ID: 1092237652

View in Genome Browser
Species Human (GRCh38)
Location 12:6820112-6820134
Sequence CACTGCTGCCTCTTGAATGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092237648_1092237652 -8 Left 1092237648 12:6820097-6820119 CCTTGTCCCAAGTTCCACTGCTG 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG 0: 1
1: 0
2: 4
3: 24
4: 234
1092237645_1092237652 0 Left 1092237645 12:6820089-6820111 CCCAGGTCCCTTGTCCCAAGTTC 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG 0: 1
1: 0
2: 4
3: 24
4: 234
1092237646_1092237652 -1 Left 1092237646 12:6820090-6820112 CCAGGTCCCTTGTCCCAAGTTCC 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG 0: 1
1: 0
2: 4
3: 24
4: 234
1092237647_1092237652 -7 Left 1092237647 12:6820096-6820118 CCCTTGTCCCAAGTTCCACTGCT 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG 0: 1
1: 0
2: 4
3: 24
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092237652 Original CRISPR CACTGCTGCCTCTTGAATGC AGG Exonic
900540063 1:3198112-3198134 CTCTGCTGCCTCCTGCACGCGGG + Intronic
900616221 1:3566835-3566857 CACTGCTGCCTCCTGAGTCTGGG - Intronic
900981766 1:6049867-6049889 CACAGCTGCCTCTTTCATGGGGG - Intronic
901148567 1:7085222-7085244 CAGAGCTGCCTCCTGAATGAGGG + Intronic
904349030 1:29893120-29893142 CAGTAGTGCCTCTTGAGTGCAGG - Intergenic
904864857 1:33570420-33570442 CACTTCAGCCTCTCAAATGCTGG + Intronic
904998219 1:34647785-34647807 CCCAGCAGCCTCTTGAAGGCGGG + Intergenic
907828427 1:58040426-58040448 TTCTGCTGCGTCTTGGATGCCGG - Intronic
908798475 1:67854695-67854717 CCCTGCCGACTCTTAAATGCAGG + Intergenic
910325579 1:86003111-86003133 AAATGCTGCCTCTGGAATTCTGG + Intronic
912857122 1:113179015-113179037 CACTCCTTCTTCTTGATTGCTGG - Intergenic
913073998 1:115325734-115325756 CACTGCTCCCTCTTTAATCTGGG - Intronic
913268246 1:117066340-117066362 CACTGCTGCTACTTCAATTCAGG - Intronic
913427840 1:118754457-118754479 CACTGCTGAAACATGAATGCTGG - Intergenic
916563486 1:165953463-165953485 AACTGCTGCCTAGTGAATGATGG + Intergenic
918953677 1:191175658-191175680 CTCTGCTGCCTCTTGGTTGATGG + Intergenic
919358725 1:196562349-196562371 CCCTCCTTCCTTTTGAATGCAGG - Intronic
919743732 1:200995633-200995655 CAGTGCTACCTCTTGGAAGCTGG + Intronic
921762447 1:218931686-218931708 CACTGCAGCCTCTTAAACGAAGG + Intergenic
1062921119 10:1280485-1280507 CAGGGCTGCCTGTTGAGTGCTGG + Intronic
1063028068 10:2202549-2202571 CCCTGCTCCCTCTGGAATTCAGG - Intergenic
1063112949 10:3052724-3052746 CACTGCAGCCTCTTCCCTGCTGG + Intergenic
1063218238 10:3943274-3943296 CACTGCTGGCTCTGGAATCGTGG + Intergenic
1065950294 10:30645378-30645400 CACTGCCGCATCCTGAACGCAGG - Intergenic
1066350942 10:34636336-34636358 CACTGCTGCCTCCTCCATCCGGG + Intronic
1073849963 10:107603390-107603412 CACCTCAGCCTCTTGAGTGCTGG - Intergenic
1074225820 10:111483411-111483433 CACTGCTGCATTTTGTATTCAGG + Intergenic
1075066182 10:119290553-119290575 CACTTCTGCCTCTAGAAGGCAGG + Intronic
1075870306 10:125767928-125767950 CACTGCTGCAGTTGGAATGCTGG + Intronic
1078728641 11:13955771-13955793 CTCTGCGGCTTCTTGAAGGCAGG + Intergenic
1078938559 11:15974930-15974952 CTCTGCTGGTTATTGAATGCAGG - Intronic
1080620134 11:33980461-33980483 CACTGATGCCTTGTGAATACCGG + Intergenic
1080830854 11:35892062-35892084 CAATGCTTCCTCTTGAATGTGGG + Intergenic
1080880350 11:36313933-36313955 CACTGCTGGGACTTGAATTCAGG - Intronic
1083471195 11:62885169-62885191 CTCTGCAGGCTCTTGATTGCGGG + Exonic
1085156756 11:74302618-74302640 AACTCCTGTTTCTTGAATGCTGG - Intronic
1085783256 11:79428635-79428657 CACAGCTGCCTTCTGAGTGCTGG - Intronic
1086235577 11:84626333-84626355 CACTCCTAACTCTTGAAAGCTGG + Intronic
1087079177 11:94153181-94153203 CACGCTTGCCTCTTGAATTCTGG + Intronic
1087154255 11:94885493-94885515 CACTGCAGCTTCTTGGATGCTGG + Intergenic
1088210537 11:107450437-107450459 CACCTCAGCCTCTTGAAAGCTGG - Intronic
1088770027 11:113025391-113025413 TACTTCTGCATCATGAATGCTGG + Intronic
1090062890 11:123478760-123478782 CATTGCAGCCTCTTCAAAGCAGG - Intergenic
1090336538 11:125971922-125971944 CATTACTGCCTTTTGAATTCAGG + Intronic
1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG + Exonic
1092898656 12:13037947-13037969 CACTTCAGCCTCCTGAGTGCTGG - Intergenic
1093422975 12:18996167-18996189 CACTGATGCCTCTGGAAAGTGGG + Intergenic
1102014055 12:109636317-109636339 TTCTGCTGCCTCTTGAATGCAGG - Intergenic
1102195649 12:111023455-111023477 CACAGGTGCCCCCTGAATGCAGG - Intergenic
1103567183 12:121822740-121822762 CACTGCTGCCCCCTGATAGCGGG - Exonic
1104396616 12:128439333-128439355 GAGTGCTGTCTCTTGAATACAGG + Intronic
1106267305 13:28122142-28122164 CACTGCAGCCTCTTGTTTCCTGG + Intergenic
1107932824 13:45320257-45320279 GACTGCTGCCTCCTGGGTGCTGG - Intergenic
1110260347 13:73477539-73477561 TCCAGCTGCCTCTTAAATGCAGG + Intergenic
1111181292 13:84669328-84669350 GAATGCTGCCTCTTTAATCCAGG - Intergenic
1112650313 13:101389555-101389577 CTCTGCTGCCTCTGGACTGCTGG - Intronic
1112912054 13:104498392-104498414 TCCAGATGCCTCTTGAATGCCGG + Intergenic
1113351076 13:109529853-109529875 CTCTGCTGCCTCTCATATGCAGG + Intergenic
1114799939 14:25762052-25762074 CACTGCTTCTTCTTTAATTCAGG + Intergenic
1119412690 14:74444158-74444180 GACTGAGGCCTCTTGAATCCGGG - Intergenic
1120532090 14:85644087-85644109 CACTGCTGCACCTTGAATCTGGG - Exonic
1120755971 14:88244689-88244711 CACTTCTGCAGCCTGAATGCAGG - Intronic
1121562886 14:94887599-94887621 CACTGCCGCCTCTTGGAGACAGG - Intergenic
1121943367 14:98094386-98094408 CATTACTGCCTTTTGAATGCTGG - Intergenic
1124103143 15:26713798-26713820 CACTTCTGCCTCCTTACTGCAGG + Intronic
1125072127 15:35567596-35567618 TCCTGCTGCCTTTTGACTGCAGG + Intergenic
1125386748 15:39145144-39145166 CACTTCTACCTCTTGCATGTAGG + Intergenic
1127681128 15:61299542-61299564 CACTGCTATCTCCTGAATGCTGG - Intergenic
1129188191 15:73923109-73923131 AGCTGCTGCCTCTGGAAAGCGGG - Intergenic
1129888859 15:79057808-79057830 CAATGCCGCCTCCAGAATGCTGG + Intronic
1131107314 15:89743956-89743978 CACTGCTGCCCCTGGCCTGCTGG + Intergenic
1132506607 16:313061-313083 CACTTCAGCCTCATGAGTGCTGG - Intronic
1132646022 16:999690-999712 GACTGCTGGCTCATGACTGCTGG - Intergenic
1132646023 16:999704-999726 GACTGCTGGCTCATGACTGCTGG - Intergenic
1133896860 16:9938044-9938066 CACCGCTGCATCTTCTATGCTGG - Exonic
1133965986 16:10532053-10532075 CAGAGCTGCCTCGTAAATGCTGG - Exonic
1135565508 16:23508625-23508647 CCCATCTGCCTCTTCAATGCTGG + Intronic
1135913644 16:26583495-26583517 CACTGCTGGCTTTTAAATGGAGG - Intergenic
1136246453 16:28979066-28979088 CCCTGCTGCCTCTTGGGAGCGGG + Intronic
1137299441 16:47133481-47133503 CACTGCAGCCTCTTAACTCCTGG - Intronic
1137804136 16:51287619-51287641 CATTGCTGCATTTGGAATGCTGG + Intergenic
1138764462 16:59585168-59585190 CACTGGTGCCTGTTGAATGATGG + Intergenic
1139035327 16:62938978-62939000 TAATGCTGCCTCCTTAATGCTGG + Intergenic
1139593743 16:67946806-67946828 CACTGCTGCCACCTGAGAGCTGG - Intronic
1139747151 16:69083737-69083759 CCCTGCTGCCTCTTGAGTGCTGG + Exonic
1140485123 16:75287662-75287684 CACCTCAGCCTCTTGAGTGCTGG - Intergenic
1141142042 16:81502892-81502914 CACTGCTGTCCCTGCAATGCCGG + Intronic
1141601394 16:85128679-85128701 AAGTGCAGCCTCTTCAATGCTGG - Intergenic
1146394549 17:32453349-32453371 CATTAGTGCCTCTTGAAAGCAGG + Intronic
1146804495 17:35854572-35854594 CTCTGCTGCCTCTTCAATCTAGG - Intronic
1148574972 17:48704006-48704028 GACTGCTGCCTCATGAAGGCTGG + Intergenic
1148727944 17:49809377-49809399 CACTTCTACCTCATGAATGAAGG + Intronic
1148805682 17:50262728-50262750 CACTGCTGCCTCTTGACGTGGGG + Intergenic
1150228938 17:63539336-63539358 CTCTGCTTCCTCTGGACTGCTGG + Intronic
1150892272 17:69166727-69166749 GTCTGCTGCCTCTTGATTGGCGG - Intronic
1151364736 17:73609877-73609899 GACAGCTGCCTGTTGATTGCTGG - Intronic
1151971716 17:77460761-77460783 CACAGCTGCATCTTGCATCCGGG + Intronic
1152151219 17:78602542-78602564 CTTTGCTCCCTCTTGAATCCTGG + Intergenic
1152351769 17:79787720-79787742 CACTGCTTCCTATTCAATACAGG - Exonic
1152823169 17:82447445-82447467 CACCTCTGCCCCTTGATTGCTGG - Intronic
1155467112 18:26148958-26148980 CACCTCAGCCTCCTGAATGCAGG + Intronic
1156245365 18:35292382-35292404 CACTGCTGCCTCTGAACTCCTGG - Intergenic
1161507898 19:4653865-4653887 CACTGCAGCCTCTTAACTCCTGG - Exonic
1161728355 19:5943951-5943973 CCCTGCTGCCTCTTGAAGGCCGG + Intronic
1161922427 19:7276523-7276545 AACTGCTTCCTCTTAAATTCAGG + Intronic
1163095534 19:15054505-15054527 CACTGCAGCCTCTTAACTCCTGG - Intronic
1163727059 19:18928842-18928864 CACAGCTGCCTCTGGAGAGCAGG - Intronic
1165242837 19:34481637-34481659 CGCTGCGGCCTCTGGAATGTGGG - Exonic
1167773672 19:51540932-51540954 CACAGCCGCCTCTTGAATAGTGG - Intergenic
1167886156 19:52501589-52501611 CACTGCTGCCTCGTGTGTGGTGG + Intronic
1167912570 19:52716127-52716149 CACTGCTGCCTCGTGTGTGGTGG - Intronic
1167927545 19:52833842-52833864 CACTGCTGCCTCGTGTGTGGTGG - Intronic
1168155135 19:54469817-54469839 CTCTGCTGCCTCTTGACTCGTGG + Intronic
925960628 2:9011793-9011815 CAATGCTGGCTCTCAAATGCAGG - Intergenic
928127620 2:28627272-28627294 CACTTCTGCCTCTAGAGTGTGGG - Intronic
929144926 2:38698288-38698310 CACTGCTGACTCCTAAGTGCCGG - Intronic
929214405 2:39396110-39396132 CACTGCAGCCTCTTAACTCCTGG + Intronic
930229518 2:48828447-48828469 CTCTTCTGCCTCTTGAGTGCCGG - Intergenic
931722027 2:65073575-65073597 CACTGCTGTCTTTGGAATGTTGG + Intronic
932250479 2:70238992-70239014 CACTGCAGCCTCTTAACTCCTGG - Intronic
933096137 2:78183822-78183844 CACCTCTGCCTCTTGAATAATGG + Intergenic
935362829 2:102262216-102262238 CACTGATTCCTCTTAAATGTAGG - Intergenic
936109511 2:109653452-109653474 CACTGCAGCCCCTTGTCTGCTGG + Intergenic
936271070 2:111049457-111049479 CACTGCTGCCTGCGGAGTGCGGG + Intronic
937765828 2:125659448-125659470 CACTTCTGCCCCTTGATTCCTGG - Intergenic
938290912 2:130149977-130149999 CACTGCAGCCTCTTAACTCCTGG - Intergenic
938376257 2:130808642-130808664 CCCTGCTGCCTCCTGGCTGCTGG + Intergenic
938465633 2:131522977-131522999 CACTGCAGCCTCTTAACTCCTGG + Intergenic
939926014 2:148173642-148173664 CACTGTAGCCTCTTTACTGCTGG - Intronic
940883751 2:158970409-158970431 AACAGCTGCTTCTTGATTGCTGG + Intronic
942402843 2:175621681-175621703 CAATGCTGCCTCTAAAATCCAGG - Intergenic
943957194 2:194207635-194207657 TACTGCTGCATCTTGTATGGGGG + Intergenic
944494579 2:200293954-200293976 CTCTCCTGCCTCTTGAATGTTGG - Intergenic
944686035 2:202118751-202118773 CACTGCTTCCTTCTGAAGGCTGG - Intronic
947079916 2:226384837-226384859 CATTGCTGCATCTTTAGTGCAGG + Intergenic
947661782 2:231874929-231874951 CCCTCCTGTCTCTTGGATGCTGG - Intergenic
1169403444 20:5303343-5303365 CTCTCCTGCCTCTGAAATGCAGG - Intronic
1170476732 20:16722373-16722395 CTCTGCTGCCACTTTAATTCAGG + Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1173985620 20:47259417-47259439 CCCTGCTGCCTCTGGGATCCTGG + Intronic
1174368431 20:50070395-50070417 CACCTTTGCCTCTAGAATGCTGG - Intergenic
1174489871 20:50885280-50885302 CTCTGCTACCTCTAGCATGCCGG - Intergenic
1174769378 20:53284187-53284209 AAGTGTTGCTTCTTGAATGCTGG + Intronic
1175250917 20:57609796-57609818 CACTCCTATCTCCTGAATGCTGG + Intronic
1175762697 20:61572097-61572119 GGCTGCTGCCTCCAGAATGCAGG + Intronic
1177454967 21:21326070-21326092 CCTTTCTTCCTCTTGAATGCAGG - Intronic
1178661927 21:34514074-34514096 CAGTTCTGCCTGTTGAATGTCGG - Intronic
1179088537 21:38242318-38242340 CACTGCTGCTTCTCTGATGCAGG + Intronic
1179521956 21:41951475-41951497 CACTGTTGCCTCTTCCAGGCAGG + Intronic
1182580116 22:31303224-31303246 AACTTCTGCCTCTTAAATCCAGG - Intergenic
1184089954 22:42287562-42287584 CACTGCTGACTCCTCAGTGCCGG - Intronic
1184450298 22:44578563-44578585 CTCTGCTGCCCCTTGCAAGCAGG - Intergenic
1184834956 22:47015682-47015704 CAGGTCTGCCTCTTGGATGCTGG - Intronic
953014885 3:39064347-39064369 CACTGCAACCTCTTGACTCCTGG + Intronic
954280813 3:49576326-49576348 CAGGGCTGTCTCTTGAATGCAGG + Intronic
955426782 3:58799689-58799711 CACTGCTCCTTCTCGAATGCTGG - Intronic
958868734 3:99532317-99532339 CAGTACTGCCTCTTGAAAGCTGG + Intergenic
958950146 3:100407697-100407719 CTCTACTCCCTCTTGAATGCTGG + Intronic
960119296 3:113930811-113930833 CACTGCTGCCACTGAAAAGCAGG + Exonic
960596212 3:119410385-119410407 CAGAGCTGCCTCTCAAATGCAGG - Intronic
961304249 3:125945293-125945315 CACCTCAGCCTCTTGAGTGCTGG + Intergenic
963352701 3:144171446-144171468 AACTGCTGCATCTTTTATGCAGG + Intergenic
966044131 3:175529455-175529477 CACTGCTACCCCTTGATTCCTGG + Intronic
966557990 3:181285203-181285225 CAATGCTGCATTTTGAAAGCTGG + Intergenic
967304784 3:188049948-188049970 CACTGCTGCATCTTAGAGGCTGG - Intergenic
968439114 4:612675-612697 CACTTCTGCCTCTTGGTTCCAGG - Intergenic
970407470 4:15777889-15777911 CACTGATGCCTCTTGAGAGAAGG + Intergenic
970488466 4:16547672-16547694 CACTGCTGCCTCTATAATTAGGG - Intronic
971607957 4:28683534-28683556 CACTGCTGCCTCATGAAAAATGG + Intergenic
971793300 4:31196520-31196542 CACTGCTGTATTTTGAAAGCAGG + Intergenic
973973674 4:56240983-56241005 CACTGCAGCCACTGTAATGCAGG - Intronic
974932339 4:68373652-68373674 CACTGCTGCCTTTGGATCGCAGG - Intergenic
976718048 4:88144362-88144384 CTCTGCTGCCTCTTTCGTGCTGG + Intronic
978835101 4:113139809-113139831 CACTGCTGCCTCTTGACTTCTGG - Intronic
978873103 4:113604562-113604584 AACTTCTGCCTCTAGAATGAAGG - Intronic
979924194 4:126539286-126539308 CATTTCTGCCTCTAGAATGGAGG - Intergenic
981217255 4:142184911-142184933 CTTTGCTGCCTCTTGCTTGCAGG - Intronic
981645115 4:146990602-146990624 CATTGCTGTCCTTTGAATGCAGG + Intergenic
982779586 4:159477017-159477039 CTCAGCTGCCTGATGAATGCAGG - Intergenic
984701809 4:182823130-182823152 CAGTGGTGCCTATTGCATGCTGG + Intergenic
985030373 4:185783179-185783201 TCCTTCTACCTCTTGAATGCTGG - Intronic
985938893 5:3118439-3118461 CACTGCAACTTTTTGAATGCTGG - Intergenic
986672903 5:10158965-10158987 CAATACTGCCCCATGAATGCAGG + Intergenic
987657441 5:20824157-20824179 CACTGTTGCCTCAGGAGTGCAGG + Intergenic
988766103 5:34379789-34379811 CACTGTTGCCTCAGGAGTGCAGG - Intergenic
989294470 5:39807627-39807649 CATTGCTGCCTCCTGGATTCTGG - Intergenic
989491410 5:42060123-42060145 TTCTGCTGCCTCTGGTATGCTGG - Intergenic
991439801 5:66634968-66634990 CAATCCTGCCTCTGGGATGCAGG + Intronic
991902562 5:71475180-71475202 CACTGCAGCCTCTTACCTGCTGG + Intronic
992038805 5:72808482-72808504 CCCTCCTGCCTCTTGACTGGGGG - Intergenic
995254509 5:110030906-110030928 AACTGCTGCTTCTTGAATTAGGG + Intergenic
996903805 5:128575091-128575113 CCCTCCTCCCTCTTGAATCCAGG + Intronic
998355179 5:141529488-141529510 CATTGCTGACTTATGAATGCTGG - Intronic
998643964 5:144042089-144042111 CACTGATTTCTCTTGGATGCTGG - Intergenic
999809173 5:155111727-155111749 CACTGCTACCTCTTGCCTCCTGG + Intergenic
1000603861 5:163306998-163307020 CACTGATGGCACATGAATGCAGG + Intergenic
1002902333 6:1419659-1419681 CCCTCCTGACTCTTCAATGCTGG - Intergenic
1003184304 6:3817476-3817498 CACTTTGGCCTCCTGAATGCTGG - Intergenic
1003763432 6:9208804-9208826 CATTTCTGCCTCTTGATTCCTGG - Intergenic
1004685605 6:17940541-17940563 TGCTGCTGCCTCTTGAAAGAAGG - Intronic
1010833003 6:80553773-80553795 CACTACAGCCTCCTAAATGCAGG - Intergenic
1011114909 6:83879174-83879196 CAATGCAGCATCTAGAATGCAGG + Intronic
1012916168 6:105173429-105173451 CCCTCCTGCATCTTGAATGGAGG + Intronic
1014537875 6:122638166-122638188 TACTGCTGCTCCTTCAATGCTGG + Intronic
1014595004 6:123324589-123324611 CAATTCTGCCTTTTGAATGAGGG + Intronic
1015645711 6:135386027-135386049 AACTGTTGACTCTTGAAGGCAGG + Intronic
1017754037 6:157514683-157514705 CCCTGCAGCCTCTTGACTGCTGG + Intronic
1019728024 7:2613652-2613674 CACTTCTGCCTCTTTTCTGCTGG - Exonic
1019838964 7:3419594-3419616 CTCAGTTGCCTTTTGAATGCTGG + Intronic
1023653385 7:42393800-42393822 CACTGCTGCATCTTGACTACGGG - Intergenic
1023712704 7:43011898-43011920 CACTGGGGCCTCTTGAAGGGTGG - Intergenic
1024010742 7:45264503-45264525 CACTGCTGTATCTTGATTGTGGG - Intergenic
1026425827 7:70292422-70292444 CACTTCTGACTCCTGAATACAGG - Intronic
1026761621 7:73131122-73131144 CACTGCAGCCTCTTAACTCCTGG - Intergenic
1027037961 7:74939938-74939960 CACTGCAGCCTCTTAACTCCTGG - Intergenic
1027085600 7:75261537-75261559 CACTGCAGCCTCTTAACTCCTGG + Intergenic
1027419561 7:78006127-78006149 TCCTGCTGCCTTTTGAATGGAGG + Intergenic
1028920821 7:96308075-96308097 CACTGCAACCTCTTGAACCCTGG - Intronic
1031336056 7:120534126-120534148 CACTTCTGCCCCTTGAATGTAGG + Intronic
1032172955 7:129600948-129600970 TCCTGCTGCCTCTTGAATTCTGG + Intergenic
1033493031 7:141863081-141863103 CACCGCTGCCCCTTTTATGCTGG + Intergenic
1033889440 7:145991863-145991885 CACTGCTTCGTGTTGAATCCTGG + Intergenic
1034432221 7:151046770-151046792 CACTGCTGCCTCTTCCAGGCTGG - Intronic
1035380013 7:158431942-158431964 CACTGCTGGCACTTGAGGGCTGG - Intronic
1037448063 8:18987735-18987757 CACTGCTGCCTCTTGGGCTCAGG - Intronic
1038047140 8:23775040-23775062 CAGTGCTGCCTCTTATATCCAGG - Intergenic
1038094920 8:24297693-24297715 CCCTGCTGCCTCCTTAATTCAGG - Intronic
1038628587 8:29218818-29218840 TAGTGCTGTCTCTTGAGTGCAGG - Intronic
1039376707 8:37041732-37041754 CCCTGCTTCCCCTTGAATGCAGG - Intergenic
1040074750 8:43218378-43218400 CACTGCAGCCTCTTGACTCCTGG + Intergenic
1040963898 8:53064883-53064905 CACTGCTGACTCTTGTCTGCTGG - Intergenic
1042710967 8:71716743-71716765 CACTGCTTCATCTTGAGTCCAGG + Intergenic
1043373641 8:79622801-79622823 CACTGAGGTCTTTTGAATGCAGG + Intronic
1045373444 8:101548420-101548442 CATTGCTTCCTCTGGAAAGCTGG - Intronic
1045473057 8:102529405-102529427 CACTGCTGCCTCTGGACTGTGGG - Exonic
1047769625 8:128020444-128020466 CACTGCTGGCTCTGAAATGTGGG + Intergenic
1048467664 8:134680568-134680590 CAGTGCTGCATCTTGACTGCAGG + Intronic
1048915300 8:139177333-139177355 CACTGCCTCCTCTGGATTGCTGG - Intergenic
1050158242 9:2690629-2690651 CATTGCTGACTCCTGAATGTGGG - Intergenic
1051777089 9:20646767-20646789 CACTTCAGCCTCTTAAAGGCTGG + Intergenic
1052519285 9:29523741-29523763 TATTGCAGCTTCTTGAATGCTGG - Intergenic
1052788901 9:32855719-32855741 CACTGTTACCTCTTAAATGGTGG - Intergenic
1056249441 9:84732986-84733008 CTGTGCTGCCTCTGGACTGCAGG + Intronic
1057122812 9:92592321-92592343 CACTGCTGGCTCCTGACAGCAGG + Intronic
1059008358 9:110428953-110428975 CACTTCAGCCTCCTGAGTGCAGG - Intronic
1059767514 9:117397584-117397606 CAAGGCTGCCTCTTGGAGGCTGG - Intronic
1060407414 9:123379717-123379739 CACTGCTGCCTCTTCACTTGTGG - Exonic
1061289286 9:129641699-129641721 CACTCCTGCCCCTTGCATGGCGG - Intronic
1061506270 9:131033570-131033592 CACAGCTTCCTCTTGACTTCTGG - Intronic
1190395120 X:49974606-49974628 CACTTCTGCCTCTTAAGGGCTGG - Intronic
1190754682 X:53391238-53391260 CACTGCAGCCTCTTGCCTCCTGG - Intronic
1192239824 X:69320209-69320231 CACTGCTGGCTCCTGACTCCTGG + Intergenic
1193440295 X:81532636-81532658 CACTGCTGCCTTTTGGAGGGAGG + Intergenic
1193821664 X:86172633-86172655 CTATGCTGTCTCTTGAATGATGG + Intronic
1194279522 X:91931985-91932007 CACTGAGGCCTCTTGAGGGCGGG - Intronic
1194302070 X:92200985-92201007 CACTGCAGCCTCCAAAATGCTGG + Intronic
1195941656 X:110172599-110172621 CACTGATGCCTCTGGAATCTGGG - Intronic
1197641623 X:128974500-128974522 CCCTTCTGCCTCTTGTATTCTGG - Intergenic
1198145085 X:133847990-133848012 CAATGCTGCCACTTCAATGAAGG + Intronic
1198643995 X:138786663-138786685 CATTGCTGCCTCTGGCTTGCTGG - Intronic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic
1200286185 X:154824794-154824816 CACCTCTGCTTCTGGAATGCTGG + Intronic
1200596999 Y:5155476-5155498 CACTGAGGCCTCTTGAGGGCGGG - Intronic