ID: 1092241223

View in Genome Browser
Species Human (GRCh38)
Location 12:6837621-6837643
Sequence GCTCTTGGGGGCAGTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 233}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092241223_1092241233 -3 Left 1092241223 12:6837621-6837643 CCCAGGACACTGCCCCCAAGAGC 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1092241233 12:6837641-6837663 AGCCCCGGGGTGGACGTGCACGG 0: 1
1: 0
2: 3
3: 14
4: 137
1092241223_1092241241 22 Left 1092241223 12:6837621-6837643 CCCAGGACACTGCCCCCAAGAGC 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1092241241 12:6837666-6837688 TGAGCCCACAGGGTGGCAGATGG 0: 1
1: 0
2: 6
3: 28
4: 295
1092241223_1092241246 30 Left 1092241223 12:6837621-6837643 CCCAGGACACTGCCCCCAAGAGC 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1092241246 12:6837674-6837696 CAGGGTGGCAGATGGGCACAGGG 0: 1
1: 0
2: 4
3: 61
4: 555
1092241223_1092241238 12 Left 1092241223 12:6837621-6837643 CCCAGGACACTGCCCCCAAGAGC 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1092241238 12:6837656-6837678 GTGCACGGCCTGAGCCCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 190
1092241223_1092241245 29 Left 1092241223 12:6837621-6837643 CCCAGGACACTGCCCCCAAGAGC 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1092241245 12:6837673-6837695 ACAGGGTGGCAGATGGGCACAGG 0: 1
1: 0
2: 11
3: 121
4: 944
1092241223_1092241242 23 Left 1092241223 12:6837621-6837643 CCCAGGACACTGCCCCCAAGAGC 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1092241242 12:6837667-6837689 GAGCCCACAGGGTGGCAGATGGG 0: 1
1: 0
2: 2
3: 22
4: 224
1092241223_1092241239 15 Left 1092241223 12:6837621-6837643 CCCAGGACACTGCCCCCAAGAGC 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1092241239 12:6837659-6837681 CACGGCCTGAGCCCACAGGGTGG 0: 1
1: 0
2: 1
3: 20
4: 196
1092241223_1092241237 11 Left 1092241223 12:6837621-6837643 CCCAGGACACTGCCCCCAAGAGC 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1092241237 12:6837655-6837677 CGTGCACGGCCTGAGCCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092241223 Original CRISPR GCTCTTGGGGGCAGTGTCCT GGG (reversed) Intronic