronic
1104769415 12:131351650-131351672 CAGGAGGAAGAGGAAGAGGAGGG - Intergenic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105585216 13:21737294-21737316 AAGAAGCAGGAGAAAGGAGCAGG - Intergenic
1105667212 13:22573709-22573731 CAGAAGCAAGCTGAAGAGGGTGG + Intergenic
1106243038 13:27925301-27925323 CAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106243051 13:27925350-27925372 CAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106474679 13:30088525-30088547 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106812005 13:33368030-33368052 AATAAGAAAGAGAAAGAGGAAGG - Intergenic
1106865515 13:33959982-33960004 CAGGAGCAAGAGAGAGTGTCAGG + Intronic
1106955647 13:34935677-34935699 CAGAAGCAAGAAAATGAGTAAGG + Intergenic
1106985248 13:35339725-35339747 CAGAAGCAGGAGCAAGAGAGAGG + Intronic
1107167427 13:37298984-37299006 CAGAAGCAAGAGAAAGAGATGGG + Intergenic
1107242375 13:38252007-38252029 CAGAACCATCAGAAACAGGCAGG - Intergenic
1107397251 13:40030613-40030635 CAGAAGGAAGAGAAAGAAATGGG - Intergenic
1107435658 13:40378425-40378447 CAGGAGCAAGAGAGACAGGGTGG - Intergenic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107672652 13:42761776-42761798 CAGAAAGTAGACAAAGAGGCTGG - Intergenic
1107799240 13:44088568-44088590 GGGAAGCAAGAGAGAGAGGAAGG - Intergenic
1107802751 13:44125661-44125683 CAGAAGCAAGACAGAGAGAGGGG + Intergenic
1107992843 13:45833549-45833571 TAAAAGGAAGAGAAAGAGGGTGG + Intronic
1108191906 13:47950394-47950416 GAGAGGCCAGAGAAAGAGGCTGG - Intronic
1108267429 13:48726262-48726284 CAGAACCAAAAGACAGAGGAAGG + Intergenic
1108549115 13:51525646-51525668 CCGAAGCAAGATACAGAGGGAGG + Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1108882434 13:55137105-55137127 CAGGAGTAGGAGAAAGAGACCGG - Intergenic
1108896574 13:55335637-55335659 CAGAAGCAAGAGAAAGAGAGTGG - Intergenic
1108984868 13:56574058-56574080 AAGAAACAAGAGAGAGTGGCAGG - Intergenic
1109156502 13:58917082-58917104 CACATGCAAAAGAAAGAAGCTGG + Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109420091 13:62100379-62100401 AACATGCAAGAGAATGAGGCAGG - Intergenic
1109721576 13:66282744-66282766 CAGAAGCAAGCAAAAGAGTGGGG + Intergenic
1109892274 13:68631038-68631060 CAAAAGTTAGAGAAATAGGCTGG + Intergenic
1109910427 13:68904362-68904384 CAGAAGCAAGAGAGAGAGAGGGG - Intergenic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110490120 13:76093607-76093629 CAATACCAAGAGAATGAGGCTGG + Intergenic
1110556334 13:76863728-76863750 GAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1110666979 13:78128293-78128315 CAGGAGCAAGAGGGAGAGGTGGG + Intergenic
1110669040 13:78154622-78154644 CAGAAGCAGGAGCAAGAAGGCGG + Intergenic
1111170163 13:84516546-84516568 CAGGAGCAAGTGAAAGAGTATGG - Intergenic
1111217610 13:85164404-85164426 AGGAAGCAAGAGAGAGAGGGGGG + Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111250895 13:85599926-85599948 CAGGAGCAAGAGAAAGAGAGAGG - Intergenic
1111494941 13:89035313-89035335 CAGGAGCAAGAGAAAGAGGGAGG - Intergenic
1111515907 13:89330608-89330630 CAGCAGCAAGAGAGAGAAGGAGG + Intergenic
1111634135 13:90881561-90881583 CAGGAGCAAGAGAGAGTGACGGG - Intergenic
1111656513 13:91160921-91160943 CAGGAGGAAGAGAGAGAAGCAGG - Intergenic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1111790661 13:92851084-92851106 GAGCAGCAAGAGAAAGAGAAGGG + Intronic
1111813594 13:93122173-93122195 CAGAAGAGAGAGAGAGAGGGTGG - Intergenic
1111877864 13:93919113-93919135 CAGGGGCAAGAGAGAGAGGGAGG - Intronic
1112105746 13:96237347-96237369 GAGAAGGAAGAGGAAGAGGAGGG - Intronic
1112235769 13:97634862-97634884 CAGGAGCAAGAGAGAGAGCAAGG + Intergenic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1112671440 13:101643899-101643921 CAGAAAGAAGAGAAAGAGCTTGG - Intronic
1112735093 13:102407380-102407402 AAGAAGGGAGAGAAAGAGGGAGG - Intergenic
1112765482 13:102737525-102737547 CAGGAGCAAGGGAAAGAGGACGG - Exonic
1112786251 13:102954912-102954934 AAGAAGAAAGAGGAAGAGGAGGG - Intergenic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113308482 13:109105053-109105075 TAGAAGCCAGAGAAAGACACAGG + Intronic
1113374917 13:109756106-109756128 CGGGAACAAGGGAAAGAGGCAGG + Exonic
1113673992 13:112195857-112195879 AAGAAGGAAGGGAAAGAGGGAGG - Intergenic
1113674029 13:112196000-112196022 AAGAAGCAAAGGAAAGAGGGAGG - Intergenic
1113814421 13:113161548-113161570 CAGAAGGAAGCGGGAGAGGCAGG + Intronic
1113841467 13:113363914-113363936 CAAAACCGAGAGAAGGAGGCCGG + Intronic
1113935171 13:113990074-113990096 CAGGAGCAAGAGAGAGAGATGGG - Intronic
1114248716 14:20938455-20938477 CAGAAGCAAGAGAGAGAGGGAGG - Intergenic
1114581310 14:23762622-23762644 CAGAAGCAAGAGTGAGGGGAAGG + Intergenic
1114684110 14:24512031-24512053 CAGAAACTATAGAAACAGGCAGG - Intergenic
1114881905 14:26796717-26796739 AAGAAGAAAGAGAAAGAAGGAGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115286145 14:31714534-31714556 CAGAAGGAAGAGAGACAGGCGGG + Intronic
1115329029 14:32173856-32173878 AAGAAGAAAGACAAAGAGGGAGG - Intergenic
1115351957 14:32405265-32405287 CAGAAGCAGGAAGAAGAGGAAGG - Intronic
1115359968 14:32489503-32489525 TAAAAACAAGAGAAAGGGGCTGG - Intronic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115703899 14:35978532-35978554 CTGAGGCAGGAGAAACAGGCAGG + Intergenic
1115812460 14:37124835-37124857 CAGGAGCAAGAGAGAGAGGTAGG - Intronic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1115867666 14:37766155-37766177 CAGAAGGAAGAGAAAAAGAAAGG - Intronic
1115998006 14:39213633-39213655 CAGAAAAAAGACATAGAGGCTGG + Intergenic
1116187148 14:41611037-41611059 CAGAAGAAAGTGAAATAGGTGGG - Intronic
1116206442 14:41873379-41873401 CAGAAGAGAGAGAAAGAGAGAGG + Intronic
1116211702 14:41954613-41954635 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1116507184 14:45698588-45698610 CAGAAGCAAGAGAGAGAAGAGGG - Intergenic
1116680568 14:47964484-47964506 CAGGAGCAAGAGAAGAAGCCTGG - Intergenic
1117050037 14:51850780-51850802 CAGGAGCAAGAGAGAGAGAGTGG + Intronic
1117497518 14:56320128-56320150 CAGAAGCAAGAGAGGGAGCGGGG - Intergenic
1117503478 14:56377162-56377184 AAGAAGGAAGAGATAGAGGGAGG - Intergenic
1117964134 14:61189524-61189546 CAGAAGCAAGAGAGAGAGGAAGG - Intronic
1118103338 14:62629942-62629964 AAGGAGCAAGAGAGAGAGGGAGG - Intergenic
1118107997 14:62682459-62682481 AGGAAACAAGAGAAAGAGGTAGG + Intergenic
1118138834 14:63057220-63057242 GAGATGCGAGAGAAAGGGGCAGG + Intronic
1118268388 14:64317466-64317488 CAGAAGCAAGATAGAGAGACAGG + Intronic
1118424936 14:65650474-65650496 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1118518329 14:66551769-66551791 CAGGAGGAAGAGAAAGAAGGAGG + Intronic
1118559045 14:67057686-67057708 AACAAGAAAGAGAAAGAGGAAGG - Intronic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1118818340 14:69328278-69328300 AAGAAGCAAGGGAGGGAGGCAGG + Intronic
1118841389 14:69515680-69515702 CAGGAGCAAGAGAGAGAGCATGG + Intronic
1119386764 14:74262093-74262115 CAGAAGGATGGGAAAAAGGCTGG + Exonic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119711999 14:76829127-76829149 GTGAAGCAAGAGAATGACGCTGG + Intronic
1119968515 14:78943488-78943510 AGAAAGCAAGGGAAAGAGGCAGG + Intronic
1120464078 14:84833693-84833715 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1120609629 14:86624070-86624092 CAGCAGCCAGAGAGAGATGCAGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120819390 14:88897938-88897960 CAGAAGCAAGACAGAGAGTGGGG + Intergenic
1120892724 14:89505371-89505393 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1120902520 14:89588160-89588182 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1121500408 14:94431413-94431435 TAGAAGCAATAGAGAGAGGGGGG - Intergenic
1121588753 14:95083017-95083039 CACATGCAAAAGAATGAGGCTGG + Intergenic
1121636997 14:95460800-95460822 CAGGAGTAACAGACAGAGGCTGG + Intronic
1121732538 14:96196609-96196631 AGGAAGCAAGAGAGAGAGGGAGG + Intergenic
1121755620 14:96399768-96399790 AAGGAGCCAGAGAAAGAAGCTGG - Intronic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122515676 14:102306714-102306736 CGAAAGAAAGAGAAAGCGGCCGG + Intergenic
1122730363 14:103792772-103792794 CAAAAAAAAGAAAAAGAGGCTGG + Intronic
1123586074 15:21761794-21761816 CAGAATCAAGTGACAGAGACAGG + Intergenic
1123622716 15:22204384-22204406 CAGAATCAAGTGACAGAGACAGG + Intergenic
1123720822 15:23060679-23060701 CAGAAGCAAGAGAGCAAGGAGGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1123954154 15:25316197-25316219 CAGAAGCAAAAGATAGCAGCTGG - Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1124146422 15:27130247-27130269 CAGAAGCAAAAGAATGAAGTTGG - Intronic
1124167641 15:27342392-27342414 CAGCAGCCAGAGACACAGGCTGG - Intronic
1124393472 15:29280483-29280505 GGGAAGGAAGAGGAAGAGGCAGG + Intronic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1125036765 15:35134317-35134339 AGGAAGGAAGAGAAAGAGGAAGG - Intergenic
1125138240 15:36369331-36369353 CAGAACCAAGTGAGAAAGGCTGG - Intergenic
1125298506 15:38228987-38229009 GAGAAAGAAGAGAAAGAGGAAGG + Intergenic
1125326096 15:38537398-38537420 CAGGAGCAAGAGGGAGAGGGAGG + Intronic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125480633 15:40077275-40077297 AAAAAGAAAGAGAAAGAGGGAGG + Intergenic
1125556678 15:40591569-40591591 CAGAAGCAAGAGAGAGCGCACGG + Intergenic
1125672193 15:41481686-41481708 CAGAATCACCAGGAAGAGGCTGG - Exonic
1125792605 15:42380285-42380307 GAGAAGCCAGAAAAAGGGGCAGG - Intronic
1125799302 15:42430939-42430961 AAGAAACTAGAAAAAGAGGCTGG - Intronic
1126007447 15:44271729-44271751 CAGAAGTGTCAGAAAGAGGCTGG + Intergenic
1126175184 15:45729408-45729430 CCGAAGCAAGAGAAAGGGAAGGG + Intergenic
1126179792 15:45773958-45773980 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1126487637 15:49199849-49199871 GAGCAACAAGAGAATGAGGCAGG + Intronic
1126490776 15:49233244-49233266 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1126653991 15:50956364-50956386 CACCAGCAAGAAAAGGAGGCTGG - Intronic
1126907465 15:53383525-53383547 CAGAAGCAAGAGAGAGAGGAGGG + Intergenic
1127013024 15:54650755-54650777 CAGAAGGAAGAAAAAGAAGGGGG + Intergenic
1127025532 15:54801154-54801176 CAGGAGCAAAAGAGAGAGGAGGG + Intergenic
1128151532 15:65366368-65366390 CTAAAGAAAAAGAAAGAGGCAGG + Intronic
1128349133 15:66877488-66877510 CAGAGACAGGAGAAAGAAGCAGG + Intergenic
1128477297 15:68008190-68008212 CAGGAGTAAGAGACAGAGTCGGG - Intergenic
1128478368 15:68016550-68016572 CAGGAGGAAGAGAGAGAGGCAGG - Intergenic
1128689213 15:69710490-69710512 CAGAAGCAAGGGCCAGGGGCAGG + Intergenic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129686377 15:77688417-77688439 CAGAAGCTAATGAAAGAGGCTGG - Intronic
1129737640 15:77974982-77975004 CAGAAGCAATGGAGGGAGGCAGG - Intergenic
1129911472 15:79230948-79230970 CAGAAGCAAGAGAGAGAGAGAGG + Intergenic
1129927256 15:79375613-79375635 CAGAAGCAAGAGAGAGAGGGAGG + Intronic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130546247 15:84859074-84859096 CAGAAGCCTGAGATATAGGCAGG + Intronic
1130773016 15:86944055-86944077 CTGAAGGAAGAGTAAGAGTCAGG + Intronic
1130874633 15:88002860-88002882 CCCAAGCCAGAGAAAGAGGAAGG + Intronic
1131278622 15:91003153-91003175 CAGGTGCATGAGAAAGAGGCCGG + Intronic
1131291654 15:91111855-91111877 CAGGAGCAAGAGAGAGAGAGGGG + Intronic
1131327613 15:91463487-91463509 CAGGAGCAAGAGAGAGAGCGAGG - Intergenic
1131439747 15:92450578-92450600 CAGGAGCAAGAGAGAGAGGGAGG + Intronic
1131463974 15:92639758-92639780 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1131465233 15:92649453-92649475 CAGAAGCAAGACCAAAAGGTTGG + Intronic
1131526374 15:93155930-93155952 CAGGAGCAAGAGAGAGAGATGGG - Intergenic
1131622036 15:94078573-94078595 CAGGAGCAAGAGAACGTGGGGGG - Intergenic
1131730106 15:95270459-95270481 CAAAAGAAAAAGAAACAGGCCGG + Intergenic
1132112086 15:99109073-99109095 CAGAAGCTATAGCCAGAGGCAGG - Intronic
1132360982 15:101215003-101215025 CAGAAGCAAGAGAAAGCGAAGGG - Intronic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133290041 16:4714314-4714336 CATCTGCATGAGAAAGAGGCAGG + Intronic
1133358964 16:5158465-5158487 CGGGAGCAAGAGAATGAGGAGGG - Intergenic
1133517451 16:6523260-6523282 AAGAAGGAAGAGACAGAGGGAGG + Intronic
1133646908 16:7773266-7773288 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1133662224 16:7929316-7929338 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1133836951 16:9376090-9376112 CAGAAGCCTGAGAAAGGGGCAGG - Intergenic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1134260798 16:12649361-12649383 CATAAGCCAGAGCTAGAGGCTGG - Intergenic
1134318202 16:13139265-13139287 AAGAAGGAAGAGATAGAGGAAGG - Intronic
1134390546 16:13816197-13816219 CAGGAGCAAGAGACAGAGAGTGG - Intergenic
1134605685 16:15569390-15569412 CAGGAGCAAGAGAGTGAGGCGGG + Intronic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1134914423 16:18058067-18058089 CAGGAGCAAGAGAGAGAGACTGG + Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135405899 16:22197567-22197589 GAAAAGAAAAAGAAAGAGGCAGG + Intergenic
1135490954 16:22908980-22909002 CAGAAGAAAGGGGAAGAGCCAGG + Intronic
1135676695 16:24421185-24421207 CAGAAGCAAGAGAGCGAGGCTGG - Intergenic
1135685819 16:24497618-24497640 AAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1135821222 16:25688288-25688310 CAGGAGCAAGAGAGCGAGGCAGG - Intergenic
1135873144 16:26170609-26170631 CAGAAGCAAGAGAGAGTGCAAGG - Intergenic
1135963037 16:27013533-27013555 CAGAAGCAAGGGAAAGGTGCTGG + Intergenic
1136030051 16:27496113-27496135 CAGGAGCAAGAGAGAGAGTTGGG - Intronic
1136087883 16:27898441-27898463 CAGAAGCACGAGAAAGGGGAAGG + Intronic
1136130385 16:28216801-28216823 CAGTAGCAATAGAAATAGGCAGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137632955 16:49960327-49960349 CAGAAGAAAGAGCCAGGGGCTGG + Intergenic
1137798459 16:51241250-51241272 AGGAAGCAAGAGAAATAGGGAGG + Intergenic
1137800999 16:51262087-51262109 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1137936348 16:52638680-52638702 CAGAAGCAAGAGAGAAAGTTGGG + Intergenic
1138160167 16:54745984-54746006 TAAAAGAAAGAGAGAGAGGCTGG + Intergenic
1138169243 16:54833530-54833552 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1138199987 16:55081517-55081539 CAGGAGCAAGAGCAAGAGAAAGG + Intergenic
1138292031 16:55856010-55856032 CAGGAGGAAGAGAGAGAGGGAGG - Intronic
1138293860 16:55870323-55870345 AAGAAGAAAGAGGAAGAGGAAGG + Intronic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138311508 16:56027412-56027434 CAGATGTAAGAGAATGAGCCTGG - Intergenic
1138545633 16:57717876-57717898 CAGGAACAAGGGAAATAGGCAGG - Intronic
1138692089 16:58777581-58777603 CAAAAGGAAGAGAGAGAGGCTGG - Intergenic
1138837310 16:60454110-60454132 TAGAAGCAAGACACAGAGTCTGG + Intergenic
1139004180 16:62551195-62551217 CGGAAGTAAGAGAAAGAAGCTGG - Intergenic
1139084084 16:63562757-63562779 CAGGAGCAAGAGAGAGTGGGAGG - Intergenic
1139474940 16:67198463-67198485 CAGAAGCAAGACACTGAGGCTGG - Exonic
1140139720 16:72244121-72244143 CAGAAGAAATAAAAAGAGGAAGG + Intergenic
1140248980 16:73277891-73277913 CAGGAGCAAGAGAGAGAGGCAGG + Intergenic
1140421243 16:74821165-74821187 CAAGAGCAAGAGAAAGAGGTAGG - Intergenic
1140646457 16:77036966-77036988 CAGGAGGTAGAGAAAGAGACAGG - Intergenic
1140716086 16:77726963-77726985 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1140989718 16:80198324-80198346 CAGGAACAAAAGAATGAGGCTGG - Intergenic
1141046998 16:80724209-80724231 GAGAAGAAAGAGGAAGAGGAGGG + Intronic
1141086753 16:81101282-81101304 CAGCTGCAAGAGAAAGAACCAGG + Intergenic
1141188686 16:81807832-81807854 CAGGAGCAAGAGAGAGAGGGAGG + Intronic
1141224264 16:82100439-82100461 CAGGAGGAAGAGAGAGTGGCGGG + Intergenic
1141232923 16:82187233-82187255 CAGAAGGAAGAGAGACAGGAGGG - Intergenic
1141381947 16:83584892-83584914 CAGAAGCAAGAGATAGGGGGAGG + Intronic
1141424363 16:83935676-83935698 CTGAAGCAAGAGAGCGGGGCTGG + Intronic
1141426453 16:83947525-83947547 GGGAGGCAAGAGACAGAGGCGGG + Intronic
1141492694 16:84385234-84385256 CAGGAGCAAGAGAGAGAGCAGGG + Intronic
1141808462 16:86357940-86357962 CAGAAGCCAGGGAATGAGCCTGG + Intergenic
1141928246 16:87183317-87183339 CAGGAGCAAGAGAGAGAGCCAGG - Intronic
1141944608 16:87300773-87300795 CACAAGCAAAAGAATGAAGCTGG + Intronic
1142027786 16:87823801-87823823 CAGCAGCCAGAGGAGGAGGCCGG - Intergenic
1142250722 16:88990616-88990638 GGGAAGGAAGAGAAAGAGCCAGG + Intergenic
1142478265 17:202502-202524 CAGCAGCAAGAGAGTGAGGCGGG + Intergenic
1142572275 17:882759-882781 CAAAAACAAAACAAAGAGGCCGG - Intronic
1143015949 17:3891371-3891393 AAGGATCAAGAGAAAGGGGCTGG + Intronic
1143069157 17:4275993-4276015 CAGAAGGAAGAGACAGAGACTGG - Intronic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1143553673 17:7647522-7647544 AAAAAGAAAGAGAAAGAGACCGG + Intronic
1143593998 17:7903246-7903268 CAGGGGCAAGAGAAAGTGGCGGG - Intronic
1143711291 17:8736970-8736992 AAGAAGAAAGAGAGAGAGGGAGG + Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1143857920 17:9866133-9866155 CAGAAAGAAGTGAAAGAGGCAGG + Intronic
1143870932 17:9956913-9956935 CAGAACCCAGAGGAAGAGGCTGG + Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144148128 17:12417885-12417907 CGGGAGCAAGAGAGAGAGGGAGG + Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144424187 17:15125917-15125939 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1144549122 17:16224183-16224205 CTGTCGCAAGAGCAAGAGGCTGG - Intronic
1144550902 17:16240167-16240189 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1145022728 17:19444174-19444196 CAGAAGGAAGAGCACGAAGCAGG - Intergenic
1145038035 17:19555021-19555043 GAGAAGGAAGAGAAAGGGGTGGG + Intronic
1145213026 17:21029129-21029151 CAGAAGAAAGAAAAAGGAGCAGG + Intronic
1146174712 17:30658415-30658437 CAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146348172 17:32074426-32074448 CAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1146348440 17:32076199-32076221 AAGGAGCAAGAGAAAGAGCAGGG - Intergenic
1146382526 17:32341728-32341750 CAGCCGCGAGAGTAAGAGGCTGG + Intronic
1146732499 17:35206028-35206050 TGGAAGCAAGAGAGAGGGGCAGG - Intergenic
1146828562 17:36046613-36046635 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
1146928088 17:36758662-36758684 CATGAGCAAGAGAAAGAGGGTGG + Intergenic
1146966772 17:37037911-37037933 CAGGAGCAAGAGAGAGAGTGGGG - Intronic
1147336782 17:39730822-39730844 CAAAAGAAAGAGAAAGTGGTGGG + Intergenic
1147366085 17:39960219-39960241 GAAAAGAAAGAAAAAGAGGCAGG + Intergenic
1147463823 17:40594667-40594689 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1147475837 17:40710751-40710773 CAGGAGCAAGAGAGAGATGGGGG + Intergenic
1147504548 17:41002527-41002549 CAGAAGCAAGGTGAAGGGGCAGG - Intergenic
1147779616 17:42931280-42931302 AAAAAGCAAGATAAAGAGCCAGG - Intergenic
1148005491 17:44425189-44425211 CAGAAGGATGAGAAAGGGACAGG + Intronic
1148014207 17:44509597-44509619 CAAAAGAAAGAGAGAGAGGGGGG + Intergenic
1148343922 17:46890803-46890825 CAGAAGCAAGAGGCACGGGCGGG + Intergenic
1148352378 17:46950336-46950358 CAGAGGCAAGTGAAAGGGCCAGG + Intronic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1148604106 17:48915922-48915944 CATGAGCATGAGACAGAGGCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148897618 17:50848886-50848908 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
1148978530 17:51550526-51550548 CAGAAGTAAGGGGAAGAGCCAGG - Intergenic
1149176345 17:53876402-53876424 CAGAATCAAAAGAAAGTGGTTGG - Intergenic
1149246540 17:54714844-54714866 CAGGAACAAGAGAAAGAGAGGGG + Intergenic
1149358453 17:55868748-55868770 CAGAAGAAAGAGAGAGAGTAGGG + Intergenic
1150023151 17:61641197-61641219 CAAGAGCAAGAGAGAGAGGGGGG - Intergenic
1150090631 17:62321977-62321999 GAGAAGTAAGATAAAAAGGCAGG + Intergenic
1150246209 17:63677509-63677531 CAGTAGCAAGGGAAACAGCCAGG + Intronic
1150296257 17:64009320-64009342 CAGTAGCAGGAGGAAGATGCTGG - Intronic
1150425348 17:65073098-65073120 CAGAAGTGAGAGAAAAAGGAAGG + Intergenic
1150465198 17:65386688-65386710 GAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1150484437 17:65533847-65533869 CAGAACCAAGAGCCAGAGCCTGG - Intronic
1151244695 17:72785367-72785389 AAGAACCCAGAGAAAGAGTCGGG + Intronic
1151400983 17:73855914-73855936 AAGATGCCAGAGAGAGAGGCTGG - Intergenic
1151420634 17:73994860-73994882 AAAAATCAAGAGAAAGAGACTGG + Intergenic
1151479286 17:74360937-74360959 CAGTAGCAGGAGAGAGGGGCGGG + Intronic
1151675379 17:75594866-75594888 CAGAAGCCGGTGGAAGAGGCGGG - Intergenic
1151967799 17:77440648-77440670 CAGAAGCAGGGAGAAGAGGCAGG + Intronic
1152237872 17:79147835-79147857 CATTAGCATGAGAGAGAGGCTGG - Intronic
1152246835 17:79189009-79189031 CAGAAGCCAAAGGAAGAGGGGGG + Intronic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152987407 18:333420-333442 CAGAAGCAACAACAAGAAGCAGG + Intronic
1153173083 18:2338868-2338890 AGGAAGCAACAGGAAGAGGCAGG + Intergenic
1153224023 18:2884250-2884272 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1153276106 18:3369206-3369228 AGGAAGCAAGAGAGAGAAGCAGG - Intergenic
1153461483 18:5338672-5338694 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1153486091 18:5599646-5599668 CAGGAGCAAGAGATAGAGCAAGG - Intronic
1153650754 18:7237806-7237828 AAGAGGCCAGTGAAAGAGGCGGG + Intergenic
1153652795 18:7256180-7256202 CTGAGGCAAGAGGATGAGGCAGG - Intergenic
1153665862 18:7367304-7367326 AGGAAGCAAGAGAAAGAAGTCGG - Intergenic
1153841543 18:9012323-9012345 CAGAGGCAATAGACAGAGACAGG - Intergenic
1154151867 18:11912590-11912612 CCGGAGCCAGAGGAAGAGGCAGG + Intergenic
1154933111 18:21021266-21021288 CAGAAGAGAGAGAAAGATTCAGG + Intronic
1155012307 18:21792089-21792111 CAGAAGCAAGGGATACAGACAGG - Intronic
1155317677 18:24588861-24588883 TAGAAGCAAGAGCAAGAGAAGGG - Intergenic
1155338529 18:24790664-24790686 AGGAAGCAAGAGAGAGAGGGAGG - Intergenic
1155364732 18:25038643-25038665 GAGAAGCAGGAGGCAGAGGCAGG + Intergenic
1155431819 18:25767714-25767736 CAAAAGCTATAGAAATAGGCGGG - Intergenic
1155653141 18:28164737-28164759 CAGAAGCAAGAGACAGATCTAGG + Intronic
1155688102 18:28580566-28580588 CAGGAGCAAGAGAGAGAGGTGGG + Intergenic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1155891621 18:31277568-31277590 TACAAGCAAGAGAGAGAGGGAGG - Intergenic
1155983335 18:32203823-32203845 CAGGAGCCAGAGAAAGAGTGGGG + Intronic
1156072986 18:33236506-33236528 AAGAAGCAACAGAAAGAAACTGG - Intronic
1156131752 18:33984590-33984612 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156163150 18:34384721-34384743 TAGTGGCAAGAGAAAGAGGAAGG - Intergenic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1156216216 18:35000709-35000731 CATAAGCCAGAGAAAGCAGCTGG + Intronic
1156220655 18:35048175-35048197 CAGAAGCAAGAGAGAGGGAGTGG + Intronic
1156224622 18:35092016-35092038 CAGGAGCAAGAGAGAGATGTGGG + Intronic
1156314723 18:35957926-35957948 CGGAAGAAAGAGAGAGAGGGAGG + Intergenic
1156422263 18:36967692-36967714 CAGAAGGAAGAAACAGATGCTGG + Intronic
1156453065 18:37277456-37277478 GAGAAGGAAGAGAGAGAGGGAGG + Intronic
1156524864 18:37757508-37757530 CAGGAGCAAGAGAGAGAGAAGGG - Intergenic
1156689981 18:39695936-39695958 CAGAAGCAAGAAAACAAGACAGG + Intergenic
1156812666 18:41271789-41271811 CAGAAGCAAGAGAGGGAGGTGGG - Intergenic
1156819841 18:41359095-41359117 CAGAAGCAAGAGAGAGAGTGGGG - Intergenic
1156886932 18:42145769-42145791 CAGGAGAAAGAGAGAGAGGGTGG + Intergenic
1157362700 18:47034066-47034088 CGGAAGCAAAAGAAAAAGACTGG - Exonic
1157382022 18:47227170-47227192 GAGAAGGAGGAGGAAGAGGCAGG - Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157709921 18:49843170-49843192 GAGAAGCAACAGTAAGGGGCTGG + Intronic
1158076466 18:53536184-53536206 AGGAAGCAAGAGAGAGAAGCAGG + Intergenic
1158173455 18:54626115-54626137 CAGAAGCAAGAGAGAAAGTAGGG - Intergenic
1158344883 18:56506281-56506303 CTGAAGTGAGAGAGAGAGGCTGG + Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158578086 18:58657251-58657273 CAGAAACAAGAGACAGAGAAAGG - Intergenic
1158602327 18:58865078-58865100 CTTAAGCAAAAGAAAAAGGCAGG - Intronic
1158643549 18:59222455-59222477 GAGGAGCAAGGGAAAGAGGGAGG + Intronic
1158750403 18:60252915-60252937 GAGAAGCAAGAGAGTGAGACTGG - Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1158904917 18:62002438-62002460 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1159002693 18:62987880-62987902 CAGAAGTGTCAGAAAGAGGCAGG - Intergenic
1159089213 18:63828262-63828284 CAGAAGCAAGAGAGAGAGATGGG - Intergenic
1159163889 18:64678218-64678240 CAAAAGCAACAGGAAGAGTCCGG + Intergenic
1159290149 18:66406914-66406936 CTGAAACAAGGGAAATAGGCTGG - Intergenic
1159333383 18:67030844-67030866 CAGGAGCAACAGAAAGTGGGAGG - Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159664709 18:71144165-71144187 TAGAAGTAAGAGAATGAGGAAGG - Intergenic
1159702084 18:71641247-71641269 AGGAAGCAAGTGATAGAGGCAGG - Intergenic
1159728551 18:71995054-71995076 CAGAAGGAAGAGAAAGATGGGGG + Intergenic
1159938268 18:74385901-74385923 GAGAATCATGGGAAAGAGGCGGG - Intergenic
1160723340 19:606873-606895 TAAAAGCAAAAGGAAGAGGCCGG + Intronic
1160816991 19:1040684-1040706 CGGGAGCCAGAGAAAGAGTCAGG - Intronic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1161397066 19:4050355-4050377 CAGAAACAAGAGAGACCGGCCGG - Intronic
1161654545 19:5506103-5506125 CAGAAGTCAGTGAAGGAGGCCGG - Intergenic
1161881688 19:6958912-6958934 CACCAGCAAGAGGAAGAGGTTGG + Intergenic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162059242 19:8084882-8084904 CAAAAGCAATAAAAATAGGCCGG - Intronic
1162103047 19:8352188-8352210 AAGAAGAAAGAAAAAGAGGGAGG + Intronic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1162827834 19:13264588-13264610 CAGAGGCAAAAGAATGTGGCTGG - Intronic
1162911623 19:13850767-13850789 AAGAGTCAAGAGTAAGAGGCAGG - Intergenic
1163048448 19:14662742-14662764 CAGAAGCAGGAGCAAAAGGGAGG - Intronic
1163108764 19:15144086-15144108 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1163227591 19:15975485-15975507 TAGAAGCAGGATAAAGAGGTGGG + Intergenic
1163345115 19:16736228-16736250 CAAAAGAAAGAGAGAGAGGAAGG - Intronic
1163384447 19:16990898-16990920 CAGGAGCCAGAGACAGAGGCAGG - Intronic
1163571815 19:18086773-18086795 CAGCAGGAAGAGGAAGAGGAGGG + Exonic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164597295 19:29538727-29538749 AGGAAGCAAGAGAGAGAGGGAGG + Intronic
1164620451 19:29692791-29692813 GAGAGGCCAAAGAAAGAGGCTGG - Intergenic
1164729003 19:30487549-30487571 CAAAAGAAAAAGAAAGAGGGAGG - Intronic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1164826338 19:31287462-31287484 CAGGAGGGAGAGGAAGAGGCAGG + Intronic
1164858807 19:31546192-31546214 TAAGAGCAAGAGAATGAGGCAGG - Intergenic
1164970157 19:32525063-32525085 AAGAAACAAGAGATTGAGGCTGG + Intergenic
1165174707 19:33919780-33919802 CAGTAGCAAGACAGAGAGGGAGG - Intergenic
1165199227 19:34131968-34131990 CTGAGGCAAGAGAATCAGGCAGG - Intergenic
1165557591 19:36648217-36648239 CAGGAGCAAGAGAGAGAGTGGGG - Intronic
1165906532 19:39197812-39197834 AAGAACCCAGAGAAAGAGACAGG - Intronic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166084128 19:40464061-40464083 AAAAAGAAAGAAAAAGAGGCTGG - Intronic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1167304419 19:48698908-48698930 CAGAAGACACAGAGAGAGGCAGG - Intronic
1167653190 19:50744881-50744903 CAAGAGCAATACAAAGAGGCTGG - Intergenic
1168077404 19:53988833-53988855 CAGCAGCAAGAGACAGGAGCTGG - Exonic
1168264423 19:55214355-55214377 CAGGAGCAAGAGAGAGAGGACGG + Intergenic
1168313007 19:55470842-55470864 CAGAAGCACGGAAATGAGGCCGG - Intergenic
1168451676 19:56471163-56471185 TGGGAGCAGGAGAAAGAGGCAGG - Intronic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
1168696388 19:58406246-58406268 CTGAGGCAAGAGAATCAGGCAGG + Intronic
1168704270 19:58459702-58459724 CAGGAGCAAGAGAGAAAGGAAGG - Intergenic
925094415 2:1184614-1184636 CAGGAGGAAGAGCAAGAAGCAGG + Intronic
925248030 2:2402187-2402209 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
925258885 2:2512485-2512507 CAGAAGCAAGAGGTGGACGCAGG + Intergenic
925270863 2:2606485-2606507 CAGGAGCAAGAGAGAGAGAGAGG - Intergenic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
925427459 2:3762572-3762594 CAGGAGCAAGAGAGAGAGTCGGG + Intronic
926232281 2:11013331-11013353 CAGGAGCGAGAGAATGAGGCGGG - Intergenic
926378943 2:12264723-12264745 CAGGAGCAAGAGAGCGAGGAAGG + Intergenic
926392370 2:12406370-12406392 CAGGAGCAAGAGAGAGAGAATGG + Intergenic
926459901 2:13115984-13116006 CAGAAGCCAAAGGCAGAGGCAGG - Intergenic
926550781 2:14298645-14298667 CACAAGGAAGAGACAGAGGCTGG - Intergenic
926560837 2:14415670-14415692 CAGGAGCAAGAGAAAGAGTGGGG - Intergenic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
926987330 2:18639198-18639220 CACAAAGATGAGAAAGAGGCCGG - Intergenic
927300417 2:21505922-21505944 AGGAAGCAAGAGAGAGAGGGAGG - Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927737035 2:25533622-25533644 AAGTAGAAAGAGAGAGAGGCAGG - Intronic
927987399 2:27422167-27422189 CAATAGCAAGAAAAACAGGCTGG + Intergenic
928051531 2:28001739-28001761 CAGGAGCAAGAGAGAGAGGAGGG + Intronic
928219498 2:29391678-29391700 TAGAAGCAAGAAAGAGAGGAGGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928831146 2:35485332-35485354 GAGAAGGAAGAGGAAGAGGAGGG + Intergenic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929074273 2:38065383-38065405 AAAAAGAAAAAGAAAGAGGCTGG + Intronic
929095946 2:38263425-38263447 CAGAAGCAAGAGAAGGACGTGGG + Intergenic
929098584 2:38287070-38287092 AAGGAACAAGAGAAAAAGGCTGG + Intergenic
929172992 2:38949865-38949887 CAGGAGCAAGACAGAGAGACGGG + Intronic
929379013 2:41327041-41327063 AGGAGGCAAGAGAAAGAGCCAGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929427346 2:41856684-41856706 CAGACGCAGTAGAGAGAGGCAGG - Intergenic
929462997 2:42118307-42118329 CAGAAGCAGGAGAAAGACCTAGG - Intergenic
929885834 2:45877405-45877427 TAGAAGAAAGAGTAAGAGGATGG - Intronic
929904054 2:46030556-46030578 CAGAAGTAACAGCAAGAGGGAGG - Intronic
929965517 2:46532208-46532230 CACAAGCAAAAGAATGAGTCTGG - Intronic
930081909 2:47457472-47457494 CAGGAGCAAGAGAGAGAAGGGGG + Intronic
930189386 2:48441672-48441694 CATAAACACGAGAAAGGGGCAGG - Intronic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
930489983 2:52057514-52057536 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
930759203 2:55013838-55013860 GAGATGCAAGGGAAAGAGGGTGG + Intronic
931115168 2:59158331-59158353 AAGAAACAAAAGAAAGAGGAAGG + Intergenic
931697928 2:64885719-64885741 GAGAGGCCAGAGAAAGAGGCTGG + Intergenic
932080919 2:68714469-68714491 CAGAAGAAAGAGATAGATACAGG - Intronic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932459070 2:71870816-71870838 AAGAGACAAGAGAAAGGGGCTGG + Intergenic
932594622 2:73086385-73086407 GGGAAGCAGGAGAAAGAGGATGG + Intronic
932615907 2:73231413-73231435 CAAAAAAAAGAAAAAGAGGCCGG - Intronic
933420354 2:82037716-82037738 AAGAAACAATAGAAAGAGACAGG + Intergenic
933482128 2:82870717-82870739 CAGAACCCAGAGAGAGAGGTGGG + Intergenic
933583588 2:84155032-84155054 CAGAAGCAAGAGAGAGAGAATGG - Intergenic
933635238 2:84701641-84701663 CAGGAGCAAGAGAGAGAGGGGGG + Intronic
933674759 2:85044812-85044834 CAGAAATAAAAGCAAGAGGCTGG - Intronic
933716695 2:85366723-85366745 AATAAGGAAGAGAAAGCGGCTGG - Intronic
933914643 2:86977279-86977301 CAGAAGTAATAGAAAGAGCATGG + Intronic
934008350 2:87792620-87792642 CAGAAGTAATAGAAAGAGCATGG - Intronic
934184287 2:89657913-89657935 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
934294572 2:91732051-91732073 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
935006552 2:99084435-99084457 CAGGAGCAAGAGAAAAGGGGAGG - Intronic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935373251 2:102369391-102369413 TGGAAGCAAGAGATTGAGGCAGG + Intronic
935491366 2:103724500-103724522 CAGGAGGAAGAGAGAGAGGGGGG - Intergenic
935536427 2:104299936-104299958 CAGAAGCAAGAGAGAGTGAAGGG + Intergenic
935571428 2:104664969-104664991 CCACAGGAAGAGAAAGAGGCAGG + Intergenic
935646216 2:105337450-105337472 CAGCAGCGAGAGAAGGAGCCCGG + Exonic
935699928 2:105802568-105802590 CGGAAGCAAGAGAGAGAGGAGGG + Intronic
935771992 2:106433561-106433583 CAGAAGTAATAGAAAGAGCATGG - Intronic
935908077 2:107862384-107862406 CAGAAGTAATAGAAAGAGCATGG + Intronic
935994484 2:108754615-108754637 CAGAAGTAATAGAAAGAGCATGG + Intronic
936129867 2:109827491-109827513 CAGAAGTAATAGAAAGAGCATGG + Intronic
936214830 2:110543994-110544016 CAGAAGTAATAGAAAGAGCATGG - Intronic
936327924 2:111521768-111521790 CGGAGGCAAGAGTAAGGGGCTGG + Intergenic
936423967 2:112398557-112398579 CAGAAGTAATAGAAAGAGCATGG - Intronic
936612254 2:114012664-114012686 CAGAAGCAAGAGAACCAGTAGGG + Intergenic
936638519 2:114286552-114286574 CAGGAGCAAGAGAGAGAAGTGGG + Intergenic
936666307 2:114600126-114600148 CAGAAGGAAGACAAAGAGATTGG - Intronic
936704749 2:115058695-115058717 CAAAAATAAGACAAAGAGGCCGG - Intronic
936825236 2:116574526-116574548 GAGAAGGTAGAGAAAGAGACGGG - Intergenic
936852084 2:116912494-116912516 CAGATGGAAGAGAAAGTGGAAGG + Intergenic
936923313 2:117711223-117711245 CAGAAGAAAGAGGAAGATGAGGG + Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
936960096 2:118063998-118064020 CTCAAGTAGGAGAAAGAGGCAGG + Intergenic
937026930 2:118706552-118706574 TAGGAGCAAGAGAGAGAGGGAGG + Intergenic
937284450 2:120741411-120741433 CAGAAGAGAGAGAAAGGGGAAGG - Intronic
937344438 2:121115930-121115952 CAGGAGCAAGATAGAGAGGGAGG + Intergenic
937359879 2:121221551-121221573 CACAAGCAAAAGAATGAAGCTGG + Exonic
937447035 2:121967129-121967151 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
937463504 2:122109724-122109746 CAGAGGCAAGGGAAACAGGAAGG - Intergenic
937615959 2:123922634-123922656 AAAGAGCAAGAGAAAGAGGGAGG + Intergenic
937630882 2:124099774-124099796 CAGGACCAAGAGAACAAGGCGGG + Intronic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937975624 2:127580729-127580751 CCGAAGCTAGAGAGAGAAGCAGG - Exonic
938057407 2:128226561-128226583 CAGGAGCAAGAAAGAGAGGAGGG - Intergenic
938113539 2:128587875-128587897 AAGAAGGAAGAGAAAGAGGTGGG + Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938600046 2:132828435-132828457 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
938803713 2:134786969-134786991 CAGAAGCAGGAGAAAGTTGAAGG + Intergenic
938937735 2:136142105-136142127 CAGAAGCGAAAAAAAGTGGCTGG - Intergenic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939023637 2:136986386-136986408 CAGAAGCAAGAAAGTGAGGAGGG - Intronic
939098288 2:137862872-137862894 AAGATGCAAAAGAAAGAGGAGGG + Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
939522764 2:143252138-143252160 CAGAAGAAACTGAAAAAGGCTGG - Intronic
939739056 2:145883859-145883881 CAGGAGCAAGAGAGAGGGGGTGG - Intergenic
939779729 2:146430914-146430936 CAGGAGCAAGAGAGAGTGGGGGG - Intergenic
939847175 2:147261428-147261450 CAGGAGCAAGAGGAAGGGGAGGG - Intergenic
939978423 2:148748177-148748199 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
939987010 2:148839421-148839443 GAGAAGAAAGAGAAAGGAGCAGG - Intergenic
940026203 2:149211084-149211106 CAGGAGCAAGAAAGAGAGGGGGG + Intronic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
940202562 2:151167459-151167481 CAGGAGCAAAAGAGTGAGGCAGG + Intergenic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940461591 2:153970325-153970347 CAAAAGCAATACAAGGAGGCAGG - Intronic
940678624 2:156755721-156755743 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
940691822 2:156927878-156927900 CAGAAGCAAGAGAAAGAGTGGGG + Intergenic
940833743 2:158497332-158497354 AAGAACCAAGAGGAAAAGGCAGG - Intronic
941247367 2:163116198-163116220 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
941590892 2:167418831-167418853 GAGAAGAAAGCGGAAGAGGCTGG - Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941779466 2:169428370-169428392 GAGAAACAAAAGAAAGAGGTTGG + Intergenic
942046427 2:172101856-172101878 CACACCCAAGAGAAAGAAGCTGG + Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942261407 2:174168204-174168226 CAAAGGGAAGAGAAAGAGACAGG + Intronic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
942572635 2:177329318-177329340 CAGAAGGAAGAGAGAGAGTGGGG - Intronic
942867075 2:180689792-180689814 CAGAAGGAAGAGATAATGGCAGG - Intergenic
942953792 2:181750946-181750968 GAGTAGCAAGAGAAACAGGCTGG - Intergenic
942970205 2:181949480-181949502 CAGGAGCAAGAGAGTGAGTCGGG + Intergenic
943104622 2:183529099-183529121 CAGAAGCTGGAGCAAGAGGCAGG - Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943241604 2:185391296-185391318 GTGATGCAAGACAAAGAGGCAGG - Intergenic
943570289 2:189565603-189565625 GAGAGGCAGGTGAAAGAGGCAGG + Intronic
943677539 2:190730934-190730956 CAGGAGGAAGAGAGAGAGGGGGG - Intergenic
943707995 2:191056370-191056392 AAGAAGCAACAGGATGAGGCTGG + Intronic
944165682 2:196717593-196717615 AAGAAGCAGGATAAAGGGGCGGG + Intronic
944313184 2:198258199-198258221 GAGAATCAAGAGACAGAAGCTGG + Intronic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
944489018 2:200238323-200238345 GAGAAGGAAGAGAGAGAAGCTGG + Intergenic
944755271 2:202755045-202755067 CAGGAGCAAGAGAGAGAAGTGGG + Intronic
945009400 2:205445497-205445519 CAGGAGCAAGACAGAGAGGAGGG + Intronic
945668355 2:212770439-212770461 CAGAAGCAAGAGAGGCAGGGTGG - Intergenic
945921350 2:215757900-215757922 AAGGAGCAAGAGAAAGAGATGGG - Intergenic
946447497 2:219751898-219751920 CTGAGGCAAGAGAATCAGGCAGG + Intergenic
946476794 2:220014333-220014355 CAGAAGGAAGACAAAGAGAGAGG - Intergenic
946535175 2:220619962-220619984 GAGAAGCAAGAGAAAGAGAGAGG - Intergenic
946653514 2:221919687-221919709 CAGAAGGAAGAGAAATGGGAAGG + Intergenic
946724293 2:222647050-222647072 AAGAAGCAAGAGGAAGAGGCAGG - Intronic
946805190 2:223464320-223464342 CAGAAGGAAGAGAGAGAGGGTGG - Intergenic
946820768 2:223627126-223627148 CAGCAGCAAGAGGAAGGGGAAGG + Intergenic
947360998 2:229345335-229345357 CAGAAGCAAGATGAAGGGGTGGG - Intergenic
947525630 2:230875163-230875185 CAGACACCAGAGAAAGAGCCTGG - Intronic
947540236 2:230972296-230972318 TAGGAGCAAGAGAGAGAGGGGGG - Intergenic
947639613 2:231699637-231699659 CATAACCAGGAGAAAGATGCTGG + Intergenic
947646642 2:231746845-231746867 CAGAACCAAGAGACAGAGCCAGG + Intronic
947772523 2:232681922-232681944 CAGAGGCAGGAGACAGAGGTGGG - Exonic
947886031 2:233572484-233572506 GAGAAGCAAGAGAAAAAGAAGGG - Intergenic
947894583 2:233657444-233657466 AAGAAGCAAGAGAAAAAGGAGGG + Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
947982953 2:234425720-234425742 CAGGTGAAAGAGGAAGAGGCAGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948057488 2:235019363-235019385 CAGAAGAAAGGGAGAGATGCAGG + Intronic
948074882 2:235158289-235158311 CTGAAGCAAGAGACAGAGATGGG - Intergenic
948219058 2:236254980-236255002 CAGGAGCAGGAGAAAGAGTGGGG - Intronic
948221626 2:236274345-236274367 TAGGAGCAAGAGAGAGAGACAGG + Intergenic
948278299 2:236727081-236727103 CACATGCAGGAGAAAGAGGATGG + Intergenic
948282958 2:236762577-236762599 CAGGATCCAGAGAGAGAGGCCGG + Intergenic
948288239 2:236803852-236803874 CAGAGGTCAGAGAGAGAGGCAGG + Intergenic
948348602 2:237320061-237320083 GAGAAGCAAGACAAAGAAGTTGG - Intergenic
948361862 2:237427489-237427511 AGGAAGGAAGAGAAAGAGGGAGG + Intergenic
948363515 2:237439074-237439096 CAAAAGCAAAAAAAATAGGCCGG + Intergenic
948578644 2:238969882-238969904 CAAAGGGAAGAGAAAGAGGGAGG - Intergenic
948658728 2:239493347-239493369 CAGAAGGAAGAGAGAGAAGGAGG + Intergenic
948730832 2:239962809-239962831 CAAGAGCAAGAGCATGAGGCGGG + Intronic
948734851 2:239995521-239995543 GAGAAGGCAGAAAAAGAGGCAGG + Intronic
948784671 2:240346154-240346176 CACAAGCAAGTGACTGAGGCAGG + Intergenic
948892896 2:240915843-240915865 CAGGAGGAAGAGATAGGGGCCGG + Intergenic
1168814141 20:725179-725201 CAGACAGAAGAGAGAGAGGCTGG - Intergenic
1169396370 20:5234002-5234024 CAGAAGCTAGAGAGAGGGGAGGG + Intergenic
1169811397 20:9612509-9612531 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
1170139728 20:13113343-13113365 CATAAGCAAGAGAAAAAATCTGG - Intronic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170488408 20:16844331-16844353 CAGAAGGAAGAAAAGGAGGAGGG + Intergenic
1170532411 20:17307998-17308020 CAGGAGCAAAAGAAAGAGTGAGG + Intronic
1170532424 20:17308100-17308122 CAGGAGCAAAAGAAAGAGTGAGG + Intronic
1170532683 20:17310074-17310096 CAGGAGCAAGAGAAAGAGCAAGG + Intronic
1170560039 20:17549444-17549466 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
1170749337 20:19131302-19131324 CAGAAGAAAGCGGAAGACGCTGG - Intergenic
1170787143 20:19477363-19477385 CAAATCCAGGAGAAAGAGGCAGG + Intronic
1171157923 20:22893584-22893606 CAAAAGCAGGAGTAAGAGGGTGG - Intergenic
1171302440 20:24075500-24075522 CAAAAGCAGGAGTAAGTGGCAGG + Intergenic
1171354544 20:24534055-24534077 GGGGAGCAAGAGAAAGAGGAGGG + Intronic
1171427713 20:25058711-25058733 CAGCAGCACGCGAAAGGGGCTGG + Intronic
1171823938 20:29877986-29878008 CGGAAGGGAGAGAAAGAGGGAGG - Intergenic
1171896140 20:30812351-30812373 CGGAAGGGAGAGAAAGAGGAAGG + Intergenic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172893842 20:38285683-38285705 CAGGAGGAAGAGAAAGAGCAGGG - Intronic
1172925051 20:38526360-38526382 CGGGAGGAAGAGAAAGAGGCAGG - Intronic
1172925054 20:38526379-38526401 CAGGAGGAAGAGGACGAGGCGGG - Intronic
1172952026 20:38728479-38728501 CAGGCGCAGGTGAAAGAGGCTGG - Exonic
1173029137 20:39338531-39338553 AAGAAGAAAGACACAGAGGCTGG + Intergenic
1173048760 20:39538503-39538525 CAGGTGCAAGAGAAAGAGGAAGG - Intergenic
1173051610 20:39567736-39567758 CAGAAAAAAGAGAGAGAGGGGGG - Intergenic
1173098266 20:40059370-40059392 CAGCAGCAAGAGAGAGAGAAAGG - Intergenic
1173112278 20:40203205-40203227 CAGAAGGAAAAGCAAGAGGAGGG + Intergenic
1173221362 20:41135654-41135676 CTGATGCCAGAGAAAGAGCCAGG - Intergenic
1173357080 20:42303548-42303570 CAGAAACAAGAGAACGAGCTGGG - Intronic
1173578066 20:44126125-44126147 CAGAAGAAAAAGAGAGAGGGAGG + Intronic
1173761563 20:45565073-45565095 AGGAAGAAAGAGAAAGAGGGAGG + Intronic
1173921709 20:46751052-46751074 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
1174197842 20:48786047-48786069 CAGCAGGAAGAGAATGGGGCTGG + Intronic
1174199266 20:48795600-48795622 CAGAAGAAAAAGAAAAAGGCAGG + Intronic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1174310318 20:49648256-49648278 AAGAAAGAAGAGAAAGAGGCTGG + Intronic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1174365558 20:50054278-50054300 CAGAAGGAAGAGATCCAGGCTGG + Intergenic
1174523045 20:51147503-51147525 GAGGAGCAAGAGGAAGAGGAGGG + Intergenic
1174863490 20:54114248-54114270 GTGAAGGAAAAGAAAGAGGCTGG + Intergenic
1174951367 20:55044819-55044841 CAGGAGCAAGAGAGCGAGGTGGG - Intergenic
1175036708 20:56006262-56006284 CTGAAGGAAGGGAAAAAGGCTGG - Intergenic
1175050402 20:56150397-56150419 AAGAAGGGAAAGAAAGAGGCAGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175134516 20:56812959-56812981 CAGGAGCAAGAGAGAGAGAGTGG + Intergenic
1175270540 20:57730855-57730877 CTGAAGGGTGAGAAAGAGGCAGG - Intergenic
1175292291 20:57884011-57884033 CAGAAGCAAGAGACAGAGCAAGG - Intergenic
1175474917 20:59265384-59265406 AAGAAGCAAGGAAAAGAGGGAGG - Intergenic
1175707613 20:61192693-61192715 CAGCAGAGAGAGAAAGAGACAGG - Intergenic
1175852698 20:62102316-62102338 CACAAGCAGGAGCCAGAGGCTGG + Intergenic
1176647763 21:9366576-9366598 CAGAAGGAAGAGAAAAGAGCAGG + Intergenic
1176937991 21:14888890-14888912 CAGAAGCAAGGTAAGGAAGCGGG - Intergenic
1177021127 21:15859489-15859511 GAAAAACAAGAGAAAGCGGCCGG - Intronic
1177298670 21:19211303-19211325 CAGGAGCAAGAGAAAGATAGGGG - Intergenic
1177420848 21:20854560-20854582 AATAAGCAAGAGATTGAGGCTGG + Intergenic
1177480282 21:21677440-21677462 CAGAACCAGAAGAAAGAGACAGG + Intergenic
1177517796 21:22177408-22177430 CGGGAGGAAGAGAAAGGGGCAGG - Intergenic
1177542689 21:22516270-22516292 CAGAGGAAAGAGTTAGAGGCTGG + Intergenic
1177553923 21:22664983-22665005 CAGAGGCAAGAGTAATGGGCTGG + Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177767611 21:25476056-25476078 TAGAAGGAAGAGAGAGAGGTGGG - Intergenic
1177774396 21:25551747-25551769 CAGAAGCAAGAGAGTGAGGTGGG + Intergenic
1177836388 21:26190128-26190150 GAGTAGGAAGAGAAAGAGGGTGG + Intergenic
1178289023 21:31350608-31350630 CAGGAGCAAAAGAGAGATGCGGG - Intronic
1178326287 21:31647836-31647858 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1178392255 21:32208412-32208434 CAGAAGCAAGGGCAAGAGAGGGG - Intergenic
1178603484 21:34015156-34015178 CAGGAGCAAGAGAGAGAGAAGGG + Intergenic
1178730230 21:35095231-35095253 CAGGAGCAAAAGAGAGAGGAGGG + Intronic
1178740548 21:35196190-35196212 AAGAAGCAAGAGAGAGGGGAGGG - Intronic
1178839237 21:36125514-36125536 CACCAGCAAGTGGAAGAGGCAGG + Intergenic
1179122957 21:38565723-38565745 GAGAAGCAAGAGACTGAGGAAGG - Intronic
1179380683 21:40896347-40896369 CAAGAGCAAGAGAGAGAGGGAGG - Intergenic
1179432496 21:41333457-41333479 CAGAAACAAGAGAGAGAAGAGGG - Intronic
1179500027 21:41802821-41802843 CAGAAGCCAGAAGAGGAGGCGGG - Exonic
1179521215 21:41946474-41946496 CAGGAGGGGGAGAAAGAGGCGGG - Intronic
1179627606 21:42657531-42657553 CATAGGCAAGAGAAAGGAGCAGG - Intronic
1179893076 21:44347101-44347123 CAGGAGTAAGAGAGAGAGACAGG + Intergenic
1179938637 21:44622972-44622994 GAGTAGCAAGAGAAAGAGAGTGG - Intronic
1180097841 21:45568211-45568233 CAGAAGCAAGAGGAGGCAGCTGG + Intergenic
1180817370 22:18799495-18799517 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1181203560 22:21233816-21233838 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1181265473 22:21628587-21628609 CAAGAGCAAGAGAAAGCGTCGGG + Exonic
1181296830 22:21847096-21847118 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1181332065 22:22100494-22100516 CAGAAGAAAGAGTCAGAGGAAGG - Intergenic
1181506619 22:23362736-23362758 CAGGAGGAAGAGAGAGAGGGAGG - Intergenic
1181890482 22:26058700-26058722 AGGAAGAAAGAGAGAGAGGCAGG - Intergenic
1181914844 22:26271628-26271650 CAGAAACAAGAGAGAGAAGGGGG - Intronic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182354280 22:29715374-29715396 CAGAGGCAACAGACTGAGGCAGG + Intergenic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182541276 22:31043909-31043931 CCGAAAAAAGAAAAAGAGGCTGG + Intergenic
1182765998 22:32759126-32759148 CAGAAGCAAGAGGAGGTGGAAGG + Intronic
1182838039 22:33360491-33360513 GAGCAGCAAGAGAAAGAGGGAGG + Intronic
1182911379 22:33987403-33987425 GGGATGCAAGAGAAAGTGGCTGG + Intergenic
1182962169 22:34485487-34485509 CAGAAGGAAGAGAGAGAAGCGGG + Intergenic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183093357 22:35538587-35538609 CAGGAGCAGAAGACAGAGGCTGG + Intergenic
1183309395 22:37101282-37101304 CTGAAGCAGGAGACAGGGGCAGG + Intronic
1183659704 22:39211990-39212012 CAGAAGCACGAGAGAGTGGGGGG - Intergenic
1183728264 22:39601532-39601554 CAGAGGAGAGAGAAAAAGGCTGG + Intronic
1183778462 22:39983428-39983450 CAGAAGCAAGGGAAGAAGGTGGG - Intergenic
1183785984 22:40029490-40029512 CAGAGGCAAGGGACAGAGGCGGG - Intronic
1183847660 22:40555436-40555458 CAGGAGCAAGAGAAAGAAGGGGG - Intronic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184019139 22:41808913-41808935 CAAAAGCAGGACAAAGAGGAAGG - Exonic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1185037056 22:48484875-48484897 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1203223361 22_KI270731v1_random:61598-61620 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
1203267468 22_KI270734v1_random:25222-25244 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
949310444 3:2691390-2691412 AAGAAGAAAGAGGAAGAGGAGGG + Intronic
949456198 3:4241760-4241782 AATAGGCAAAAGAAAGAGGCAGG + Intronic
949853180 3:8439148-8439170 CTGAGGCAAGAGAATCAGGCAGG - Intergenic
949890720 3:8731993-8732015 AAGAAGAAAGAGGAAGGGGCAGG - Intronic
949962076 3:9320486-9320508 CAGGAGCAAGAGAGAGAGGTGGG - Intronic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950523789 3:13511668-13511690 CAGGAGCAAGGGACAGAGGAGGG - Intergenic
950650460 3:14403711-14403733 CAGAAGGAAGAGAAATAGTCTGG - Intronic
950705987 3:14782118-14782140 CAGGAGCAAGAGAGAGTGGGTGG - Intergenic
950721848 3:14888790-14888812 CAGAACAAAGACACAGAGGCTGG + Intronic
950790256 3:15465900-15465922 CAATAGCTAGAGAAAGAGGCTGG - Intronic
950845546 3:16012086-16012108 AAGAAGGAAAAGAAAGAGGGAGG + Intergenic
950861647 3:16152669-16152691 CATAAGCAAGAGAAGCAGGTTGG - Intergenic
950870586 3:16225128-16225150 CAGGAACAAGAGAAAGAGAGTGG + Intronic
950949314 3:16981035-16981057 CTGAGGCAAGAGAATCAGGCAGG + Intronic
951392284 3:22121175-22121197 TAGAAGTAAGTGAAAGAGGAAGG - Intronic
952602322 3:35100379-35100401 AAGCAATAAGAGAAAGAGGCTGG + Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952871165 3:37902601-37902623 GAGAAACAAGAGGAAGAAGCGGG - Intronic
953091153 3:39727184-39727206 CAGTAGCAAGAGAGTGAGGATGG + Intergenic
953175416 3:40547241-40547263 AAGAAGAAAGAGAGAGAGGGAGG - Intronic
953626956 3:44579476-44579498 GAGAAGCAAGAGGCAGAGCCGGG - Intronic
953875157 3:46662453-46662475 GTGAGTCAAGAGAAAGAGGCTGG + Intergenic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
954536351 3:51362088-51362110 CAGGAGCTAGAGAATTAGGCAGG - Intronic
954631210 3:52048524-52048546 CGGCAGCAAGAGAAAGAGTTAGG + Intergenic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
954933099 3:54301300-54301322 CAGAAAAAAAAAAAAGAGGCCGG + Intronic
954984547 3:54778137-54778159 CAGAAGGAAGAGAGAGAGTGGGG + Intronic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
955034727 3:55256224-55256246 CCGAAGGATGAGAAAGAGCCAGG + Intergenic
955150209 3:56359793-56359815 AGGAAGCAAGAGAGAGAGGATGG + Intronic
955569370 3:60287833-60287855 CAGTAGTAAATGAAAGAGGCTGG - Intronic
955703119 3:61701900-61701922 GAGAGGGAAGAGAAAGAGGAAGG + Intronic
955840821 3:63110880-63110902 AATAAGCAAGACAAAAAGGCAGG + Intergenic
955996332 3:64684537-64684559 CAGAAGGAAGACAAAGGGGCAGG + Intronic
956107539 3:65836522-65836544 CTAAAGAAAGGGAAAGAGGCCGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956261689 3:67350196-67350218 CAGAAGCAAGAGAAAGATGGGGG - Intergenic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956489378 3:69754462-69754484 CAGGAGCAAGAGAGAGTGACAGG - Intronic
956529323 3:70200359-70200381 CAGAAGTCAGAGAAATAGGCAGG - Intergenic
956540008 3:70326159-70326181 CAGAAGGAAGGGAAAGAGGAAGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956724895 3:72148861-72148883 CAGAAGCAAGAGAAAGGGAGCGG + Intergenic
956765346 3:72480122-72480144 CAGGAGAAAGAGAGAGAGGGGGG - Intergenic
956775098 3:72558446-72558468 CAGGAGCAAGAGAGAGAGGCAGG - Intergenic
956887006 3:73570369-73570391 CAAAAGCAAGTGAAATATGCCGG - Intronic
956901830 3:73724761-73724783 CAGGAGCAAGAGAGAGAAGTGGG + Intergenic
956922456 3:73944339-73944361 CAAAAGTAAAGGAAAGAGGCAGG + Intergenic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
957356002 3:79087494-79087516 AGGAAGGAAGAGAAAGAAGCTGG - Intronic
957561015 3:81820826-81820848 ATGAAGCAAGAGAGAGAGGGAGG + Intergenic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957720793 3:83995718-83995740 CAGTAGCAGGAGGAAGGGGCAGG + Intergenic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
958175613 3:89992052-89992074 CAGAAGGAAGAGAGAGAGAAAGG - Intergenic
958444200 3:94194835-94194857 CAGAAGCAAGAGAGAGAGTGGGG - Intergenic
958997967 3:100927619-100927641 TAGGAGGAAGAGAAAGAGGAAGG + Intronic
959021760 3:101195231-101195253 CAGAAGAAAGAGAGTGAAGCGGG + Intergenic
959037318 3:101383225-101383247 CAGGAGCAAGAGAAAGAGTGGGG - Intronic
959124899 3:102279001-102279023 CAGGAGCAAGAGGAAGAAGTGGG + Intronic
959202056 3:103259689-103259711 CAGAAGCAAGAGAGAGAGTGAGG + Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960214265 3:115011200-115011222 GAGGAGGAAGAGAAAGAGACAGG + Intronic
960351790 3:116602800-116602822 CAGCAGGAAGAGAAAGTGGTAGG - Intronic
960372224 3:116854452-116854474 AAGGAGCAAGAGAGAGAGGGAGG - Intronic
960724865 3:120659927-120659949 CAGGAGCAAGAGAGAGTGGGGGG + Intronic
960724878 3:120660063-120660085 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
960763474 3:121098345-121098367 AGGGAGCAAGAGAGAGAGGCAGG + Intronic
960787069 3:121385328-121385350 GAAAAGCAAGAGAGAGAGGAGGG + Intronic
960959734 3:123061819-123061841 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
961138147 3:124531622-124531644 CAGGAGCAAGAGAGAGAGTGAGG + Intronic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
961194063 3:124986499-124986521 CAGACCTCAGAGAAAGAGGCAGG + Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
962005454 3:131344756-131344778 CAAAAGCAAGAGAGAGAGTGGGG + Intronic
962136308 3:132737932-132737954 CAGAAGGAAGAGAGAGAGCGGGG + Intergenic
962211126 3:133478896-133478918 AAGAAGCAAGAGAAACACGTAGG + Intergenic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962360715 3:134740591-134740613 AGGAAAGAAGAGAAAGAGGCGGG - Intronic
962612332 3:137089435-137089457 CAGAAACAAGAGACAGAGAGGGG + Intergenic
962716218 3:138128451-138128473 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
962834221 3:139172601-139172623 CAAAAAAAAAAGAAAGAGGCCGG - Intronic
962932862 3:140053655-140053677 CAGAAATAAGAGAGAGAGGAGGG - Intronic
963274669 3:143318021-143318043 GAGAAGGAAGAAAATGAGGCCGG - Intronic
963343040 3:144060648-144060670 CAGAAACAATGGAGAGAGGCAGG + Intergenic
963538488 3:146557909-146557931 AAGAAGCAAGAGAGAGAGGAGGG - Intergenic
963562356 3:146881839-146881861 CAGAAACAGTTGAAAGAGGCTGG + Intergenic
963592834 3:147285427-147285449 GAGAAGAAAGAGGAAGAGGAGGG - Intergenic
963707870 3:148710897-148710919 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
963745367 3:149119524-149119546 CAGGAGCAAGAGAAAAGGGAAGG - Intergenic
963796360 3:149634649-149634671 AAGAAGCAAGTGAAAGACCCTGG + Intronic
963963059 3:151331931-151331953 CGGAGGCAAGAGAGTGAGGCAGG - Intronic
964092253 3:152891542-152891564 CAGGAGCAAGAGAAAAGGGAGGG + Intergenic
964276100 3:155010576-155010598 CAGAAGGAAGAAGGAGAGGCTGG - Intergenic
964298708 3:155263043-155263065 CAGGAGGAAGAGAGAGAGACAGG - Intergenic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
964578480 3:158202399-158202421 CAGAAGGAAGAGGCAGAGGTGGG + Intronic
964727591 3:159830841-159830863 AAGAAGCAAGGGAAAGAGATGGG + Intronic
965619195 3:170625543-170625565 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
965807126 3:172553183-172553205 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
965993965 3:174856010-174856032 GAGAAGTAAGAGAGAGAGACAGG + Intronic
965997288 3:174899506-174899528 CAGAAGCAAGAGAGAGACTGTGG - Intronic
966055782 3:175687828-175687850 CAGAAACAAGAGAAAGGTGGGGG - Intronic
966205125 3:177398319-177398341 CAGAAGCAGGAGAGAGGGGAGGG + Intergenic
966260693 3:177975094-177975116 CAGATGCAACAGGAAAAGGCTGG - Intergenic
966319894 3:178690532-178690554 AAGAAGGAAGAGAAAGAGGGAGG + Intronic
966650172 3:182291798-182291820 CAGTGGGAAGAGAAAGTGGCAGG - Intergenic
966668367 3:182498427-182498449 TAGAAAGAAGAGAAAGAAGCAGG + Intergenic
966759766 3:183407547-183407569 AAGAAGCAGAAGAAAGAGGGAGG - Intronic
966929528 3:184666862-184666884 CGGAAACCAGAGAAGGAGGCTGG + Intronic
967150338 3:186642946-186642968 CACAAGCAAGACACAGAGACTGG - Intronic
967446064 3:189568046-189568068 CAAAAGCAAGAAAAAGACACAGG - Intergenic
967550739 3:190792386-190792408 GAGAAGCAGGAGAGAGAGGAAGG + Intergenic
967613440 3:191536246-191536268 CAGGAGCAAGAGAGAGAGAGGGG + Intergenic
967874751 3:194260202-194260224 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
967959665 3:194910385-194910407 CCGGAGCAAGAGAGAGAGGCTGG + Intergenic
968124493 3:196148495-196148517 CAGAAGCAAGAGAGAGAGCGAGG - Intergenic
1202739120 3_GL000221v1_random:38411-38433 CAGAAGGAAGAGAAAAGAGCAGG - Intergenic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
968583935 4:1407228-1407250 CGGGAGCAAGTGAGAGAGGCGGG - Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969340728 4:6539279-6539301 CAGAAGCCAGGAGAAGAGGCTGG + Intronic
969908394 4:10419548-10419570 CAGAAGGAAGAGAGTGAGGGGGG - Intergenic
970044480 4:11835484-11835506 CTGAAGCAAGAGAAAGCGTTGGG + Intergenic
970122166 4:12768194-12768216 AAGAAGGAAGGGAAAGAGGGAGG + Intergenic
970235534 4:13954771-13954793 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
970281084 4:14456431-14456453 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
970474500 4:16408630-16408652 CAATGGCAAGAGAAAGTGGCAGG + Intergenic
970701955 4:18752045-18752067 GAGAGGCCAAAGAAAGAGGCTGG + Intergenic
970749641 4:19342200-19342222 CAGAAGCAAGAGAGCGAGGGAGG - Intergenic
970792616 4:19876535-19876557 CAGAAGCAAGACAGAGAAGCAGG + Intergenic
970801711 4:19979706-19979728 CAGGAGCAAGAGAGAGATGGGGG - Intergenic
970971914 4:21994733-21994755 GAGAAACAAGAGAGAGTGGCAGG + Intergenic
971408597 4:26346209-26346231 CAAAAGAAAGAGAAAGAGAAAGG + Intronic
971410813 4:26369866-26369888 GAGAAGAGAGAGAAAGGGGCTGG - Intronic
971448500 4:26778117-26778139 GAGAAGGAAAGGAAAGAGGCCGG + Intergenic
971550739 4:27952942-27952964 CAGGAGCAAGAGAGAGATGGAGG + Intergenic
971861166 4:32108072-32108094 CAAAAGAAAGAGAGAGAGGGAGG + Intergenic
972123807 4:35739530-35739552 CAGAAGCAAGAGCAAGACGGAGG + Intergenic
972133826 4:35866301-35866323 AGGAAGCAAGAGGAAGAGGAAGG - Intergenic
972149390 4:36069933-36069955 CAGAAGCAAGAGAGAGAGGGGGG - Intronic
972385474 4:38561577-38561599 CAGGAGCAAGAGAGAGAGTGTGG - Intergenic
972413547 4:38816523-38816545 CAGAAGCAAGAGAGAGTGTGGGG + Intronic
972568178 4:40287364-40287386 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
972603883 4:40596308-40596330 CTGAGGCAAGAGAAAAAGACAGG + Intronic
972683897 4:41333085-41333107 CAGAAGGAAGAGAGAGAAGGGGG + Intergenic
972754532 4:42032069-42032091 CAGGAGCAAGAGAGAGATGGGGG + Intronic
972828086 4:42784954-42784976 CAGGAACAAGAGAAAGAGTGGGG - Intergenic
973731931 4:53831282-53831304 GAGAAGGAAGAGATAAAGGCAGG + Intronic
973976479 4:56267968-56267990 CACAAGGATGAGAAAAAGGCTGG - Intronic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974441615 4:61925625-61925647 CAGGAGCAAGAGAGAGAGAGTGG + Intronic
974457278 4:62144612-62144634 CAGGAGCAAGAGAGAGAGTTGGG - Intergenic
974457526 4:62146650-62146672 TAGGAGCAAGAGAAAGAGTTGGG - Intergenic
974516039 4:62912355-62912377 CAGAAGCAAGGGAAAGGTGATGG - Intergenic
974585721 4:63874365-63874387 TAGAAGCCAGAGAGAGAAGCTGG - Intergenic
974670284 4:65021574-65021596 CAAAAGGAAGAGAGAGAGACGGG + Intergenic
974849930 4:67392024-67392046 ATCAATCAAGAGAAAGAGGCAGG + Intergenic
975025761 4:69546590-69546612 CAGAGACAAAAAAAAGAGGCTGG - Intergenic
975029778 4:69600768-69600790 CAGGAGCAAGAGAGAGAGTGAGG + Intronic
975029850 4:69601301-69601323 CAGGAGCAAGAACACGAGGCTGG - Intronic
975111021 4:70626604-70626626 TAGATGTAAGGGAAAGAGGCTGG - Intergenic
975244191 4:72099565-72099587 CAGGAGCAAGAGAGAGGGGGAGG + Intronic
975281691 4:72569204-72569226 CGGGAGCGGGAGAAAGAGGCAGG + Intergenic
975607212 4:76167461-76167483 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
975615482 4:76242321-76242343 TGGGAGCAAGAGAAAGAGGGAGG - Intronic
976081419 4:81359288-81359310 CAGAAGCAAGAGGACCATGCAGG + Intergenic
976133589 4:81911115-81911137 CAGCAGCAAGAGAGAGAGCAAGG - Intronic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
976647817 4:87403412-87403434 CAGAAGGAAAATAAAAAGGCTGG - Intergenic
976706316 4:88023283-88023305 CAGGAGCAAGAGAGAGAGAATGG + Intronic
976741131 4:88358608-88358630 CAGGAGCAAGAGAGAGAGAGAGG - Intergenic
976948597 4:90800018-90800040 CAGAAGGAAGACACAGAAGCTGG - Intronic
976960635 4:90967500-90967522 CACAAGCAAAAGAAAGAAGTTGG + Intronic
977001553 4:91511025-91511047 CATATGCAGAAGAAAGAGGCTGG - Intronic
977118727 4:93069001-93069023 CAGAAACAAGAGAGAGAGGAGGG + Intronic
977415484 4:96727548-96727570 AAGAAGGAAGAGTAAGAGGAGGG + Intergenic
977569186 4:98612189-98612211 GAGAAGCAGGAGGAAGAGGAGGG + Intronic
978165826 4:105605352-105605374 TCAAAGCCAGAGAAAGAGGCTGG - Intronic
978234069 4:106436675-106436697 CACATGCAAAAGAATGAGGCTGG - Intergenic
978690568 4:111504539-111504561 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
979140800 4:117171600-117171622 CAGGAGCAAGAGAAAGAGTGAGG - Intergenic
979301622 4:119093548-119093570 TAGAAGCAAGAGAAAAAGGGAGG + Intergenic
979555922 4:122047505-122047527 AAGGAGCAAGAGAATGAGACAGG + Intergenic
979881246 4:125962740-125962762 CAGGTGCAAGAGAGAGAGGAGGG - Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
980211497 4:129794185-129794207 GAGAAGGACGAGAAAGAGGAGGG - Intergenic
980380157 4:132003364-132003386 CACAAGAAAGAGAAAGAGAGAGG + Intergenic
981117104 4:141004439-141004461 CAGAAGAAAAATGAAGAGGCAGG + Intronic
981190947 4:141862004-141862026 GAGAGGCCAAAGAAAGAGGCTGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981364227 4:143883214-143883236 CAAGAGCAAGAGAGAGAGTCGGG - Intronic
981409911 4:144417700-144417722 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
981572873 4:146172055-146172077 AAGAAGGAAAAGAAAGAGGGAGG - Intergenic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
981952187 4:150422894-150422916 CTGAACCAAGAGAAAGGGGATGG + Intronic
981956260 4:150477766-150477788 CAGGAGCATGAGGAAGAAGCGGG - Intronic
982103104 4:151987992-151988014 CAGAAGGAAAAGAAAGAACCTGG - Intergenic
982256842 4:153459172-153459194 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
982305188 4:153923268-153923290 CGGGTGCAAGAGAAAGAAGCAGG - Intergenic
982400868 4:154966425-154966447 CAGGAGCAAGAGAAAGAAGAAGG - Intergenic
982464265 4:155710695-155710717 AAGAAGCAGGAAAAAGGGGCAGG + Exonic
982567001 4:156998038-156998060 CAGGAGCACGAGAAAGAGTGAGG + Intergenic
982666521 4:158271040-158271062 CAGGAGCAAGAGAGAGAAGTGGG - Intergenic
982834569 4:160108423-160108445 CAGAAGCAAGAGAGAGAATGGGG + Intergenic
982909487 4:161121136-161121158 CTGAAGCAGGGAAAAGAGGCTGG + Intergenic
983057806 4:163119381-163119403 CTGAAGACAGAAAAAGAGGCTGG - Intronic
983102189 4:163638414-163638436 CTGGAGCAAGAGAGAGAGGGAGG - Intronic
983161166 4:164416742-164416764 CAGGAGCTAGAGAGAGAGACTGG + Intergenic
983170104 4:164525971-164525993 GAGAGGCCAAAGAAAGAGGCAGG - Intergenic
983203160 4:164884205-164884227 AAGAAGAAAGAAAAAGAGGAAGG + Intronic
983209974 4:164948322-164948344 GAGAAGCAAGAGGAAATGGCAGG + Intergenic
983516886 4:168666844-168666866 CAGAAAAAAAAGAAAGAGACTGG + Intronic
983524706 4:168749141-168749163 CAGGAGCAAGAGAGAGAGAGTGG - Intronic
983571580 4:169214231-169214253 CAGAAGCAAGAGAGTGAGGGAGG - Intronic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
983698255 4:170559466-170559488 CAGGAGCAAGAGAGAGAAGTGGG - Intergenic
983728040 4:170954431-170954453 GATAAGCAAGAGGAGGAGGCTGG - Intergenic
983826912 4:172273905-172273927 CAGAAGCAAGAGAAGCAGTCAGG + Intronic
983917834 4:173311551-173311573 CAGGAGCAAGAGAGAGAAGCAGG + Intronic
984144588 4:176044937-176044959 CAGAAGGAAGATACAGAAGCTGG - Intergenic
984189012 4:176582392-176582414 CAGGAGGAAGAGAGAGAGGTGGG - Intergenic
984256927 4:177400569-177400591 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
984355763 4:178655203-178655225 CAGGAGGAAGAGGGAGAGGCGGG - Intergenic
984522556 4:180818858-180818880 CAGAAGGAAGAGAAAGGGAGCGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984660842 4:182373502-182373524 CAGGAGCAAGAGAAAGGAGGAGG + Intronic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
984984712 4:185316751-185316773 CAGTATCAACAGAAAGAGCCAGG - Intronic
985010065 4:185573284-185573306 TAAAAGCAAAATAAAGAGGCGGG - Intergenic
985056070 4:186036575-186036597 CAGGAGCAAGAGAGAGAGTAGGG - Intergenic
985137922 4:186807246-186807268 CACAAGCAAGAGAAAGTGCTGGG - Intergenic
985572720 5:658343-658365 CAGCAGCAAGGGGAGGAGGCCGG - Intronic
985583066 5:710134-710156 CAGGAGCAAGAGAGAGTGGTGGG - Intergenic
985596745 5:795386-795408 CAGGAGCAAGAGAGAGTGGTGGG - Intergenic
985624959 5:980541-980563 CTGTGGCCAGAGAAAGAGGCTGG + Intronic
985851629 5:2392633-2392655 AGGAAGGAAGAGAAAGAGGAAGG - Intergenic
985937209 5:3106463-3106485 GAGAAGCAAGAGAAAGCAGAGGG - Intergenic
985953775 5:3244595-3244617 CAGAAGCAAGAGAGAGGAGTAGG + Intergenic
986024038 5:3833291-3833313 CAGAAGCAAGAGAGAGCGGGTGG - Intergenic
986027005 5:3860075-3860097 CAGAAGCCAGAGAGAGAGACAGG - Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
986095117 5:4547102-4547124 GAAAAGAAAGAGAAAGAGGCTGG + Intergenic
986099492 5:4594190-4594212 CAGGAGGAAGAGAATGAAGCAGG + Intergenic
986150799 5:5128999-5129021 CAGAAGAAAGAGAGAGAGAGGGG - Intergenic
986310022 5:6544759-6544781 CAGAAGCCAGAGGAAGAGGAAGG + Intergenic
986410351 5:7473355-7473377 GAGAAGCAAGAGAGAGTGGGGGG + Intronic
986538653 5:8819579-8819601 CAGGAGGAAGAGATAGAAGCAGG - Intergenic
986538893 5:8822625-8822647 CAGGAGCAAGAGAAAGAAATAGG - Intergenic
986585179 5:9309052-9309074 CAGAAGAAAGAGTAAGTGGAAGG + Intronic
986628755 5:9748605-9748627 AGTAAGCAAGAGAAAGAGGGAGG + Intergenic
986924722 5:12732586-12732608 CAGAAGCAAGAGAAAAAAGGAGG + Intergenic
986999245 5:13642473-13642495 GAGAAGCAAAACAAAGAGGTTGG - Intergenic
987033208 5:13994736-13994758 CAGAGCCAAGGGGAAGAGGCGGG - Intergenic
987069784 5:14325439-14325461 GAGAAGCAAGAGAAAAAGGAGGG + Intronic
987182643 5:15384421-15384443 CAGGGGCCAGAGACAGAGGCTGG - Intergenic
987187986 5:15444665-15444687 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
987306771 5:16644700-16644722 CAGAAGCAAGAGTAAGAGTGAGG - Intergenic
987387560 5:17344522-17344544 CAGGAGGAAGAGATAGAGGGGGG - Intergenic
987862480 5:23506092-23506114 CAGGAGGAAGAGAGAAAGGCGGG - Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988095042 5:26596038-26596060 AAGAAGCAAGAGGAAGGGGAAGG - Intergenic
988164738 5:27572067-27572089 GAGAAGAAAGATAAAGAGGAGGG + Intergenic
988390087 5:30616480-30616502 CAGAAGGAAGAGAGAGAGTGGGG + Intergenic
988634129 5:32963315-32963337 TAGGAGCAAGAGAAAGAGGGAGG + Intergenic
988877127 5:35458657-35458679 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
988928375 5:36012037-36012059 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
989161740 5:38397849-38397871 CAGAAGCAGGTGAGAGAGGAGGG + Intronic
989296471 5:39833127-39833149 TAGGAGCAAGAGAAAGAGTGAGG + Intergenic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989663612 5:43825263-43825285 CTGAGGCAAGAGAATCAGGCAGG + Intergenic
990168519 5:53020988-53021010 AAGAATCAAGATAAAAAGGCCGG - Intronic
990286653 5:54307026-54307048 GAGAAGAAAGAGTAAGATGCTGG + Intronic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990489302 5:56288372-56288394 CAGAGGCAAGAGAAAGGTGTGGG + Intergenic
990619066 5:57540379-57540401 GAGAAGTGAGAGAAAGAGGGAGG - Intergenic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
991018920 5:61959798-61959820 CTGAAGTAAGAGTAGGAGGCAGG - Intergenic
991042939 5:62194226-62194248 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
991245261 5:64503592-64503614 GAGAAGGAAGAGAGAGAGGAAGG + Intergenic
991316277 5:65310111-65310133 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
991405753 5:66299878-66299900 CAGTAGTAAGTGAAAGAGCCAGG + Intergenic
991561208 5:67955600-67955622 CACAAACAAGAGAACAAGGCAGG - Intergenic
991605952 5:68401391-68401413 CAGGAGCAAGAGAGAGAGAGGGG + Intergenic
991643654 5:68779066-68779088 CAGGAGCAAGAGAGAGAGAAGGG + Intergenic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
991965433 5:72086019-72086041 CACTAGAAAGAGAAAGAGCCTGG + Intergenic
992002647 5:72450868-72450890 GAGAGGCCAGAGAAAGAGGATGG + Intronic
992066293 5:73113206-73113228 CAGAAGCCAGAGGCAGATGCTGG - Intergenic
992313595 5:75529255-75529277 CAGGAGCAAAAGAGAGAGGGGGG + Intronic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
992432346 5:76721298-76721320 CACAAGCAAGAGAAAGAAAAAGG - Intronic
992532725 5:77667783-77667805 CCAAATCAAGAGAATGAGGCAGG + Intergenic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
992666415 5:79013767-79013789 CAGGAGCAGGAGCAAGAGACAGG + Intronic
992677183 5:79116916-79116938 CTTTAGCAAGAGAATGAGGCTGG - Intronic
993555217 5:89328628-89328650 CAGGAGGAAGAGAGAGAGCCGGG + Intergenic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
993701367 5:91122941-91122963 CAGGAGTAGGAGAAACAGGCAGG - Intronic
993754723 5:91714327-91714349 TAGAAGCAAGAGAAAGGTGGAGG + Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
994050726 5:95359431-95359453 CAGAAGGAAGAGAGAAAGGGAGG + Intergenic
994060884 5:95475427-95475449 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
994077321 5:95667927-95667949 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
994314207 5:98313363-98313385 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
994513740 5:100742866-100742888 TGGGAGCAAGAGAAAGAGGGAGG + Intergenic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
994613839 5:102078581-102078603 CAGAGGCAAGAGAAAAAAGTTGG + Intergenic
994641835 5:102420565-102420587 CAAAAGAAAGAGAAAAAGGAGGG + Intronic
994661331 5:102657948-102657970 CTAAAGCATGAGAAATAGGCAGG + Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
995060208 5:107805367-107805389 CGGGAGCAAGAGAAAGGGGGAGG + Intergenic
995250309 5:109985525-109985547 CAGGAGCAAGAGAGAGAGAAGGG + Intergenic
995559579 5:113365817-113365839 CAGAAGGAAGAGAGAGAGCAGGG + Intronic
995810167 5:116097799-116097821 CAGGAACAAGAGAGAGAGGGAGG + Intronic
995860730 5:116637616-116637638 CAGCAGCAAGGCAAAGTGGCTGG + Intergenic
996013248 5:118503940-118503962 CAAGAGCAAGAGAGAGAGGGGGG - Intergenic
996184925 5:120464047-120464069 CAGAACCAAGAGGAGGGGGCGGG + Intergenic
996380976 5:122862317-122862339 AAGAAAAAAAAGAAAGAGGCTGG + Intronic
996441719 5:123498838-123498860 CAGGAGCAAGAGAGAGAGAGAGG - Intergenic
996509067 5:124298795-124298817 CAGGAGCAAGAGAGAGAGAAGGG + Intergenic
996737029 5:126767513-126767535 GAGAAGAGAGAGAAAGAGGGAGG - Intergenic
996793830 5:127322330-127322352 CAGAGGAAAGGCAAAGAGGCAGG - Intronic
996809172 5:127494983-127495005 AAGAAAGAAGAGAAAGAGGAAGG + Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
997068852 5:130594912-130594934 CAGGAGCAAGAGAGAGAAGGTGG - Intergenic
997110111 5:131065589-131065611 AAGAAGGAAGAGAGAGAAGCAGG - Intergenic
997297742 5:132778166-132778188 CAGAGGGAAGAGAAAGAAACGGG - Intronic
997443344 5:133924390-133924412 CAGATGCAAGACACAGAGGGAGG - Intergenic
997451076 5:133983871-133983893 CAGGAGCAAGAGAGAGAGAGTGG - Intronic
997529816 5:134575073-134575095 CAGAAGCATGGGCAAGAGCCTGG + Intronic
997755571 5:136395741-136395763 GAGAGGTAAGAGAAAGATGCAGG + Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
997982880 5:138480589-138480611 AAGAAAGAAAAGAAAGAGGCCGG - Intergenic
998294379 5:140952929-140952951 CAGGAGCAAGAGAGAGAGAAGGG + Intronic
998555292 5:143117297-143117319 CAGATGCATGGGAAACAGGCTGG - Intronic
998609286 5:143670600-143670622 CAGGAGGAAGAGAGAGAGGGTGG + Intergenic
998618943 5:143773195-143773217 GAGGAGCAAGAGAGAAAGGCAGG + Intergenic
999199101 5:149803584-149803606 CAGGACTAAGAGAAACAGGCAGG - Intronic
999248664 5:150168463-150168485 CAGAAGCAAGTGGCAGAGTCTGG - Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999692676 5:154162327-154162349 AAGAAGGAAGAGAGAGAGGAGGG + Intronic
999971576 5:156869093-156869115 CAGAAGCAAGAGAGTGAAGGAGG - Intergenic
1000222609 5:159228262-159228284 CAAAAGAAAGAAAGAGAGGCTGG - Intergenic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001174235 5:169450515-169450537 CAGAAGAAAGAGAAAATGCCAGG + Intergenic
1001306581 5:170578896-170578918 CAGAAGGAATAGCAAGAGGGAGG + Intronic
1001575193 5:172758639-172758661 CATGAGGAAGGGAAAGAGGCTGG + Intergenic
1001885075 5:175282517-175282539 CACAAGCCATAGAAAGAGGCTGG - Intergenic
1002030272 5:176423463-176423485 CAGAGGCAAGAGACAGAGATAGG - Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002392655 5:178927992-178928014 CAGGAGCAAGAGAGAGTGGCAGG + Intronic
1002507351 5:179688950-179688972 AAAAAACAACAGAAAGAGGCCGG + Intronic
1002529531 5:179835585-179835607 CTGAGGCAAGAGAATCAGGCAGG + Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003652985 6:7978357-7978379 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1003922006 6:10841205-10841227 CAAAAGAAAGAGAAAGAGAAAGG + Intronic
1004135605 6:12963105-12963127 CAGAATTCAGAGAAAGAGACAGG + Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004284484 6:14308067-14308089 CAGGAGCCAGAGAAAGAGGGTGG - Intergenic
1004330309 6:14715037-14715059 CACAGGGAAGGGAAAGAGGCTGG - Intergenic
1004333552 6:14743260-14743282 GAGAAGCAAGACAAAGTGACAGG - Intergenic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004481185 6:16020833-16020855 CAGAAGCCAGAGAGAGAGGAGGG - Intergenic
1004779414 6:18891743-18891765 CCAGAGCAAGAGAGAGAGGCAGG - Intergenic
1004831019 6:19476661-19476683 CAGCAGCAAGAGAAAAAGTGAGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005276582 6:24225986-24226008 CGCAAGCAAGAGAAAGTGGTAGG - Intronic
1005451546 6:25977695-25977717 GAGGAGGAAGAGAAAGAGGTGGG + Intronic
1005830954 6:29670779-29670801 AAGCAACAAGAGGAAGAGGCGGG + Intronic
1005857648 6:29874780-29874802 GAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1006236332 6:32636659-32636681 CAGAAGCCAGAGAAAGGGCAGGG + Intronic
1006246422 6:32740974-32740996 CAGAAGCCAGAGAAAGGGGAGGG + Intergenic
1006338740 6:33434165-33434187 CAGAAGCAGGGGAAAGAGTGAGG - Intronic
1006466734 6:34199799-34199821 CAAAAAAAAAAGAAAGAGGCCGG - Intergenic
1006536409 6:34702594-34702616 AAGAATCATGAGACAGAGGCCGG + Intergenic
1006901307 6:37503788-37503810 CAGAAACAAGAGAATGGGGTGGG + Intergenic
1006911249 6:37565071-37565093 AAGGTGCAAGAGAAAGAGGCAGG - Intergenic
1007131937 6:39483364-39483386 CACAAGCAAGAGATGGAGGAAGG - Intronic
1007354117 6:41298150-41298172 CAGAAGCAAGAGAGAATGGTGGG - Intergenic
1007358862 6:41341426-41341448 CAGAGGCATGAGAAAGAGAATGG + Intronic
1007690106 6:43695366-43695388 CAGAGGCAACGGAAAGGGGCGGG + Intergenic
1007880549 6:45161045-45161067 CAGAAGCAAGAGAGAGTGTTGGG - Intronic
1008113269 6:47517131-47517153 CAGGAACAAGAGAAAGAGGAGGG - Intronic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008418569 6:51271350-51271372 CAGAAGCAACAGAGAGAGTGTGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008754551 6:54778546-54778568 CAGGAGGAAGAGAGAGAAGCGGG + Intergenic
1008786979 6:55180313-55180335 TAGAAGCTAAGGAAAGAGGCAGG - Intronic
1008803065 6:55393632-55393654 AGGAAGTAAGAGAAAGAGGAAGG + Intronic
1009033372 6:58087159-58087181 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1009058943 6:58374446-58374468 AACAAGCAAGAGAGAGAGGAGGG + Intergenic
1009208985 6:60838928-60838950 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1009231896 6:61072677-61072699 AACAAGCAAGAGAGAGAGGAGGG - Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009356721 6:62757304-62757326 CACATGCAAAAGAATGAGGCTGG - Intergenic
1009518133 6:64646126-64646148 GAGAATCAAGAGAAACCGGCAGG + Intronic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1009734954 6:67663764-67663786 CAGAGGGAAGACAAAGATGCTGG - Intergenic
1009863823 6:69370645-69370667 TAGAAGCAAGAGCAAAAGACAGG - Intronic
1010233412 6:73555192-73555214 CAGTAACAAGAGTTAGAGGCAGG + Intergenic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010807110 6:80250347-80250369 CAGAAGATTGAGACAGAGGCTGG - Intronic
1011115756 6:83889844-83889866 CAGAAGCAAGAAAAAGAAAGAGG + Intronic
1011247972 6:85340085-85340107 CAGAAGCAGGTGACTGAGGCTGG - Intergenic
1011259631 6:85457423-85457445 TAGAAGCAAGAGAGAGGGGTGGG - Intronic
1011463306 6:87628794-87628816 CAAAAGAAACAGAAAGAGGTGGG - Intronic
1011519040 6:88184085-88184107 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1011996775 6:93599474-93599496 CAGAAGCAAGAGAGAGAGTTGGG - Intergenic
1012402786 6:98858034-98858056 CAGGAGCGAGAGAGAGAGGTGGG + Intergenic
1012471710 6:99579877-99579899 CAGGAGCAAGAGGTGGAGGCTGG - Intergenic
1013215068 6:108019663-108019685 AGCAAGAAAGAGAAAGAGGCAGG + Intergenic
1013293489 6:108738590-108738612 CAAAAGAAAGAGAAAGAGAAAGG + Intergenic
1013637652 6:112044469-112044491 CATAAGCAAAAGCAAGAGGCTGG + Intergenic
1013912076 6:115287858-115287880 GAGAAGCAAGAGAAATAGGATGG - Intergenic
1014073617 6:117211903-117211925 CAAAAGCAAGAGCAAGAAGGAGG + Intergenic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1014786513 6:125625748-125625770 CAGGAGCAAGACAGAGAGCCAGG + Intergenic
1014802320 6:125790896-125790918 GAGGAGCAAGAGGAGGAGGCGGG - Exonic
1015019844 6:128459958-128459980 CAGGACCAAGAGAAAGAAGTGGG + Intronic
1015045420 6:128770071-128770093 CAGGAGCAAGAGAGAAAGGGAGG + Intergenic
1015280947 6:131433534-131433556 CAGGAGCAAGAGAGAGAGTGAGG - Intergenic
1015323206 6:131898993-131899015 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1015460301 6:133483642-133483664 CAATAGCAAGAGAGAAAGGCAGG - Intronic
1015550018 6:134402538-134402560 TAGAAGAAAGAGAAAAAGACAGG - Intergenic
1015568015 6:134593979-134594001 AACAGGCAATAGAAAGAGGCTGG + Intergenic
1015713474 6:136166553-136166575 CAGGAGCAAGAGAGAGAGTGAGG + Intronic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016085431 6:139907645-139907667 AAGAAGCAAGAGAGAGAGCTAGG - Intergenic
1016317669 6:142808358-142808380 CGGATGGAAGAGATAGAGGCAGG + Intronic
1016403703 6:143707907-143707929 CAGGAGGAAGAGAGAGAGGGAGG + Intronic
1016699023 6:147033096-147033118 CGGAAGGAAGAGACAGAGGGAGG + Intergenic
1017189847 6:151641342-151641364 CAGGAGCAAGAGAGAGAGGAAGG - Intergenic
1017371181 6:153710988-153711010 CAGGAGGAAGAGAGAGAGACGGG + Intergenic
1017589190 6:155960140-155960162 CAGAAGCAGCAGGAAGAGACAGG - Intergenic
1017629546 6:156383081-156383103 CAGGAACAAGAGAGAGTGGCGGG - Intergenic
1017986531 6:159447669-159447691 CAGAAGGAAGAGACAGAAACAGG - Intergenic
1018279771 6:162172896-162172918 CAGAAGAAAGAGGAAGAAGGGGG + Intronic
1018331172 6:162728331-162728353 CAGAAACCAGAGAGTGAGGCTGG - Exonic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1018386388 6:163307869-163307891 GAGAAAGAAAAGAAAGAGGCAGG - Intronic
1018441101 6:163814116-163814138 GAGAAGAAAGAGAAAGTGGTGGG - Intergenic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1018740542 6:166725479-166725501 CGGAGGCTGGAGAAAGAGGCTGG - Intronic
1018788266 6:167125680-167125702 CAGAACCAGAAGAAAGAGGGAGG - Intronic
1018944076 6:168333639-168333661 CAGGACCTAGAGATAGAGGCAGG + Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019076961 6:169395454-169395476 CAGAAGCGAGAGACTGAGGCAGG - Intergenic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019219129 6:170461198-170461220 CAGAAGACAGAAAAAGATGCAGG + Intergenic
1019336919 7:489377-489399 CAGGAGCAAGACAAAGATGTCGG + Intergenic
1019404758 7:877502-877524 CAGCAGGAAGAGAGAGAGACGGG - Intronic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019742914 7:2683862-2683884 AAAAAGAGAGAGAAAGAGGCTGG - Intronic
1019784970 7:2970852-2970874 CAGAGCCGAGAAAAAGAGGCAGG + Intronic
1019964136 7:4484941-4484963 GAGAAGAGAGAGAAAGAGGAGGG + Intergenic
1019969603 7:4529573-4529595 CAGGAGCAAGAGAAAGGGAGAGG + Intergenic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020390500 7:7652595-7652617 GAGAAGTAGGATAAAGAGGCAGG + Intronic
1020483972 7:8697742-8697764 CAGAAGCCAGAGAAAGTCTCAGG + Intronic
1020611051 7:10398555-10398577 AAGATGCATGAGGAAGAGGCAGG - Intergenic
1020629178 7:10619993-10620015 CAGAAGCAAGAGGGAAAGGGGGG + Intergenic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1022416589 7:30183358-30183380 CAGGAGCAAGAGAGAGAGAGGGG + Intergenic
1022712437 7:32864526-32864548 CAGGAGCAAGAGAGAGAGGTGGG + Intergenic
1022748103 7:33193467-33193489 CTCAAGCAAGGTAAAGAGGCTGG - Intronic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1022910298 7:34894495-34894517 CAGGAGCAAGAGAGAGAGTCGGG - Intergenic
1022910562 7:34896478-34896500 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1023014213 7:35950782-35950804 GAGAAGCAAGAGAGAGAAGTGGG - Intergenic
1023030494 7:36086604-36086626 CAGTAGCAAAAGGAAGAGGGAGG + Intergenic
1023218482 7:37892904-37892926 TAAAAGAAAGAGAAAGAGGAAGG - Intronic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023318533 7:38968010-38968032 AAGAAACAAGAGATATAGGCTGG + Intergenic
1023471128 7:40521307-40521329 CAGGAGCAAGAAAGATAGGCAGG - Intronic
1023543311 7:41289473-41289495 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1023649974 7:42359479-42359501 CAGAAGCTAGAGAGAGAGTGTGG + Intergenic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1024066786 7:45744224-45744246 GAGAAGCAAGAGAGAGAAGCGGG + Intergenic
1024691591 7:51808947-51808969 AAAAAGGAAGAAAAAGAGGCAGG - Intergenic
1024895042 7:54249213-54249235 CAGGAGCAAGAGAACGAGGCGGG + Intergenic
1024941408 7:54767104-54767126 CAGAAGCCAGATGAGGAGGCTGG - Intergenic
1025049298 7:55721031-55721053 CAGGAGCAAGAGAGAGAGGGTGG - Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025158730 7:56634813-56634835 CATACCCATGAGAAAGAGGCGGG + Intergenic
1025279496 7:57616456-57616478 CAGAAGGAAGAGGTAGAGGGAGG - Intergenic
1025305235 7:57849044-57849066 CAGAAGGAAGAGGTAGAGGGAGG + Intergenic
1025939958 7:66068678-66068700 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
1026197338 7:68184486-68184508 TAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026338741 7:69417313-69417335 CAGAAGCAAGAGAGATGGGGAGG + Intergenic
1026497033 7:70912332-70912354 CAGAAGAAAGAGAAAGAATGAGG + Intergenic
1026506563 7:70989515-70989537 AGGAAGCAAGAGAGAGAGGAGGG - Intergenic
1026617343 7:71917228-71917250 CAGAAACAACAGGATGAGGCAGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027605815 7:80297191-80297213 CAGGAATAACAGAAAGAGGCAGG - Intergenic
1027743419 7:82041236-82041258 GAGAAGGAAGAAAAAGATGCAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028570045 7:92277038-92277060 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1029157934 7:98530542-98530564 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029241431 7:99166010-99166032 CAGAAGGAAGAGAGAGAAGGGGG - Intergenic
1029624924 7:101714670-101714692 CAGAAGCAAAAGAAAGGGGAAGG + Intergenic
1030450624 7:109705805-109705827 AAGAAGCAAGAGAAAAAGAAAGG - Intergenic
1030620495 7:111785052-111785074 CAATAACAAGAGAAAGAGGTAGG - Intronic
1030834616 7:114266502-114266524 CAGAAGCAAGAGAGAGAGTTGGG + Intronic
1030917275 7:115330954-115330976 CAGGAGCAAGAGAAAGAGGTGGG + Intergenic
1030919839 7:115369167-115369189 AGGAAGCAAGAGACAGAGGGAGG - Intergenic
1031014901 7:116562891-116562913 AGGAAGGAAGAGAAAGAGGAAGG + Intergenic
1031717483 7:125126384-125126406 CAGGAGCAAGAGACAGAGAGTGG + Intergenic
1031878069 7:127164140-127164162 CAGGAGCAAGAGAGTGAGGGGGG - Intronic
1031959196 7:127973651-127973673 CAGAACCAAAAGAATGAGGTTGG - Intronic
1032089559 7:128904423-128904445 CAGGAGAGAGAGAAAGAGGGAGG - Intronic
1032099806 7:128964886-128964908 CACAAGCAAAAGAAAGAGGCTGG + Intronic
1032124932 7:129186886-129186908 CAGGAGCAGGAGGAAGAAGCGGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032253802 7:130281088-130281110 AGGAAGCAAGAGAGAGAGTCGGG + Intronic
1032279728 7:130491195-130491217 CAGAGGCACAAGAAAGAGGGAGG - Intronic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1032417277 7:131745711-131745733 CAGAAACAAGAGAAAGAAATAGG + Intergenic
1032536505 7:132668964-132668986 CAGGAGCAAGAGAGAGATGGAGG + Intronic
1032707210 7:134431821-134431843 CAGGAAGAAAAGAAAGAGGCTGG + Intergenic
1032738451 7:134714060-134714082 CAGGAGGAAGAGACAGAGGTGGG - Intergenic
1033019419 7:137707615-137707637 CAGGAGGAAGAAAAAGAGGGTGG - Intronic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1033255536 7:139798222-139798244 CAGAAGGAAAAGAAAGAAGCCGG + Intronic
1033300392 7:140179475-140179497 CAGGAGCAAAAGAGAGAGGGAGG - Intergenic
1033313416 7:140279044-140279066 CAGGAGCCAGAGAAAGAGTGGGG - Intergenic
1033359288 7:140626675-140626697 CAGAAGCCAGCAAAAGAGGGTGG - Intronic
1033542058 7:142366267-142366289 CAGGAGCAAGAGATAGAGAGTGG + Intergenic
1033741587 7:144280039-144280061 GAGAAGCAGGAGACAGAAGCAGG + Intergenic
1033741590 7:144280084-144280106 GAGAAGCAGGAGACAGAAGCAGG + Intergenic
1033752311 7:144369530-144369552 GAGAAGCAGGAGACAGAAGCAGG - Intronic
1033752315 7:144369575-144369597 GAGAAGCAGGAGACAGAAGCCGG - Intronic
1033953759 7:146817650-146817672 CAGGAACAAGAGCAAGAGGAAGG + Intronic
1034365047 7:150539173-150539195 CAGTAGCAAGAGAGAGAGTGGGG + Intergenic
1034726454 7:153340617-153340639 AGGAAGCAAGAGAGAGAGGGAGG + Intergenic
1034740674 7:153470849-153470871 CTGAAGTCAGAGAGAGAGGCAGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035112116 7:156491996-156492018 CAGATCCAAGGGACAGAGGCAGG + Intergenic
1035476744 7:159149268-159149290 CAGAAGCAGAAGGGAGAGGCTGG - Intergenic
1035925351 8:3722044-3722066 CAGAAGCATAAGGAAGAGGCCGG + Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036700464 8:11010158-11010180 CAGGAGGAAGAGAGAGAAGCAGG + Intronic
1036746421 8:11413148-11413170 AGGAAGCAAGAGAGAGAGGAAGG - Intronic
1037314021 8:17583788-17583810 AAGAAGCAAGAGAGAGAGAGAGG - Intronic
1037480460 8:19300628-19300650 CAGTAGCAAGAGACAGATGTTGG + Intergenic
1037529544 8:19759174-19759196 TAAAAGAAAGAGATAGAGGCCGG + Intergenic
1037549289 8:19954579-19954601 CAGTAGCAAGAGAAAAAGGTGGG + Intronic
1037946106 8:22990604-22990626 CAGAAGGAGGAGGAAGAGGGTGG + Intronic
1038058042 8:23880606-23880628 CAGGAGCAAGAGGGAGAGACCGG + Intergenic
1038090810 8:24250853-24250875 CAGAAGCAATAGTAACAGGCTGG - Intergenic
1038170538 8:25127943-25127965 CAGAAGGAAGACACAGAAGCTGG + Intergenic
1038370586 8:26985906-26985928 CAGGAGCAAGGGAGAGAGGGAGG + Intergenic
1038423753 8:27451482-27451504 CAGACGCCAGAGAAGGAGGTCGG + Exonic
1038796632 8:30716269-30716291 CAGAAACCAGAGGAAGAGGATGG + Intronic
1038948279 8:32385596-32385618 CAGAAGCAAGAAAGAGAGCCAGG + Intronic
1038967625 8:32593096-32593118 GAGGAGGAAGAGGAAGAGGCGGG + Intronic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1039434716 8:37552121-37552143 TAGAAGACAGAGAGAGAGGCTGG + Intergenic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1039583333 8:38684743-38684765 CACTAGAAAGAGAAAGAGGTTGG - Intergenic
1039680317 8:39728057-39728079 CAGGAGCAAGCGAGAGAGTCAGG + Intronic
1039785362 8:40829979-40830001 TAGATGGAAGAAAAAGAGGCTGG + Intronic
1039883610 8:41642720-41642742 CAGAAAGTAGACAAAGAGGCCGG - Intergenic
1040003294 8:42597241-42597263 CGGGAGCGAGAGAGAGAGGCGGG + Intergenic
1040517067 8:48144038-48144060 GAGAAGCAAGAGAAGCAGTCAGG + Intergenic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1040921164 8:52619333-52619355 CACAAGCAAGAGAATGAAGTTGG + Intergenic
1040957663 8:52995960-52995982 CAAAAGAAAGAGAAAGGGCCTGG - Intergenic
1040994396 8:53387449-53387471 AGGAAGCCAGGGAAAGAGGCTGG + Intergenic
1041223350 8:55673660-55673682 CAGGAGCAAGAGAAAGGAGTGGG + Intergenic
1041264867 8:56054600-56054622 TAGAAGCAAGAGAAACAATCTGG - Intergenic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041315950 8:56562731-56562753 CAGGAGCAAGAGAGAGAGTGAGG - Intergenic
1041360194 8:57044943-57044965 AAGAAGCAAGAGAAAGGGGAGGG - Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1042072464 8:64950667-64950689 CAAAAGGAAGAGAGAGAGGGTGG + Intergenic
1042426871 8:68659355-68659377 CAGAAGGAGGCAAAAGAGGCTGG - Intronic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1043126639 8:76404552-76404574 CAAAGGCAAGACAAAGAGGATGG + Intergenic
1043185078 8:77138158-77138180 CAGAAGGAAGACAGAGGGGCAGG - Intergenic
1043492211 8:80760866-80760888 CAGAAGCAAGAGAGCGAGCAGGG + Intronic
1043585227 8:81760853-81760875 CAGAAGACAGAGAAAGAGAGAGG + Intergenic
1043732272 8:83697419-83697441 CCTAAGCAAGAGAACGAAGCTGG - Intergenic
1044152432 8:88798034-88798056 AAGAAGAAAGAAAAAGAGGAAGG - Intergenic
1044168290 8:89017025-89017047 CAGGAGCAAGAGACAGAGAGTGG - Intergenic
1044271881 8:90253845-90253867 CTGAAGGAAGGGCAAGAGGCTGG + Intergenic
1044489293 8:92793142-92793164 GGGAAGACAGAGAAAGAGGCTGG - Intergenic
1044493790 8:92851811-92851833 CAGGAGCAAGAGACAGAGAGTGG + Intergenic
1044604836 8:94039573-94039595 TAGAAGCAAGACCAAGAAGCAGG + Intergenic
1044631836 8:94287765-94287787 CAGAAGCAAGAGGCAGGGGATGG - Intergenic
1044636698 8:94332338-94332360 GAGGAGCAAGAGAAAGACGGGGG + Intergenic
1045718666 8:105079655-105079677 TGGAAGAAAGAGAAAGAGGGAGG + Intronic
1045737952 8:105318584-105318606 AAGAAGGAAGAGAAGGAGGGAGG - Intronic
1045887245 8:107113239-107113261 CAGAAGGAAGAAAAAGAGGTGGG + Intergenic
1046214626 8:111127268-111127290 TAGAAGCAAGAGGGAGAGGGTGG + Intergenic
1046295603 8:112215613-112215635 CAGGAGCAAGAGAGAGAGAAAGG - Intergenic
1046595417 8:116255758-116255780 CAGAACAAAAAGATAGAGGCAGG + Intergenic
1046716046 8:117568577-117568599 CCGAAGCAAGAGAAAGAGAGAGG + Intergenic
1046735021 8:117767706-117767728 CAGAAGGAAGAGAGAGAAGGGGG - Intergenic
1046735292 8:117769657-117769679 CAGGAGGAAGAGAAAGAAGGGGG - Intergenic
1046763514 8:118045721-118045743 CAGCTGCAATAGAAAGAGGAAGG - Intronic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1047051775 8:121120787-121120809 CAGGAGCAAGAGAAAGTGAATGG + Intergenic
1047099672 8:121663037-121663059 CAGAAGAAAGAGAGAAAGGTGGG + Intergenic
1047539849 8:125754188-125754210 CAGTAGCCAGAGGAAGAGGCAGG - Intergenic
1047688116 8:127321892-127321914 CAGGACCAAGAGAGAGAGGGAGG - Intergenic
1047711117 8:127553440-127553462 CAGTAGCAAGAGAGAGAGGCAGG - Intergenic
1047945108 8:129869087-129869109 AAGAAGAAAGAAAAAAAGGCTGG + Intronic
1048005068 8:130412395-130412417 CAGGAGCAAGAGAGAGAGCAAGG - Intronic
1048036865 8:130685273-130685295 CAGAAGGAAGAGGAAGAAGGGGG + Intergenic
1048146927 8:131854164-131854186 CAGAAGCAAGAGAGAGAGGGTGG - Intergenic
1048226227 8:132588873-132588895 TAGGAGCAAGAGAGAGAGGAAGG + Intronic
1048285083 8:133135254-133135276 CTGAAGCAAGACAATGAGGATGG + Intergenic
1048323023 8:133416358-133416380 CAGGAGCAAGAAAGTGAGGCAGG - Intergenic
1048735802 8:137500278-137500300 CAGGAGCAAGAGAAAGTTGTTGG + Intergenic
1048755908 8:137737961-137737983 GAGAAGGAAGAAAGAGAGGCAGG + Intergenic
1048767236 8:137858377-137858399 CAAAAGCAAGAGAGAGAGAGAGG + Intergenic
1049034325 8:140062494-140062516 CAGAGGCCAGTGGAAGAGGCAGG - Intronic
1049124817 8:140777333-140777355 CAAAAGCAAGAGCAAGGGGTGGG + Intronic
1049921751 9:371016-371038 TAGAAGCAAATGAATGAGGCAGG - Intronic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050128393 9:2383473-2383495 CAGGAGCAAGAAAATGAGGGAGG + Intergenic
1050192348 9:3040537-3040559 CAGTAGCAAGAGCAGGAGGCTGG - Intergenic
1050284352 9:4085771-4085793 CAGGAGCAAGAGAGAGAGTGGGG - Intronic
1050396550 9:5204162-5204184 AAGAAGCAAGAAAGAGAGGGAGG + Intergenic
1050424722 9:5501562-5501584 CAGAGGGAAGACACAGAGGCTGG + Intergenic
1050831170 9:10015710-10015732 CAGAAAGAAGAGAAAGAGGTGGG + Intronic
1050876205 9:10640065-10640087 CAGAAGGAAGAGAGAGAGAAGGG + Intergenic
1050937827 9:11421176-11421198 CACTAGCAAGAGAAGGAGGTAGG + Intergenic
1050982956 9:12043346-12043368 GAGAAGCAAGAGAGAGATGGGGG - Intergenic
1051208810 9:14719642-14719664 AAGAAGCAAGATAGAGAGGGAGG - Intergenic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051453606 9:17226861-17226883 CAGGAGCAAGAGAGAGAGACAGG + Intronic
1051677894 9:19577023-19577045 CTGAAGCAAAAGAAAGTGGCAGG + Intronic
1051869171 9:21716597-21716619 CAGAAGCAAGAGAGCAAGGGGGG - Intergenic
1052049538 9:23829748-23829770 ACCACGCAAGAGAAAGAGGCAGG + Intergenic
1052193545 9:25684766-25684788 CAAAAGCAGGAGCAAGAGGTGGG - Intergenic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052779351 9:32764896-32764918 CAGAAGCAAGACCCTGAGGCAGG + Intergenic
1053084671 9:35208601-35208623 CAGAAGCAAGAGCAAGAGTGGGG + Intronic
1053185120 9:36009469-36009491 AAGAAGGAAGGGAAAGAGGAAGG + Intergenic
1053470245 9:38341127-38341149 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1053836457 9:42141419-42141441 CAGAAACAGGAGAAAGAAGGAGG + Intergenic
1054337080 9:63817083-63817105 CGGAAGGGAGAGAAAGAGGGAGG - Intergenic
1055498760 9:76882611-76882633 CAGGAGCAAGAGAGAGAGAGGGG + Intronic
1056482952 9:87024303-87024325 CAGTAGCAAGAGAAAGAGAAGGG + Intergenic
1056579548 9:87880836-87880858 CAGCAGCAGGAGCAAGGGGCTGG + Intergenic
1056796600 9:89662935-89662957 CAGAAGCAAGACAAAGAGGAGGG - Intergenic
1056856507 9:90134486-90134508 AAAAAGGAAGAGAAAGAGCCCGG - Intergenic
1056947346 9:91009980-91010002 CAGGAGCAAGAGAGAGAGCAGGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057292817 9:93818218-93818240 GGGAAGGAAGAGAAAGAGGGAGG + Intergenic
1057292886 9:93818477-93818499 AAGAAGGAAGGGAAAGAGGGAGG + Intergenic
1057340928 9:94200590-94200612 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1057477113 9:95412124-95412146 GTGAAGGAAGAGAAAGAGGCAGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057606870 9:96504876-96504898 TAGAAGCTAAGGAAAGAGGCCGG + Intronic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1057945523 9:99324726-99324748 GAGAAGCTAGAGGAAGAGTCAGG + Intergenic
1058300797 9:103370250-103370272 TAGAAATAAGAAAAAGAGGCCGG + Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058545322 9:106054919-106054941 CAGAAGCAAAGGGAAGAGACAGG - Intergenic
1058653321 9:107197243-107197265 CAACAGCAAGAGAGAGAGGGGGG + Intergenic
1058927712 9:109684053-109684075 AAGAAGCAAGCAAAAGAGGCTGG - Intronic
1059119221 9:111627103-111627125 CAGAAGACAGAGGCAGAGGCTGG - Intergenic
1059139331 9:111837366-111837388 AAGAAGAAAGGGAAAGAGACAGG - Intergenic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059411802 9:114137205-114137227 CAGGAGCAAGAGAGAGAGTTGGG - Intergenic
1059639177 9:116199877-116199899 AAGAAGCAAGAGAGAGAGTGGGG + Intronic
1059730764 9:117054717-117054739 AAGAAGCCAGAGAGATAGGCAGG + Intronic
1059855525 9:118393070-118393092 CAGGAGCAAGAGAGAGAAGGAGG - Intergenic
1060255613 9:122027145-122027167 CAGGAGCAAGAGAGAAAGGAGGG + Intronic
1060650756 9:125324701-125324723 CATAAGCAAGTCAAAGAGGTGGG + Intronic
1060785419 9:126448673-126448695 CGGGAGCAAGAGAAAGAGAAGGG + Intronic
1060902257 9:127270121-127270143 CACAAGCAAGAGAATGCAGCTGG - Intronic
1061332518 9:129904660-129904682 AAGAAACAAGATAAAGCGGCTGG - Intronic
1061345554 9:130022153-130022175 TAAAAAGAAGAGAAAGAGGCTGG - Intronic
1062145763 9:134988844-134988866 CAGGAGCAAGAGGCAGAGGCAGG + Intergenic
1062380526 9:136284657-136284679 CACCAGCAAGAGCGAGAGGCCGG + Intronic
1062680801 9:137778914-137778936 CAGTAGCAAGAGACAGAGAAGGG + Intronic
1203707849 Un_KI270742v1:68855-68877 CAGAAGGAAGAGAAAAGAGCAGG - Intergenic
1185665568 X:1762736-1762758 CAAAAAGAAGAAAAAGAGGCCGG - Intergenic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1185826365 X:3255100-3255122 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1185917634 X:4053485-4053507 GAGAAGCAGGAGGAAGAGGATGG + Intergenic
1185975882 X:4719577-4719599 CAGAAGAAAGGTAAAGGGGCAGG - Intergenic
1186020065 X:5245128-5245150 AAGAAGGAAGGGAAAGAGGGAGG - Intergenic
1186413224 X:9361747-9361769 CAACAGCAAGAGAAAGAGTTGGG - Intergenic
1186640052 X:11445865-11445887 CAGAAGCTAGAGAAATAGATAGG + Intronic
1186672821 X:11783985-11784007 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1186701025 X:12090284-12090306 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1186821808 X:13296489-13296511 CAGAAGAAAGACAAAGAAGCAGG - Intergenic
1186830997 X:13390116-13390138 CAGGAGCAAGAGAGTGAGGGAGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187209452 X:17214754-17214776 AAGAAGCTAGAGAGATAGGCAGG + Intergenic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1187333626 X:18363021-18363043 CAGGAGCAAGAAAGAGAGGGAGG - Intergenic
1187401055 X:18960511-18960533 CAGAAGCAAGAGGGAGATGGGGG + Intronic
1187414241 X:19078860-19078882 CAAAATCAAGAGACAGAGGGAGG + Intronic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187916553 X:24158053-24158075 CAGAAGCAAAAGAAATTGGCCGG - Intronic
1188054470 X:25525543-25525565 AAGAAGCCAGAGAAAGAAGCTGG + Intergenic
1188138199 X:26515486-26515508 AAGCAGCAAGAGAAAGAGATTGG - Intergenic
1188260660 X:28019190-28019212 CAGGAGGAAGAGAAAGAGGGTGG + Intergenic
1188339117 X:28977373-28977395 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
1188651226 X:32633799-32633821 CAGGAGCAAGAGTGAGAGGGAGG + Intronic
1188963861 X:36526809-36526831 CAGAAGGAAGAGAGAGAGAGAGG + Intergenic
1189025202 X:37387532-37387554 CAGGAGGAAGAGAGAGAGGGGGG + Intronic
1189154321 X:38741417-38741439 AAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1189245840 X:39562695-39562717 AAGAAGCAAGAGAGAGAAGGAGG + Intergenic
1189540246 X:41979985-41980007 CAGAAGGAACAGAAAAAGGAAGG + Intergenic
1189628964 X:42931603-42931625 CAGAAGAAAGAGAGAGAAGGGGG + Intergenic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189656506 X:43250498-43250520 CAGGAGCAAGAGAGAGAGGTAGG + Intergenic
1189668978 X:43387642-43387664 CAGGAGCAAGAGAAAGTGGAAGG - Intergenic
1189724285 X:43952966-43952988 CATAAGCAAAGGCAAGAGGCAGG - Intronic
1189761242 X:44323761-44323783 CAGCTGCAAGAGAAAGAGAAGGG + Intronic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190479312 X:50860039-50860061 CAGAAGCAAGAGTGAGAGAGTGG - Intergenic
1190656554 X:52617870-52617892 CAGAGGGCAGAGAAAGAGGTAGG - Intergenic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1190732025 X:53232850-53232872 CAGAAGTAGGAGGCAGAGGCAGG + Intergenic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1191801915 X:65090931-65090953 CAGGAGCAAGAGAGAGACGCAGG - Intergenic
1191934082 X:66407581-66407603 CAGAAGCAAGGGAGAGAGTTGGG + Intergenic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192384999 X:70659002-70659024 CACATGCAAAAGAAAGAAGCTGG + Intronic
1192397102 X:70793523-70793545 CAGAAGAAAGAGAGTGAGGGTGG - Intronic
1192494327 X:71604856-71604878 CAGGAGCATGAGAAAGATGTGGG - Intronic
1192527956 X:71863762-71863784 CAGGAGCAAGAGAGAGAGCAGGG + Intergenic
1192668882 X:73117895-73117917 CACAAGCAACAGAACGAAGCTGG + Intergenic
1192779176 X:74276933-74276955 CAGAAAGAAGAGTAAGAGGAGGG + Intergenic
1193046469 X:77059905-77059927 AGGAAGGAAGAGAAAGAGGAGGG + Intergenic
1193254545 X:79331772-79331794 CAGAAGCAAGGTGAAGGGGCAGG - Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1194064049 X:89240505-89240527 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1194347823 X:92787395-92787417 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1194369017 X:93047523-93047545 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1194402238 X:93452775-93452797 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1194559065 X:95397690-95397712 AAGGAGCAAGAGAAAGAGGGGGG - Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194916236 X:99712600-99712622 AGGAAGCAAGAGAAAGAGAGTGG - Intergenic
1195245151 X:102988645-102988667 CAGAAGCAAGAGCATGGGGAAGG - Intergenic
1195588443 X:106595134-106595156 CAGAAACTAGAAAAAGAGGGAGG - Intergenic
1195919817 X:109972367-109972389 AAGAAACTAGAAAAAGAGGCTGG - Intergenic
1196137050 X:112221453-112221475 AAGAACCAAGAGATAGAGACAGG - Intergenic
1196270700 X:113707091-113707113 GAAAAACAAGAGAAAGAAGCAGG - Intergenic
1196274914 X:113755638-113755660 CAGAAATAATAGAAAGAAGCAGG - Intergenic
1196317667 X:114248128-114248150 CAAAAGCAAAACAAACAGGCCGG - Intergenic
1196544810 X:116949275-116949297 CAAAAGCAAATGAAAGAGGGAGG - Intergenic
1196777503 X:119352894-119352916 CAAGAGCAAGAGAGAGAGGGTGG + Intergenic
1196970075 X:121099110-121099132 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1197144789 X:123159508-123159530 AAGAAGCAAGACAGAGAGGAAGG + Intergenic
1197173049 X:123455787-123455809 CTAAAGCAAGCAAAAGAGGCTGG + Intronic
1197473290 X:126890011-126890033 CAGGAGCAAGAGAAAGTGCGGGG + Intergenic
1197524046 X:127539605-127539627 CAGGAGCAAGAGAAATAAGTTGG + Intergenic
1197558725 X:127991470-127991492 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1197667351 X:129238272-129238294 CAGGAGCAAGAGAAAGAGAGTGG + Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1197889528 X:131255406-131255428 CAGAAGCAAGACCAAGTGGTTGG - Intergenic
1198074375 X:133180489-133180511 CAGAAGCAAGAGAGCAAGGCTGG - Intergenic
1198261003 X:134964871-134964893 CAGGAGCAAGAGAGAGAGCGGGG + Intergenic
1198360700 X:135892698-135892720 CAGCACCAAGAGAAAGCGTCTGG + Intronic
1198666160 X:139025542-139025564 CAGAAGGAACAGAAAGATGTGGG - Intronic
1198688538 X:139253824-139253846 GAGATGACAGAGAAAGAGGCAGG + Intergenic
1198762234 X:140044521-140044543 CAGAAGCAAAAGAATGAAGCTGG - Intergenic
1198785295 X:140281945-140281967 CAGAAGGTAGAGAAAGAGATAGG - Intergenic
1199239416 X:145528970-145528992 CAGGAGCAAGAGAGTGAGGTGGG - Intergenic
1199241989 X:145557545-145557567 CAAAAGGAAGAGAGAGAGGAAGG - Intergenic
1199250912 X:145660419-145660441 CAGGAGGAAGAGAAAAAGGCGGG - Intergenic
1199261305 X:145778734-145778756 CAGAAGCAAGAGAGCGAGTGGGG - Intergenic
1199442151 X:147880342-147880364 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199945627 X:152664246-152664268 CAGGAGGAAGAGAAAGAGAGGGG - Intergenic
1199993400 X:153003127-153003149 CAGGAGCAAGAGAGAGATGGAGG + Intergenic
1200314109 X:155113445-155113467 CACATGCAAAAGAAAGAAGCTGG + Intronic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1200656151 Y:5904031-5904053 TAGAAGCAAGAGAGAGAGGCAGG + Intergenic
1200677222 Y:6163857-6163879 AAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1200718224 Y:6574604-6574626 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic
1201437360 Y:13973730-13973752 CAGGAGGAAGAGAGAGAGGGAGG + Intergenic
1201453017 Y:14136382-14136404 GAGAAGGAAGAGAAAGAGTGAGG - Intergenic
1201897149 Y:19004029-19004051 CAGCAGGAAGACAAAGAGGGTGG + Intergenic
1202099397 Y:21290116-21290138 CAGGAGAAAGAGAAAAATGCAGG + Intergenic
1202374423 Y:24220622-24220644 GAGAAGAAAGAGAAAGAGAGAGG + Intergenic
1202496357 Y:25449498-25449520 GAGAAGAAAGAGAAAGAGAGAGG - Intergenic