ID: 1092239536

View in Genome Browser
Species Human (GRCh38)
Location 12:6828524-6828546
Sequence GTCCCCGGGGGCGCCCCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 212}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092239517_1092239536 14 Left 1092239517 12:6828487-6828509 CCCCGGGGTCCCCTGAGCCCCCC 0: 1
1: 1
2: 0
3: 42
4: 445
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239523_1092239536 3 Left 1092239523 12:6828498-6828520 CCTGAGCCCCCCGGCCTGACCCA 0: 1
1: 0
2: 2
3: 38
4: 444
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239518_1092239536 13 Left 1092239518 12:6828488-6828510 CCCGGGGTCCCCTGAGCCCCCCG 0: 1
1: 2
2: 6
3: 49
4: 466
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239516_1092239536 15 Left 1092239516 12:6828486-6828508 CCCCCGGGGTCCCCTGAGCCCCC 0: 1
1: 1
2: 5
3: 55
4: 484
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239525_1092239536 -4 Left 1092239525 12:6828505-6828527 CCCCCGGCCTGACCCAGCTGTCC 0: 1
1: 0
2: 2
3: 25
4: 283
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239522_1092239536 4 Left 1092239522 12:6828497-6828519 CCCTGAGCCCCCCGGCCTGACCC 0: 1
1: 0
2: 3
3: 40
4: 396
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239515_1092239536 18 Left 1092239515 12:6828483-6828505 CCTCCCCCGGGGTCCCCTGAGCC 0: 1
1: 0
2: 3
3: 39
4: 511
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239521_1092239536 5 Left 1092239521 12:6828496-6828518 CCCCTGAGCCCCCCGGCCTGACC 0: 1
1: 0
2: 2
3: 19
4: 302
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239519_1092239536 12 Left 1092239519 12:6828489-6828511 CCGGGGTCCCCTGAGCCCCCCGG 0: 1
1: 0
2: 5
3: 64
4: 487
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239527_1092239536 -6 Left 1092239527 12:6828507-6828529 CCCGGCCTGACCCAGCTGTCCCC 0: 1
1: 0
2: 5
3: 67
4: 508
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239524_1092239536 -3 Left 1092239524 12:6828504-6828526 CCCCCCGGCCTGACCCAGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 284
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239526_1092239536 -5 Left 1092239526 12:6828506-6828528 CCCCGGCCTGACCCAGCTGTCCC 0: 1
1: 0
2: 1
3: 40
4: 376
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212
1092239528_1092239536 -7 Left 1092239528 12:6828508-6828530 CCGGCCTGACCCAGCTGTCCCCG 0: 1
1: 0
2: 1
3: 29
4: 359
Right 1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG 0: 1
1: 0
2: 2
3: 24
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092239536 Original CRISPR GTCCCCGGGGGCGCCCCCGC AGG Exonic
900471821 1:2858842-2858864 GGCCACTGGGGCGTCCCCGCTGG - Intergenic
901007898 1:6180464-6180486 GGACCGGGGGGCGCCCCGGCAGG + Intergenic
901242863 1:7704951-7704973 CGCCCCGCGCGCGCCCCCGCCGG - Intronic
903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG + Intergenic
904822672 1:33256012-33256034 GGCCCCGGGAGCCCCCGCGCTGG + Intergenic
905417071 1:37811238-37811260 GTGCCCCAGGGCGCCCCCTCAGG - Exonic
905617103 1:39408919-39408941 CTCCCCGGCCCCGCCCCCGCCGG + Intronic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906365381 1:45205875-45205897 GCCCCCGGGGGCGTCGCGGCTGG - Exonic
906614601 1:47225692-47225714 GGCCCGGGGGGCGGCCCTGCCGG - Exonic
907341454 1:53738816-53738838 GTCCCCGGGCGTGCCTCGGCGGG - Intergenic
909657416 1:78046461-78046483 TTCCCCCGGGACGCCCCCGGCGG - Intronic
918282919 1:183023406-183023428 CTCCCCGGGGGCGCGCACTCGGG + Intergenic
920660569 1:207911052-207911074 GTCCGCAGGGGCGCGCGCGCAGG - Exonic
921909166 1:220528601-220528623 TACCCCGGCGGCGCCGCCGCGGG + Exonic
1064028811 10:11870003-11870025 GCCCCCTGGGGCCCCCTCGCCGG - Exonic
1066370204 10:34814216-34814238 GTTCCCGGGAGGGCCACCGCTGG - Intronic
1069984219 10:72273033-72273055 GACCCGGGGGGCGCCCGGGCAGG + Intergenic
1072654296 10:97319648-97319670 GCCCCCGGGGGCGCCGCTGCGGG + Exonic
1072656590 10:97334356-97334378 GCCCCCGGGGGTGCCGCTGCGGG - Exonic
1072903579 10:99430663-99430685 GGCCGCGGGCCCGCCCCCGCCGG - Intergenic
1073414267 10:103368212-103368234 GGCACCGGGGCCGCCCCCGCCGG - Exonic
1075801986 10:125159837-125159859 GCCCCCGGGCGCGCACCCACCGG + Intronic
1076344733 10:129772623-129772645 GTCCCGGGGAGCGCCCGCCCCGG - Intergenic
1076872046 10:133199044-133199066 GGCCCCGGGGCCACCCCTGCCGG + Exonic
1076996613 11:300124-300146 GTCCCTGGGGGTTCCCCTGCCGG - Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077044140 11:537043-537065 GTCCTCGGGGGCGCTTCCCCCGG + Intronic
1077214595 11:1390163-1390185 GCCCGCGGGGGCGCCCCGGCCGG + Intronic
1083933355 11:65857849-65857871 GTCCGCGCGGGCGCACCAGCGGG + Intronic
1083997220 11:66278415-66278437 GGCCCGGGGGGCGCCAGCGCGGG - Exonic
1085239835 11:75044128-75044150 GTCCTCGGGGGCTGACCCGCAGG - Intergenic
1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG + Exonic
1096980969 12:55728239-55728261 GTCCTGGGGGGCGCGCCGGCAGG - Intronic
1102068159 12:109996098-109996120 TACCCCGGGGCCGCCCCCTCAGG - Intronic
1102256428 12:111418196-111418218 CTCCCCGGCGGCGGCCCCGCGGG + Exonic
1103813346 12:123633566-123633588 GTCCCCTGGGGCTCCGCAGCAGG - Exonic
1104475457 12:129067259-129067281 GTCCCCGTGAGCGCCCCCTCAGG - Intergenic
1105409789 13:20161603-20161625 GTGCCCGGCGGCGCTTCCGCGGG - Intergenic
1113803244 13:113097035-113097057 GTCTCCGGGGAAGCCCCAGCGGG - Exonic
1115235834 14:31207807-31207829 TCCCCCGGCGGCGACCCCGCCGG + Intergenic
1117478378 14:56118998-56119020 GTGCCCGGCGCTGCCCCCGCTGG - Intronic
1119319190 14:73719265-73719287 GTCCCCGCTGGGACCCCCGCGGG - Exonic
1121546978 14:94769857-94769879 GTCCGAGGAGGCGCCGCCGCTGG + Exonic
1122230757 14:100305531-100305553 GTCCCCGGGAGGGCCCGGGCGGG - Intronic
1122264099 14:100538670-100538692 GGCCGCGGTGGCGGCCCCGCTGG - Exonic
1122768205 14:104085631-104085653 CTCCCCGTGGGTGCCCCCGCCGG + Intergenic
1125518969 15:40337847-40337869 GCCTCCGGGGGCTCCCCCACCGG + Exonic
1125742027 15:41972147-41972169 GTCCCCGAGGTCGCGCCGGCCGG + Intronic
1128153540 15:65377852-65377874 GGCCCCGGCGCCGGCCCCGCGGG - Exonic
1130261157 15:82355347-82355369 GGCTCCCGGGGCTCCCCCGCGGG - Intergenic
1130280078 15:82513671-82513693 GGCTCCCGGGGCTCCCCCGCGGG + Intergenic
1130471453 15:84229857-84229879 GGCTCCCGGGGCTCCCCCGCGGG + Intergenic
1130478947 15:84344428-84344450 GGCTCCCGGGGCTCCCCCGCGGG + Intergenic
1130492823 15:84443703-84443725 GGCTCCCGGGGCTCCCCCGCGGG - Intergenic
1130593747 15:85234484-85234506 GGCTCCCGGGGCTCCCCCGCGGG + Intergenic
1130613310 15:85380771-85380793 GGCTCCCGGGGCTCCCCCGCGGG - Exonic
1131257486 15:90871822-90871844 GGCCCCGGGGCCGGCCCCGAGGG + Intronic
1132483993 16:180897-180919 GTCCCCGGGAGGGCCCCGGCGGG + Intronic
1132499841 16:280449-280471 GGCACCCGGGTCGCCCCCGCCGG - Intronic
1132508559 16:325068-325090 GTTTCCTGGGGCGCGCCCGCGGG - Intronic
1132512753 16:352464-352486 GCCCCGGGCCGCGCCCCCGCCGG - Exonic
1132762959 16:1519865-1519887 GGCCCCGGGGGCACACCTGCGGG + Exonic
1132851626 16:2027299-2027321 CTCCCCGCGGGAGCCCCCTCGGG - Intronic
1132863381 16:2082303-2082325 GGCCCCGTGCGCGCCCCTGCCGG + Intronic
1132897929 16:2237677-2237699 GACCCCCGGGGCGCGCCTGCAGG - Intronic
1132925969 16:2429317-2429339 CTGCCCGGGGGGGCCGCCGCCGG - Intergenic
1134134203 16:11668709-11668731 GTTCCAGGGGCCGCGCCCGCGGG + Intronic
1136146777 16:28320830-28320852 CTCCCCAGGGGCCCCCCGGCCGG + Exonic
1136707757 16:32202881-32202903 GTCCCTGGGGGGGCCGGCGCGGG - Intergenic
1136760152 16:32726530-32726552 GTCCCTGGGGGGGCCGGCGCGGG + Intergenic
1136807952 16:33143856-33143878 GTCCCTGGGGGGGCCGGCGCGGG - Intergenic
1136912979 16:34159503-34159525 GTCCCCGGGCGCGCGCCTTCCGG + Intergenic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1138561378 16:57802615-57802637 CAGCCCGGGCGCGCCCCCGCAGG + Intronic
1139391712 16:66609614-66609636 GACCCCAGGGGGGCCCCAGCAGG - Intronic
1139473797 16:67192425-67192447 AACCCCGGGGGCGGCCCAGCTGG + Intronic
1139545673 16:67648513-67648535 GACCCCGGCCACGCCCCCGCGGG + Intronic
1139602156 16:67993437-67993459 ATCCCCAAGGGCGCTCCCGCCGG + Exonic
1140096879 16:71883606-71883628 GACGCCGGGGCCGTCCCCGCCGG + Intronic
1141168882 16:81678641-81678663 GGCCCCGGGGGCGGGCACGCGGG - Intronic
1142699074 17:1648811-1648833 GTTCCCTGGGGCGCCTGCGCCGG + Exonic
1143223728 17:5282621-5282643 GGCCCCGGGGGTGACCCCGCCGG + Intronic
1143513575 17:7408317-7408339 GCCGCCCGGGGCGCCGCCGCCGG - Exonic
1146054925 17:29576256-29576278 GTCCCCAGGGGGGCCCCCAAAGG + Exonic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146183018 17:30709288-30709310 GGCAGCGGGGGCGCCCCTGCAGG - Intergenic
1146433659 17:32822629-32822651 GTCCCGGGGGGTGGCCGCGCGGG + Intronic
1147164692 17:38586985-38587007 CTCCCCGGGTGCCCACCCGCAGG - Intronic
1147741766 17:42674201-42674223 GTCCCGGGGGGCGGTCCGGCTGG - Intronic
1148209625 17:45800365-45800387 GGCCCTGGGGGAGGCCCCGCAGG - Intronic
1148807866 17:50273291-50273313 GCTCCCGGGGGCACCCGCGCTGG + Intronic
1148848367 17:50541951-50541973 GAGCCCAGGGGCGCCCCCACAGG - Exonic
1149610581 17:57955497-57955519 GGGCCCGGGGGCGCCGCAGCCGG - Intergenic
1150250222 17:63700640-63700662 GGCTCCGGGGTCGCCCCGGCTGG - Intronic
1150798418 17:68259176-68259198 GTCCCCGGCTGCGCCCAGGCCGG + Exonic
1151293318 17:73165695-73165717 ATCTCCGGGTGCGCTCCCGCAGG - Intronic
1152357339 17:79813530-79813552 GCCGCCGGGCGCCCCCCCGCCGG - Intergenic
1152389079 17:79992195-79992217 CTCCCCGGGGTGCCCCCCGCTGG + Intronic
1152697418 17:81804072-81804094 GGGCTCGGGGGCGGCCCCGCGGG - Intergenic
1152725266 17:81942003-81942025 GTCCCCTGTGGAGCCCCTGCCGG + Intronic
1152797234 17:82314437-82314459 GGCCCCGGGGGAGACCCAGCTGG - Intergenic
1153514477 18:5891333-5891355 GCCCCGGGGGGCGCCGCGGCGGG + Exonic
1153805725 18:8706736-8706758 GTGTCCCGGGGCGCCCCCGGAGG + Intronic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1155199345 18:23503583-23503605 GCCCCCGGGGCCCCCGCCGCGGG + Exonic
1155507536 18:26548084-26548106 GTCCCCGGGCGGCCCACCGCGGG + Intronic
1156245139 18:35290494-35290516 GTGCCCGGGAGCGACCCCGGGGG - Intergenic
1156350701 18:36298535-36298557 GTCCCCGGCGGCGCCCCCGGGGG - Intronic
1160948062 19:1652488-1652510 TGCCCCAGGGGCGCCCCGGCCGG - Intronic
1161396563 19:4047777-4047799 GGCCCCGGGGCCGCCACCGACGG - Exonic
1161779034 19:6279442-6279464 GTCCCCAGGGGCGTCCCAGGTGG + Intronic
1162039347 19:7960367-7960389 TTCCTCGGGGGCCCGCCCGCAGG - Exonic
1162746610 19:12802080-12802102 GACCCCGGGGGCGCTGCTGCTGG + Intronic
1163154519 19:15432592-15432614 CTGGGCGGGGGCGCCCCCGCGGG + Intronic
1163288850 19:16365578-16365600 GTCCCCCAGGGTGCCCCTGCCGG - Intronic
1163607070 19:18281370-18281392 GTTCCCCGGGGCGCCCCCGACGG - Exonic
1165426212 19:35746789-35746811 GTCCCCAAGGGCACCCCAGCGGG - Exonic
1166045317 19:40226490-40226512 GTCCCCGACGGCTTCCCCGCGGG - Exonic
1166139683 19:40799360-40799382 CTTCCCGGGGTCGCCCCGGCAGG - Intronic
1166682618 19:44778125-44778147 ACCCCCGGGGCCGCCTCCGCCGG - Exonic
1166759477 19:45215766-45215788 GTCCCCTGCGGCTCCCCTGCGGG + Intronic
1166995116 19:46716413-46716435 GTCCCCCGGGGCCCCCCGGCCGG - Exonic
1167129155 19:47573085-47573107 GCCCCCGGGGGCTCGCGCGCCGG + Intergenic
1167239410 19:48334256-48334278 GCCCCCGGGGTCACCCCCGCTGG + Intronic
1168293005 19:55366123-55366145 GGACCCGCCGGCGCCCCCGCTGG - Exonic
926101742 2:10122493-10122515 GTCCCGGGGGGCGTCCACGGGGG + Exonic
926101748 2:10122505-10122527 GTCCACGGGGGTGTCCCCGGGGG + Exonic
927720069 2:25376875-25376897 GCCCCCGGCGGCGCGCCCCCTGG + Intergenic
928303719 2:30147928-30147950 GGGCCCGCGAGCGCCCCCGCCGG - Intronic
929452705 2:42047876-42047898 GTCCTCGGCGCCGCCCCCTCCGG - Intergenic
932887516 2:75560828-75560850 GACCCCGGCGGCCCCTCCGCCGG - Intronic
934846392 2:97663784-97663806 GCCCCCGGGGGCGCACGCGGCGG - Intronic
937241748 2:120466378-120466400 GTCCCCAGCCACGCCCCCGCAGG - Intergenic
937907429 2:127059035-127059057 GGCCCCGGGCGTGGCCCCGCCGG + Exonic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
942449591 2:176100527-176100549 CTCCCCGGGGCCGCCCCCCACGG - Exonic
948370599 2:237487115-237487137 GACACCTGGGGCGCCCGCGCGGG - Intronic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
949046955 2:241876734-241876756 GGCCCCGGGGGCGCAACTGCAGG + Intergenic
1168777750 20:462282-462304 GCCCCCCGGGCCGCCCTCGCAGG + Intronic
1171217974 20:23365938-23365960 GACCCCTGGGGCGCCCCTGCTGG + Intronic
1171767996 20:29300702-29300724 GTCCCCGGGCGCGCGCCTTCAGG - Intergenic
1171810697 20:29742928-29742950 GTCCCCGGGAGCGCGCCTTCAGG - Intergenic
1172126200 20:32626758-32626780 GTCCCCAGGGCCTCCCCCACAGG + Intergenic
1176029423 20:63004949-63004971 GTCCCCGGGGGCACCCTGCCCGG + Intergenic
1176156799 20:63626380-63626402 ATCCCCAGGGGCCACCCCGCAGG - Intronic
1176156816 20:63626424-63626446 ATCCCCAGGGGCCACCCCGCAGG - Intronic
1176235068 20:64050115-64050137 GTCCCCAGGGGCGCCCATGCTGG + Intronic
1176548423 21:8211770-8211792 GTCCCCGGCAGCGGCCCCGACGG + Intergenic
1176550186 21:8217409-8217431 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1176567354 21:8394805-8394827 GTCCCCGGCAGCGGCCCCGACGG + Intergenic
1176569114 21:8400447-8400469 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1176577028 21:8444679-8444701 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1178610300 21:34073775-34073797 GGCAGCGGGGGCGCCCGCGCGGG - Intronic
1179245036 21:39625699-39625721 GTCCCTGTGTGCGCCCCTGCGGG - Intronic
1180791769 22:18578566-18578588 GTTCGCGGGGGTGCGCCCGCGGG - Intergenic
1180795890 22:18605143-18605165 TTCCCCGAGGGCATCCCCGCAGG - Intergenic
1181225834 22:21390128-21390150 TTCCCCGAGGGCATCCCCGCAGG + Intergenic
1181229967 22:21416743-21416765 GTTCGCGGGGGTGCGCCCGCGGG + Intergenic
1181235795 22:21446983-21447005 CTCCCCGCGGGGGCCACCGCAGG + Exonic
1181248682 22:21518123-21518145 GTTCGCGGGGGTGCGCCCGCGGG - Intergenic
1181252799 22:21544685-21544707 TTCCCCGAGGGCATCCCCGCAGG - Intergenic
1181574865 22:23787286-23787308 CTCCCCGGGCTCGGCCCCGCGGG + Intronic
1182103668 22:27674130-27674152 GTCCCCGGGGGGCCTCCCCCGGG - Intergenic
1183788366 22:40045073-40045095 GTCGGCGAGGGCGCCCCCGGGGG + Intronic
1184184662 22:42856864-42856886 GTTCCCGGGGGCGGCGGCGCGGG - Intronic
1184568860 22:45309845-45309867 GTCCCCGGAGGCCCCGCCCCGGG - Intronic
1185259360 22:49853314-49853336 GTCCCCCGGGGGGGCCGCGCGGG + Intergenic
1185379985 22:50503837-50503859 GTCCCTGGGGGACCCCACGCTGG - Exonic
1203255081 22_KI270733v1_random:133747-133769 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1203263137 22_KI270733v1_random:178826-178848 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
950487810 3:13283118-13283140 GGCCCCGGGGGCGGCGCCGGCGG - Intergenic
950683915 3:14603024-14603046 GGCCCCGGCCCCGCCCCCGCCGG + Intergenic
952764690 3:36944409-36944431 TGCCCCGGGGGCGCGCTCGCTGG + Intronic
953447376 3:42979620-42979642 GTCCCCGGCGGTGCCCCGGCCGG - Exonic
955325924 3:58009203-58009225 GTCCCCGGGGGCGGGCCCTAGGG + Intronic
961252560 3:125519741-125519763 GCCTGCGGGGGCGCCCCCCCGGG + Intronic
961252561 3:125519742-125519764 ACCCGGGGGGGCGCCCCCGCAGG - Intronic
961322362 3:126084367-126084389 GGCCCCACTGGCGCCCCCGCGGG + Intronic
964622614 3:158732297-158732319 GACCCCGCGGGCGCCGCCACCGG + Exonic
968556415 4:1248407-1248429 GTCGCCGGCGGCCTCCCCGCGGG + Intronic
968764730 4:2462470-2462492 GGCCCCGGCGGCGCCCTCGCAGG + Exonic
968879945 4:3293431-3293453 CTGCCCGGCGCCGCCCCCGCGGG - Intronic
969239169 4:5888121-5888143 GCCTCGGGGGGCGCCCCTGCCGG + Intronic
969436869 4:7193571-7193593 CTCCGCGGTGGCGCCTCCGCAGG + Intronic
983923468 4:173371344-173371366 GCCCCCGGGGGCGGCCGGGCCGG + Exonic
985576954 5:677988-678010 GTCCCCGGGGGACCCCTCGAAGG - Exonic
985591874 5:770041-770063 GTCCCCGGGGGACCCCTCGAAGG - Intergenic
985688504 5:1294544-1294566 GGCCTCGGGGGGGCCCCCGCGGG + Exonic
989178734 5:38556250-38556272 GTCCCCAGGGGCGGCCCGGGCGG - Intronic
993900929 5:93584137-93584159 GTCCCGGCGGGAGCCCTCGCCGG - Exonic
998385250 5:141753661-141753683 GGCCCCGGGGGCTCCCGGGCTGG + Intergenic
1002763287 6:218216-218238 GTCCCCGGGGCCTCCCCAGCAGG - Intergenic
1002775166 6:322403-322425 GTACCCTGAGGCGCCCCTGCAGG - Intronic
1002898110 6:1390711-1390733 GTGGCTGGGGGCGCCCGCGCCGG - Exonic
1006145793 6:31958921-31958943 GTCTCCGGCCGCGCCCGCGCTGG + Exonic
1006814314 6:36840033-36840055 GCCCCTGCGGGCGCCCCCTCTGG - Intergenic
1006983973 6:38165944-38165966 ATCCCGGGGGGCCCCCCCGCAGG - Intergenic
1008932451 6:56954888-56954910 GCCCCCGGGCGCAGCCCCGCCGG + Intergenic
1013152466 6:107459625-107459647 GTACCCGAGAACGCCCCCGCAGG + Intergenic
1013167163 6:107604690-107604712 GTCACTGGGGGCGCCCTCACAGG - Intronic
1013459005 6:110357958-110357980 CCCCGCGCGGGCGCCCCCGCCGG - Exonic
1014632534 6:123803916-123803938 GGCCCCGAGCGCGCCTCCGCAGG + Intergenic
1017793584 6:157822932-157822954 TTCCCCTGGGGCGGCCACGCAGG + Intronic
1017954827 6:159169301-159169323 GTCGCCCGGGTCGCCCCCGCCGG + Intergenic
1019537524 7:1537076-1537098 GTAGCCGGGGGCGCCCCAGGAGG - Intronic
1019711472 7:2520003-2520025 GGCGCCGGGGCAGCCCCCGCGGG - Exonic
1019922158 7:4169806-4169828 GTGCCCAGGGGCCCTCCCGCAGG - Intronic
1021104052 7:16616738-16616760 CTCCCCAGGCGCGCCTCCGCTGG - Intronic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1025813139 7:64888157-64888179 GGCCCCGGGGGCTCCCCAGGTGG - Intronic
1031483463 7:122304113-122304135 GGCCCCGGCGGCGCCCGCGGCGG - Exonic
1032013468 7:128361309-128361331 CTCCCCGGGGTCTCTCCCGCAGG + Exonic
1034899223 7:154897201-154897223 GACCCCTGGGGAGCCCCAGCAGG - Intergenic
1035453998 7:158997281-158997303 TTCCCCTGGGCAGCCCCCGCGGG + Intergenic
1049509252 8:143019285-143019307 GGCCCCAGGGGCGCCCCCCACGG + Intronic
1049613696 8:143567359-143567381 GTGCCCGGGGCTGCCCCCGCGGG - Exonic
1049645503 8:143733969-143733991 GTCTCCGGGCGCGCGGCCGCAGG - Intergenic
1049687324 8:143944193-143944215 GTCCCCGCGGCCACACCCGCCGG + Intronic
1049762196 8:144336651-144336673 GCCCCCGGGGGCGGCGGCGCCGG + Intergenic
1052740068 9:32384512-32384534 GAGCCTGCGGGCGCCCCCGCGGG - Intergenic
1053129225 9:35605674-35605696 GGCCCCGGGGGCCCCTCCCCCGG - Exonic
1053313932 9:37036551-37036573 GTTCCCGAGGGGGCGCCCGCTGG + Intergenic
1053835332 9:42129305-42129327 GTCTCCGAGGTCGGCCCCGCGGG + Exonic
1057259746 9:93576939-93576961 GCCCCCGGCTGCGCGCCCGCAGG + Intronic
1059405835 9:114098085-114098107 AGCGCCGGCGGCGCCCCCGCGGG - Intronic
1060517994 9:124277754-124277776 GTTCACGGGAGCGCGCCCGCAGG + Intronic
1060991943 9:127854429-127854451 GTCCCCGTGCGAGCCCACGCCGG - Exonic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061540972 9:131277680-131277702 GGGGCCGGGGGCGCCCACGCCGG - Intergenic
1062277207 9:135736678-135736700 GGCCCGGGGGGCGCCCCAGCCGG + Intronic
1203471479 Un_GL000220v1:116884-116906 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1203479300 Un_GL000220v1:160856-160878 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1186463349 X:9765622-9765644 GTCCCCCGCGACGTCCCCGCCGG - Exonic
1196645886 X:118116909-118116931 GGCCCCGGCGGCGCCTGCGCGGG + Intronic
1199736898 X:150693621-150693643 GCCGCGGGGGGCGCCACCGCCGG + Exonic
1201308960 Y:12577232-12577254 GCCCCCGGGGGCTGACCCGCAGG - Intergenic