ID: 1092241566

View in Genome Browser
Species Human (GRCh38)
Location 12:6839236-6839258
Sequence CTGAGCTGACCCAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092241553_1092241566 13 Left 1092241553 12:6839200-6839222 CCCCCGAGAAGGCTCACAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG 0: 1
1: 0
2: 3
3: 46
4: 367
1092241557_1092241566 10 Left 1092241557 12:6839203-6839225 CCGAGAAGGCTCACAGTCGGTGA 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG 0: 1
1: 0
2: 3
3: 46
4: 367
1092241555_1092241566 12 Left 1092241555 12:6839201-6839223 CCCCGAGAAGGCTCACAGTCGGT 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG 0: 1
1: 0
2: 3
3: 46
4: 367
1092241556_1092241566 11 Left 1092241556 12:6839202-6839224 CCCGAGAAGGCTCACAGTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG 0: 1
1: 0
2: 3
3: 46
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092241566 Original CRISPR CTGAGCTGACCCAGGGAAGG TGG Intronic
900383295 1:2396228-2396250 CCGAGCTGACACGGGGCAGGTGG - Intronic
900524992 1:3124196-3124218 CTGGGCTGAGCCAGGGTACGAGG - Intronic
900604112 1:3516227-3516249 CTGAGCTGGCGCAGGGAGGCGGG + Intronic
900621579 1:3590071-3590093 CTGGCCTGGCCCAGGGGAGGGGG - Intronic
900645969 1:3708881-3708903 CTGAGCTGTGCCCGGGGAGGCGG - Intronic
901301068 1:8200473-8200495 CGGTGACGACCCAGGGAAGGAGG + Intergenic
902583323 1:17423039-17423061 CGCTGCTGCCCCAGGGAAGGAGG - Intronic
902817438 1:18924368-18924390 GTGGGCAGACCCAGGGAAGAGGG - Intronic
903212711 1:21827823-21827845 CTGAGCTGAAGCTGGGGAGGAGG + Intronic
903280549 1:22247607-22247629 GTCTGCTGACCCATGGAAGGTGG + Intergenic
903284399 1:22267950-22267972 CTCAGCTGGCCCAGGGCAGCAGG + Intergenic
904262503 1:29297781-29297803 CAGGACTGACCCAGGGAAGTCGG + Intronic
904421664 1:30398282-30398304 CTGAGGTGACCTGGGGATGGAGG + Intergenic
904983448 1:34525647-34525669 CCCAGGTGACCCAGGGGAGGAGG + Intergenic
905042666 1:34973182-34973204 CTGCGTTGACTCAGGGAAGGAGG - Intergenic
905286251 1:36882375-36882397 ATGAGCAGACCCAGGGCAGCTGG + Intronic
905402846 1:37716059-37716081 CTGAGCTCACCCTGGGAGGGAGG - Exonic
905464627 1:38143544-38143566 CTGGGCTGACCAAGGGCTGGTGG - Intergenic
905961733 1:42048677-42048699 CTGAGCTGAACCCTGGAAGCAGG + Intergenic
906109176 1:43312062-43312084 CTGAGCCGGCCAGGGGAAGGAGG + Exonic
906239829 1:44235996-44236018 GGGAGCTGAGCCAGGCAAGGCGG - Intronic
906468698 1:46108715-46108737 CTGTGCTAGCTCAGGGAAGGAGG - Intronic
906668500 1:47638425-47638447 CTGTGGTGGCCCAGGGAGGGAGG + Intergenic
906866388 1:49425057-49425079 CTGAAATGACCCAGGAAATGTGG + Intronic
907241859 1:53085316-53085338 CTGGGCTGAGCCAGGGAGGAAGG + Exonic
907406421 1:54256422-54256444 CTGCCCTGAACCAGGGAGGGTGG + Intronic
909495014 1:76268824-76268846 CTCAGCTGAGCCACGGAAGGTGG - Intronic
912372883 1:109187338-109187360 CCGAGCTGAGCAGGGGAAGGAGG + Intronic
912718650 1:112001708-112001730 CTGAGCTGAGCCTGGAAAGAAGG + Intergenic
912727259 1:112069232-112069254 CTGAGCTGAGCCTAGGGAGGGGG - Intergenic
913287602 1:117241149-117241171 AGGAGCTGGGCCAGGGAAGGAGG - Intergenic
913569319 1:120104461-120104483 CTGAGCTGGCCCAGGAGAGAGGG + Intergenic
916025154 1:160827245-160827267 CTGTGCTGACCCAGAGGAGCGGG - Intronic
918096550 1:181341020-181341042 CTGAGATCACACAGGTAAGGAGG + Intergenic
918340805 1:183566747-183566769 CAGAGCTGAACCTGGGAATGAGG - Intronic
919289126 1:195605788-195605810 ATGAGCTGATCCAAGGAAGCAGG - Intergenic
919840471 1:201605630-201605652 CTGAACTGACCCACAGAAAGGGG - Intergenic
921159612 1:212463731-212463753 CAGAGCTGAGCTGGGGAAGGGGG + Intergenic
921213773 1:212920723-212920745 CTGTGCTCTCCCAGGGAAGAGGG + Intergenic
921220741 1:212972039-212972061 CTGAGCTTTTCCAGGGAAGGGGG - Intronic
921436446 1:215129012-215129034 TTGCAGTGACCCAGGGAAGGAGG + Intronic
922176963 1:223204531-223204553 CTGAGCTGACGCAGCTGAGGGGG - Intergenic
922478572 1:225923535-225923557 TTGAGCTGCCCAAGAGAAGGTGG + Intronic
923071198 1:230565975-230565997 TTGACCAGACCCAGGGAAAGAGG + Intergenic
923139277 1:231147518-231147540 CTCTCCTGACCCAGGGATGGAGG + Intergenic
1062897605 10:1116235-1116257 CAGAGATGACCCAGGGCAGGGGG - Intronic
1063071516 10:2671331-2671353 CGGAGATGACACAGGGAAAGAGG - Intergenic
1063897757 10:10700250-10700272 ATGAGCAGCCCCAGGGAAGAGGG + Intergenic
1064289846 10:14023501-14023523 CTGCGCTGCCCCCGGGAAGGCGG - Intronic
1064658491 10:17580588-17580610 CTGACATGCCCCAGGGAAGATGG - Intergenic
1065195155 10:23257210-23257232 GTGAACTGCCCCAGGGAAGAGGG + Intergenic
1065276576 10:24092199-24092221 TTCAGCTGACACAGGGAAGCAGG - Intronic
1067060511 10:43075921-43075943 CTGAGCTCAGCCAGGCAAGAGGG + Intergenic
1067563116 10:47317703-47317725 CAGAGCTGTCCCAGGGGTGGGGG + Intergenic
1069832429 10:71289468-71289490 CAGAGCTGACGCAGGGCAGCGGG - Intronic
1070494918 10:77012725-77012747 CTCAGCTGACCACTGGAAGGGGG + Intronic
1070612112 10:77940519-77940541 CAGAGGTGACCCAGGGAGTGGGG - Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1072359036 10:94640619-94640641 GTGAGCTGAAGCAGGGTAGGGGG - Intergenic
1072784992 10:98273362-98273384 CTGAGCTTCCCCAGGCAAGGAGG - Intergenic
1072956039 10:99888775-99888797 TTGAGATGACCCTGGGAAGGGGG + Intronic
1073156915 10:101354398-101354420 CGGAGCGGACCCAGGGGTGGGGG + Intronic
1075069869 10:119313723-119313745 CTGGTGTGACCCAGGGGAGGTGG - Intronic
1075255925 10:120926107-120926129 CTTAGCTGCTCCTGGGAAGGAGG + Intergenic
1075344660 10:121673371-121673393 CTGGGCTTACCCAGGGAGGAGGG - Intergenic
1075516030 10:123109014-123109036 GAGAGCTGCCCCAGGGAAGCTGG - Intergenic
1076014420 10:127015940-127015962 CTGTCCTCACCCAGGGGAGGTGG - Intronic
1076196032 10:128519011-128519033 CTCTGCTGAGGCAGGGAAGGAGG + Intergenic
1076674869 10:132142551-132142573 CTAAGGTGAGCCAGGGAAGTGGG - Intronic
1076698485 10:132258152-132258174 CTGACCTGACCTAGAGAGGGGGG + Intronic
1077077833 11:709253-709275 GGGATCTGGCCCAGGGAAGGAGG + Intronic
1077111510 11:864157-864179 CTGGGTTGCCCCAGGGATGGGGG + Intronic
1077220578 11:1413734-1413756 CTGAGCTGAGCCTGGGGTGGTGG + Intronic
1077257971 11:1597564-1597586 GAGAGCTGAGCCATGGAAGGAGG + Exonic
1077407858 11:2390717-2390739 CTGGTCTGAGCCAGGGCAGGGGG + Intronic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1077660718 11:4066172-4066194 CAGAGCTAACCCAGGGAAGCTGG - Intronic
1078363845 11:10691062-10691084 GTGAGGTGACCCAGGAGAGGAGG + Intronic
1080550989 11:33374111-33374133 CGGAGCAGAGGCAGGGAAGGAGG - Intergenic
1081154861 11:39677480-39677502 CTGAGCCTAGCGAGGGAAGGAGG + Intergenic
1083292658 11:61698577-61698599 GTGAGCTTCCCCAGGGAAGCAGG - Intronic
1084117418 11:67050294-67050316 CTGAGCTCACCCAGGCCAGCAGG + Exonic
1084804015 11:71566328-71566350 GAGAGCTGAGCCATGGAAGGAGG - Exonic
1085313235 11:75528402-75528424 CTCATCTGACCCAGCTAAGGAGG - Intergenic
1088116504 11:106318696-106318718 ATTAGCTGACCAAGGGAAAGGGG + Intergenic
1088231543 11:107678111-107678133 CTGAGCTGAGCCAGAAAAGCTGG - Intergenic
1089026744 11:115278768-115278790 CTGGCCTGAACCAGGGAGGGAGG + Intronic
1089556922 11:119320165-119320187 CGCACCTGACCCAGGGCAGGAGG + Intronic
1089613056 11:119680391-119680413 CTGTACTGACCCAAGGCAGGGGG + Intronic
1090080423 11:123608906-123608928 CTGAGGTGGCCGAGGGAAGGAGG - Intronic
1090228442 11:125085306-125085328 AGGGGCTGACTCAGGGAAGGTGG - Intronic
1090449779 11:126796328-126796350 CTGGGCTGACCCAGGGCATCAGG + Intronic
1091205698 11:133819339-133819361 CTGGGCTGACCCATAGACGGCGG + Intergenic
1091318471 11:134632672-134632694 CTGAGCTCATGCTGGGAAGGTGG + Intergenic
1091453141 12:586215-586237 CTGAGCAGATCCTGGGAAGCTGG + Intronic
1091794193 12:3287972-3287994 CTGAGATGACCCGGGGGGGGGGG + Intergenic
1092241566 12:6839236-6839258 CTGAGCTGACCCAGGGAAGGTGG + Intronic
1092773759 12:11922870-11922892 CACACCTGACCCAGGGATGGGGG + Intergenic
1093820268 12:23607980-23608002 CTGAGCTGAGCCAGGTGTGGTGG + Intronic
1094500679 12:31018288-31018310 CTGAGTGGGCCTAGGGAAGGAGG + Intergenic
1096100853 12:48969825-48969847 CTGAGCGGAGGCAGGAAAGGGGG + Intronic
1096602652 12:52741461-52741483 CAGAGCTGAAGCAGGGAATGGGG + Intergenic
1096627958 12:52906771-52906793 TAGCCCTGACCCAGGGAAGGGGG + Intronic
1097009873 12:55945300-55945322 CTGAGATTACCCAGAGAAAGAGG + Intronic
1097226152 12:57477798-57477820 CTGAGGTGACCCAGGGTACTGGG + Intronic
1097691911 12:62741565-62741587 CTGAGCTGACTCAGAGAAATGGG - Intronic
1097960971 12:65531704-65531726 CTGAGCTAACCCAGGGTAAGGGG - Intergenic
1098312172 12:69159030-69159052 CTGAGCTGGCCCAGGTGAGGTGG - Intergenic
1099719384 12:86341692-86341714 CTGAGCCAACCCAGGGCAGATGG + Intronic
1100457766 12:94768788-94768810 GTGAATTGTCCCAGGGAAGGAGG + Intergenic
1100677524 12:96884256-96884278 CTGAGATTGCCCAGGGAAGAGGG - Intergenic
1101236106 12:102791991-102792013 GTTAGCAGAACCAGGGAAGGAGG + Intergenic
1101532360 12:105585372-105585394 TTAAGCTGAGCCATGGAAGGAGG + Intergenic
1102046929 12:109835207-109835229 TTGAGCTGACTCAGGGACTGTGG + Intergenic
1102442905 12:112977326-112977348 CTGAGCTCCCCCAAGGAAGAGGG - Intergenic
1102492373 12:113297066-113297088 GTGAGCAGAGCCAGGGAGGGTGG - Exonic
1102535342 12:113576763-113576785 CTGAGCTGAGGCGGGGCAGGGGG + Intergenic
1102641261 12:114368860-114368882 CTGAGATGGCACAGGGAAGCTGG - Intronic
1103270332 12:119668213-119668235 CTGCGGGGACACAGGGAAGGCGG - Exonic
1103329329 12:120142931-120142953 CAGAGCTGAACCTGAGAAGGAGG + Exonic
1103739900 12:123084064-123084086 TTGGGGTGACCCCGGGAAGGTGG + Intronic
1104719659 12:131038293-131038315 GTGCGCTGAGCCAGGGCAGGTGG + Intronic
1104986699 12:132601406-132601428 CGGGGGTGACCCAGGGAATGGGG - Intergenic
1108327208 13:49345701-49345723 CTGAGCTGAACCAGGGCAGAGGG + Intronic
1110296622 13:73874305-73874327 CTGGGCTGAGGTAGGGAAGGTGG + Intronic
1112071052 13:95850916-95850938 ATGGGCTGCCCCAGGTAAGGGGG - Intronic
1113681217 13:112246257-112246279 CTGAGCTGGCCCTGGAAAAGTGG - Intergenic
1113789974 13:113023102-113023124 CTGAGCTGTCCCAGGTGAAGGGG + Intronic
1114277290 14:21158357-21158379 CTGTGCTATCCCAGGGATGGGGG - Intergenic
1118847755 14:69560689-69560711 CTGAGCTGGGCCAGGCATGGTGG + Intergenic
1118957567 14:70497116-70497138 CTGAGCTGACCTGGGGCAGAAGG + Intergenic
1119176290 14:72569756-72569778 CTGAGCTAAGCAAGGGAAGATGG - Intergenic
1119667978 14:76498566-76498588 CTGAGCTGTCCCAGAGGCGGGGG + Intronic
1119758707 14:77136607-77136629 CTCAGCTGATCCAGAGAGGGAGG - Intronic
1120791540 14:88588247-88588269 CAGAGCCGACTCAGGGGAGGAGG - Intronic
1121122104 14:91382584-91382606 CAGAGATGACCCAGAGAAGACGG + Intronic
1121904371 14:97726293-97726315 GTGAGATGACCCAGGGAATGTGG - Intergenic
1122153719 14:99738128-99738150 CAGAGCTGACCCAGGACAGAGGG + Intronic
1122373426 14:101242283-101242305 CTGAGATGACCCAGTGAATGCGG + Intergenic
1122859182 14:104574813-104574835 CTGAACTCCCGCAGGGAAGGGGG + Intronic
1122870068 14:104634417-104634439 CAGAGCTGACCCAGGTCAGTCGG - Intergenic
1123119287 14:105909387-105909409 CTGTGCTGCACCAGGGCAGGAGG + Intergenic
1123196022 14:106617460-106617482 CTGAGCACACACAGGGAAGCAGG + Intergenic
1202926210 14_KI270724v1_random:28404-28426 CCGAGCTGACCCAGCGGAGAAGG - Intergenic
1124095358 15:26644023-26644045 CTGAGGGTACCCAGGGCAGGAGG + Intronic
1124107414 15:26753113-26753135 CTGAGCTGCCCCAGGCACTGAGG + Intronic
1124434090 15:29633526-29633548 CCCAGCTGAACCAGGAAAGGAGG + Intergenic
1124962830 15:34410890-34410912 ATGAGCAGACCCAGGGCAGTGGG - Intronic
1124979453 15:34557112-34557134 ATGAGCAGACCCAGGGCAGTGGG - Intronic
1127301148 15:57655103-57655125 CTGAGCTATCACAGAGAAGGGGG + Intronic
1127682015 15:61306634-61306656 CTGAGCTGAACCAGGGAAGTGGG + Intergenic
1127855117 15:62947871-62947893 CTGAGATGACCCAGGAAGAGGGG - Intergenic
1128497932 15:68208921-68208943 TAGAGCTGGCCCAGGAAAGGAGG + Intronic
1128697788 15:69781420-69781442 CTGCGCTGAGCCTGGGAAGAAGG - Intergenic
1128787289 15:70407139-70407161 CAGAGCTGTCCCAGGGCAGCGGG - Intergenic
1128907187 15:71477637-71477659 AAGAGCTGACCCAGCTAAGGAGG - Intronic
1129033895 15:72638430-72638452 CTGAGCTGCAGCAGGGAAGCTGG + Intergenic
1129215987 15:74098786-74098808 CTGAGCTGCAGCAGGGAAGCTGG - Intergenic
1129705880 15:77794007-77794029 GGGAGCTGACGCAGGGCAGGAGG - Intronic
1129769493 15:78194121-78194143 CTGAGGGGACCCTGGGAGGGTGG - Intronic
1130097662 15:80867895-80867917 CTTACCTGACCCAGGAGAGGAGG + Intronic
1130332957 15:82935469-82935491 GTGAGGTCACCCAGGGAGGGAGG - Intronic
1132561542 16:596876-596898 CTGAGCCGACCTGGGGATGGCGG + Intronic
1132732135 16:1367719-1367741 CTGAGCTGGCCCGGGTCAGGCGG - Intronic
1132787680 16:1667017-1667039 CAGAGCTGCCCCAAGGAGGGTGG + Intronic
1134256729 16:12618595-12618617 AAGATCTGCCCCAGGGAAGGGGG + Intergenic
1137671754 16:50283429-50283451 TTCTGCTGACCCAGGGAAAGAGG - Intronic
1137904060 16:52300903-52300925 CTGAACTCACCAAGGCAAGGAGG + Intergenic
1138309439 16:56010929-56010951 CTCAGCTGACACAGGTGAGGAGG - Intergenic
1140407616 16:74721519-74721541 CTGCGCTGACCCAGGGGTGAGGG - Intronic
1140994906 16:80249755-80249777 TTGAGATGATCCAGGCAAGGAGG - Intergenic
1141988273 16:87594068-87594090 CTGCGCTGGCACAGGGGAGGAGG + Intergenic
1142157310 16:88538460-88538482 CTGTGCTGAGGCAGAGAAGGGGG - Intergenic
1142494637 17:299854-299876 CTGACCAGACCCAGGGAAGACGG + Intronic
1145279686 17:21458223-21458245 CTGAGATGACGTAGGGAGGGCGG + Intergenic
1146002400 17:29139247-29139269 GTGAGCATCCCCAGGGAAGGGGG - Intronic
1146718069 17:35103118-35103140 TGTAGCTGACCCAGGGAAGCTGG + Intronic
1147615122 17:41822950-41822972 CTGAGCTGACCCTGGGCTGCTGG + Exonic
1147693459 17:42333290-42333312 CTGAGAGGCCCCAGGGCAGGTGG - Intronic
1147884486 17:43675595-43675617 CTGGGCAGGCCCAGGGAGGGTGG + Intergenic
1147914651 17:43879191-43879213 CTGAGCTGACAGAGAGAAGGAGG - Intronic
1148047299 17:44751951-44751973 CGGAGCTGACTCAGGGCAGACGG - Exonic
1148458366 17:47823053-47823075 CAGGGGTGACCCGGGGAAGGTGG - Intergenic
1148964451 17:51422894-51422916 AGGAGCTGAGCCATGGAAGGGGG + Intergenic
1149386131 17:56145021-56145043 CTGAGCTGCCCCAAGGAGAGGGG - Intronic
1149524196 17:57341151-57341173 CTGGGGTGGGCCAGGGAAGGAGG + Intronic
1149664218 17:58354483-58354505 CAGAGCTCACCCAAGGAGGGAGG + Exonic
1149965619 17:61161011-61161033 CAAAGTTGACACAGGGAAGGGGG - Intronic
1151565344 17:74894306-74894328 CAGAGGTGACCCAGGGGAGCTGG + Intergenic
1151658750 17:75507898-75507920 CCCAGCTGGCCCAGGGGAGGGGG + Intronic
1151698051 17:75728044-75728066 CTGAGAAGGCCCAGGGCAGGCGG + Intronic
1153420753 18:4902230-4902252 TTGAGGTGACCCAGGTTAGGAGG - Intergenic
1153785285 18:8528880-8528902 CTGAGCCCACCCAGGGCAGGAGG + Intergenic
1156909072 18:42389361-42389383 CAGAGGTGACCCAGGGAGGATGG - Intergenic
1157095585 18:44682890-44682912 CTGAGCTGAGCTGGGGGAGGAGG + Intronic
1157518036 18:48324823-48324845 CTGGGCTGGTCCAGGGAAGGGGG + Intronic
1157981696 18:52389058-52389080 CTGAGCAGTTCCAGGGAGGGTGG - Intronic
1158866876 18:61646487-61646509 ATGAGCTAGCCCAGTGAAGGTGG + Intergenic
1160419604 18:78735098-78735120 CTGGGCAGACCCAGAGCAGGAGG - Intergenic
1160555361 18:79721131-79721153 CTGAGCGGCTCCAGGGTAGGAGG - Intronic
1160865818 19:1255535-1255557 CGGAGCTGGGCCAGCGAAGGGGG - Exonic
1161161218 19:2762759-2762781 CTGAGCTGACAGCGGGCAGGGGG - Intronic
1161249073 19:3270812-3270834 CCGAGCTGACCCAGCGGTGGGGG + Intronic
1161357325 19:3826245-3826267 CTGAGCCGAGCCAGGGAATGAGG + Intronic
1161610214 19:5238139-5238161 CTGAGCGGAGCCAGGGAGGCAGG + Intronic
1162553114 19:11369380-11369402 CTGAGATGACACTGGGAGGGAGG + Intergenic
1162567238 19:11451155-11451177 CAGATGAGACCCAGGGAAGGTGG - Intergenic
1162895581 19:13763155-13763177 CTGAGCTCTCCCAGGGCTGGTGG - Exonic
1163497665 19:17656010-17656032 GCCAGCTGCCCCAGGGAAGGAGG - Exonic
1163790051 19:19301312-19301334 CTCAGCTGACCCAGTGAATGGGG - Intronic
1163794308 19:19327761-19327783 CTGAGCAGACCCAGGGAACAAGG - Intronic
1164712097 19:30364197-30364219 CTGAACTGACACAGGGAAAGTGG + Intronic
1164715251 19:30386089-30386111 CTGAGATGAAGCTGGGAAGGTGG - Intronic
1165097604 19:33418076-33418098 CTGGGCGCACCCCGGGAAGGCGG - Intronic
1165176511 19:33934377-33934399 CAGAGGTGGCCAAGGGAAGGTGG + Intergenic
1165890118 19:39106909-39106931 CTGATCAGACCCAGAGCAGGTGG - Intronic
1166088832 19:40494981-40495003 CTGGGCTGTCCCAGGCCAGGTGG - Intronic
1166363975 19:42269396-42269418 CAGGGCTGACACAGGAAAGGGGG + Intronic
1167376950 19:49117531-49117553 CTGAGCTGGCCCAGGGCTGTGGG + Intronic
1167437419 19:49487468-49487490 CAGAGATTCCCCAGGGAAGGCGG - Intergenic
1167507660 19:49879387-49879409 CTGCGCTGCCCCAGGGCAGGAGG + Intronic
1168234129 19:55051292-55051314 GTGCGGAGACCCAGGGAAGGGGG + Intronic
925811209 2:7702775-7702797 CTGAGCTGAGGCAGGGAGGTGGG - Intergenic
926128400 2:10285772-10285794 CTGGGCGGACCCAGGGAGGCTGG - Intergenic
926590572 2:14735819-14735841 CTGTGCTGACGCTGGGAAGGTGG - Intergenic
927429443 2:23014880-23014902 CTGGAATGCCCCAGGGAAGGGGG - Intergenic
928085624 2:28344718-28344740 CAGAGCTGACCCTGGGTAAGCGG - Intergenic
931785916 2:65619402-65619424 CAGGGCTTACACAGGGAAGGAGG - Intergenic
933650527 2:84846682-84846704 CTCAGCTAAGCCAGCGAAGGAGG - Intronic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936541444 2:113355274-113355296 CTAAGCTGACACAGGTAGGGTGG - Intergenic
937043407 2:118837749-118837771 CGGAGCAGACCCAGGGCAAGAGG - Intergenic
937861469 2:126714776-126714798 CTGAGGTCACCCTGGGGAGGGGG - Intergenic
941255948 2:163231097-163231119 CTGAGCTGACAAAGGTAAGTGGG - Intergenic
942549371 2:177098796-177098818 CTGAGATGCACCAGAGAAGGAGG - Intergenic
944930099 2:204508531-204508553 CTGAGCTGACTGAGGAGAGGTGG + Intergenic
946253523 2:218427930-218427952 GTGAGCTGACCCAAGGAAGTGGG - Intronic
947811015 2:233003985-233004007 CTGCCCTCACCCAGGCAAGGAGG - Intronic
947909562 2:233792179-233792201 CAGAGGAGCCCCAGGGAAGGAGG - Intronic
947915406 2:233829094-233829116 CTGAGCTTGCTCAGTGAAGGAGG + Intronic
948137234 2:235645643-235645665 GCGTGCTGACCCATGGAAGGGGG - Intronic
948467645 2:238159861-238159883 CAGGGCTGCCCCAGGGAAGCCGG + Intronic
948528122 2:238586050-238586072 CTGAGCTGAACAAGGGAACCTGG - Intergenic
948602535 2:239115537-239115559 GTGACCTGGCCCAGGGAAGGAGG + Intronic
948785105 2:240348184-240348206 CTGAGCTGGCTCAGAGAGGGCGG - Intergenic
948930920 2:241131627-241131649 CTGCCCTGACCCAGGGCAGCAGG + Intronic
1169864102 20:10181615-10181637 CTGAGATGACCCAATGAAGATGG - Intergenic
1170576748 20:17668816-17668838 GTGAGCTGACCCTGGGACAGGGG - Intronic
1170847493 20:19974734-19974756 CAGAGCTGACGCAGGGAGGCAGG - Exonic
1171373534 20:24676573-24676595 CAGGGCTGCCCCAGGGAAAGCGG - Intergenic
1171412058 20:24953968-24953990 CTGAACTGGCCTAGGGGAGGAGG - Intronic
1171976420 20:31597518-31597540 CTAAGGTGACTCAGGAAAGGAGG + Intergenic
1172645318 20:36465524-36465546 GGGAACAGACCCAGGGAAGGCGG - Intronic
1172966315 20:38838145-38838167 CTGAACAAGCCCAGGGAAGGGGG - Intronic
1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG + Intergenic
1173905872 20:46628338-46628360 CTGAGCGGGCCCAGGGAAGAAGG + Intronic
1174193387 20:48756144-48756166 CAGAGTTGACTCAGAGAAGGAGG - Intronic
1174609863 20:51790274-51790296 CTTAGATGCCCCAGGGAAAGTGG - Exonic
1175084216 20:56445335-56445357 CTGGGCTGAGGCAGGGAAGCAGG - Intronic
1175278804 20:57788896-57788918 TTGAGTGGACCCAGGGAAGGAGG + Intergenic
1175306227 20:57977471-57977493 CTGAGCTGCCCCACAGAAGTGGG + Intergenic
1175375576 20:58521367-58521389 CTGAGATGACACGGGGGAGGAGG - Intergenic
1175517934 20:59580697-59580719 CTGAGCTGAGCCAGGAAACAAGG - Intronic
1175766156 20:61594233-61594255 CTGAGCTGAGCAGGGGAAGAGGG + Intronic
1176031414 20:63014812-63014834 CTGTGCTGACTGAGGGCAGGCGG - Intergenic
1176274987 20:64260299-64260321 CTCATCTGTCTCAGGGAAGGAGG + Intronic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179011760 21:37561883-37561905 CTGATGTGATCCAGGGAAGGCGG - Intergenic
1179406655 21:41131932-41131954 GTCAGAGGACCCAGGGAAGGAGG + Intergenic
1179707546 21:43190995-43191017 CTGAGCTGTTGCAGGGTAGGGGG - Intergenic
1180102465 21:45595232-45595254 CTGTGGTCACCCAGGGAGGGAGG + Intergenic
1180102504 21:45595387-45595409 CTGAGCTGAGCCATGGGAGCCGG - Intergenic
1180722209 22:17917800-17917822 CTGACCACACCCAGGGAAGAAGG + Intronic
1181316809 22:21975998-21976020 CTGAGATGATCCTGGGAATGTGG + Intronic
1181338400 22:22159085-22159107 CTGGGCTGATCCAGGGAGGAAGG - Intergenic
1181345136 22:22214598-22214620 ATGAGCTGACCCAGGGGTGGAGG - Intergenic
1182765469 22:32754917-32754939 CACAGCTGGCCCAGAGAAGGAGG + Intronic
1183286240 22:36965953-36965975 CAGCCCTGACCCGGGGAAGGAGG + Intergenic
1184194759 22:42919826-42919848 CTGAGCTCAGCCAGGCACGGTGG + Intronic
1184248472 22:43247520-43247542 CTGGTCTGACCCAAGGAAGGTGG - Intronic
1184501745 22:44878818-44878840 CAGAGCTGTCCCTGGGAGGGAGG + Intergenic
1184645985 22:45895776-45895798 CTGAGGTCAGGCAGGGAAGGTGG + Intergenic
1184708573 22:46233409-46233431 CTGACCTTACCCAGGGTTGGTGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950126559 3:10513439-10513461 CTGTCCTTACCCTGGGAAGGGGG + Intronic
950132684 3:10558133-10558155 CTGCTCTGACCCAAAGAAGGAGG - Intronic
951632526 3:24737315-24737337 CAGAGCTGATCCAGGGGAGCTGG + Intergenic
952510153 3:34044757-34044779 GAGAGCTGACACAGGGAAAGTGG + Intergenic
953288267 3:41634461-41634483 CTCATGTGACCCAGGGATGGAGG - Intronic
953536956 3:43783928-43783950 AGGAGCTGACCAAGGGAAGATGG + Intergenic
953749085 3:45595786-45595808 CTGAGCTGCCCCAGGCAAGGAGG + Exonic
953882084 3:46695855-46695877 ATGAGGTCACCCAGGGAATGGGG - Intergenic
954197390 3:49004816-49004838 CTGGGCAGCCCCAGGCAAGGTGG - Intronic
954709444 3:52498043-52498065 CTGATCTGACCAAAGGTAGGGGG + Intronic
954998752 3:54906662-54906684 GGTAGCTGACCCAGGGAAAGTGG + Intronic
955755176 3:62218713-62218735 CTGAGCTGCCCCATGACAGGAGG - Intronic
955933105 3:64077463-64077485 CAGAGCTGACCCAGGACAGGAGG + Intergenic
956611067 3:71123468-71123490 CTTAGCTGAACCAGAGAACGAGG - Intronic
957309980 3:78507117-78507139 CTGAGCTGACTCAGCAAGGGTGG + Intergenic
961438052 3:126932832-126932854 CTGAGCAGGCCCAGGGCAGGCGG + Intronic
961742445 3:129041051-129041073 CAGAGCTGGCCCCGGGGAGGTGG + Intergenic
962199774 3:133391717-133391739 CTGAGGTGAGCAAGTGAAGGGGG - Intronic
964528500 3:157642037-157642059 CTGATCAGACCAAGGGTAGGTGG - Intronic
965317674 3:167211654-167211676 CTGAACTGACCCAGGGCAGAAGG + Intergenic
965725604 3:171712063-171712085 CTGATGAGACGCAGGGAAGGGGG + Intronic
966208960 3:177433230-177433252 CTGTGCTGCCCCAGGGAGGGTGG + Intergenic
966250804 3:177863393-177863415 CAGAGCCTACACAGGGAAGGAGG - Intergenic
966613762 3:181893042-181893064 CTGAGCTGAGGCAAGGTAGGGGG + Intergenic
968545914 4:1198305-1198327 GAGAGCTGAGCCAGGAAAGGAGG + Intronic
968814607 4:2815400-2815422 ATCAGCTGACCCTGGGCAGGGGG - Intronic
968899978 4:3426340-3426362 CGGGGCTGGCCCAGGGGAGGGGG + Intronic
969467499 4:7366393-7366415 CTGTGCTGAGCCAGGGGAGCAGG - Intronic
975190097 4:71450576-71450598 CTGAGATGACTCTGAGAAGGAGG + Intronic
975454301 4:74572102-74572124 CTGACCTGAGCCAAAGAAGGTGG + Intergenic
976267426 4:83197209-83197231 CTGAGCTCACGCTGGGATGGTGG - Intergenic
976611966 4:87039840-87039862 CTGATGTGCCCCTGGGAAGGAGG - Intronic
977324085 4:95553103-95553125 CTGGGCTAAGGCAGGGAAGGAGG - Intergenic
978208130 4:106104405-106104427 CTGAGCTGACTCAGAGCAGAAGG + Intronic
978208154 4:106104579-106104601 CTGAGCTGACTCAAGGCAGAAGG + Intronic
981601679 4:146496335-146496357 TTGAGCTGACACAGACAAGGGGG + Intronic
981988650 4:150889081-150889103 CTGACCTGCCCCAGGGATGAAGG - Intronic
982312443 4:154000212-154000234 GTGAGGTGGCCCAGGGAAAGGGG + Intergenic
982385646 4:154798819-154798841 TTGGGCTGACCCAGAGAAAGAGG + Exonic
984346619 4:178536416-178536438 ATGAGCTCACCCAGGAAATGGGG - Intergenic
985428600 4:189855826-189855848 CTGTGCTGACTTAGGGGAGGAGG + Intergenic
992368302 5:76115862-76115884 CTGAGCAGAGCCAGGGAGAGGGG - Intronic
992468548 5:77030825-77030847 CTGAGCTGGCCCAGCTAAGGCGG + Exonic
992974518 5:82100398-82100420 ATGAGCTGACACAGTGAAGATGG - Intronic
993501912 5:88674864-88674886 CTTAGCTGCCCCAGAGGAGGGGG + Intergenic
996747406 5:126857269-126857291 CTGAGCTGGCCCAGACATGGAGG - Intergenic
997752086 5:136356470-136356492 CTGAGCAGGCCCAGGGGAGGAGG - Intronic
998443870 5:142183867-142183889 CTCAGCTGACACAGTGATGGTGG + Intergenic
999759864 5:154691665-154691687 GTGAGCTGCCCCAGGGAACAGGG - Intergenic
999789565 5:154926467-154926489 CTTATCATACCCAGGGAAGGAGG + Intronic
1002186668 5:177457900-177457922 CAGAGCCGGCCCAGGGAGGGAGG + Intronic
1002194303 5:177493890-177493912 CTGAGCTGAGGCAGGGAGAGGGG + Intronic
1002299223 5:178248078-178248100 CTGAGCAAACCCAGGGCAGTAGG - Intronic
1002846167 6:947346-947368 CTGTGCTGACCCTGGGCTGGAGG + Intergenic
1003468832 6:6409503-6409525 AGGAGCTGACCCAGTGAGGGAGG - Intergenic
1003674717 6:8192669-8192691 CTGAGTGGAGCCAAGGAAGGGGG + Intergenic
1003923959 6:10859537-10859559 CTGAGGTTTCCCAGAGAAGGAGG + Intronic
1006505792 6:34487847-34487869 GTGACCTCACCCTGGGAAGGTGG + Intronic
1006983281 6:38162332-38162354 CAGAGCTGACCAAGTGGAGGAGG - Intergenic
1007508945 6:42360737-42360759 ATGAACTGACCCAGGGAGGAAGG + Intronic
1007943100 6:45800462-45800484 ATGAGCTGTCCCTGGGAAGGTGG - Intergenic
1010365008 6:75040726-75040748 CTGTGCTGATGCAGTGAAGGGGG - Intergenic
1011553854 6:88554645-88554667 CAGAGCTAACCCAGAGAAAGTGG - Intergenic
1013596825 6:111668094-111668116 CTGTGCTGGCGCTGGGAAGGAGG + Intronic
1015018002 6:128437632-128437654 TTAAGCTGACCCAAGGCAGGAGG + Intronic
1015127871 6:129774598-129774620 GTGAGTTTACCCAAGGAAGGAGG + Intergenic
1016463735 6:144305755-144305777 TTTGGCTGACCCTGGGAAGGAGG + Intronic
1016856480 6:148675683-148675705 TGGAGCTGGTCCAGGGAAGGTGG + Intergenic
1017645717 6:156538289-156538311 CTGGGCAGATCCAGGTAAGGGGG + Intergenic
1018206957 6:161445299-161445321 CGGCACTGACCCAGGGGAGGAGG + Intronic
1018395912 6:163377921-163377943 CTGCGCTGCTCCAGGGAAGGAGG - Intergenic
1019365856 7:632446-632468 CTGAGCTGAGCCAGGGGCAGTGG - Intronic
1019906437 7:4068596-4068618 CTGAGCTGTACCAGGGATGGGGG + Intronic
1020373436 7:7459757-7459779 CTGACCTGACCCTGGCAAGTAGG + Intronic
1022628618 7:32064138-32064160 AGGAGATGACCCAGGGAAGAGGG - Intronic
1023598097 7:41853682-41853704 CTCAGGTGTCCCAGGGAAGCAGG - Intergenic
1026204381 7:68243382-68243404 CTGACCTCCCCCAGGGAAGAAGG + Intergenic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1028391305 7:90320899-90320921 GTGACCTGACCCAGGGCTGGGGG - Intergenic
1029225267 7:99022410-99022432 CAGAGGTGAAACAGGGAAGGTGG + Intergenic
1031182145 7:118432774-118432796 CTGAGCTCATGCAGGGAAGCAGG - Intergenic
1032699173 7:134363821-134363843 CTGCTCTGACCCTGGGAAGCTGG + Intergenic
1033640313 7:143256899-143256921 CTGTCATGACCCAGGGATGGAGG - Intronic
1035381315 7:158443225-158443247 CTGGGCTGAGCCACGGAAGATGG - Intronic
1035386168 7:158474637-158474659 CTTAGCTGACCTTGGGAAGAGGG - Intronic
1035670877 8:1416307-1416329 CTGGGCTGACCACGGGAAGCTGG - Intergenic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1037161664 8:15780684-15780706 CTGGGGTGAGCCAGGGAAGAGGG - Intergenic
1037861726 8:22410142-22410164 CTGTGCCGCCCCAGGGAAAGAGG - Intronic
1038347711 8:26747553-26747575 CAGGGCTTGCCCAGGGAAGGTGG + Intergenic
1038443255 8:27586176-27586198 CTGAGCTGACCCAGTAAAGTGGG - Intergenic
1038680685 8:29664299-29664321 CAGACCTGACAAAGGGAAGGAGG - Intergenic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1039882325 8:41632690-41632712 CTGGGCTGGCGGAGGGAAGGAGG + Intergenic
1043276982 8:78410216-78410238 CTGAGCAGACACAGGGGTGGGGG + Intergenic
1044772677 8:95653711-95653733 CTGAGCTGAGCCACTGAAGAGGG - Intergenic
1045402337 8:101831711-101831733 CTGAGATGACCCTGGGTAGAAGG - Intronic
1045847740 8:106657876-106657898 CAGACCTGACCCAGGGGAGGCGG - Intronic
1047959000 8:129997189-129997211 TTAAGCTGACCCAGGGAACATGG + Intronic
1049205561 8:141361920-141361942 CTGAGCTCCTCCAGGGGAGGGGG + Intronic
1049326576 8:142024627-142024649 CCCTGCTGACCCAGGTAAGGAGG + Intergenic
1049348094 8:142149436-142149458 CTGAGCTGAGCCAGGCCGGGTGG + Intergenic
1049446582 8:142634229-142634251 CTGAGCTGTCCCTGGGAACAAGG + Intergenic
1049708603 8:144053856-144053878 CTGAGCAGCTGCAGGGAAGGGGG - Intronic
1049732245 8:144184689-144184711 CTGAGCTGGCAGAGAGAAGGGGG + Intronic
1049798964 8:144509051-144509073 CTGCGCGGCCGCAGGGAAGGGGG - Intergenic
1049813451 8:144586701-144586723 CAGAGCCTGCCCAGGGAAGGGGG + Intronic
1051596158 9:18826175-18826197 TAGAGCAGCCCCAGGGAAGGGGG + Intronic
1051604979 9:18909698-18909720 CAGAGCTGGCCCAGGGACCGGGG + Exonic
1055053011 9:71998578-71998600 CAGTGCTTATCCAGGGAAGGAGG + Intergenic
1055398124 9:75894720-75894742 CTGAGCTGGCCGAGGGTAGGAGG + Intronic
1056369726 9:85941559-85941581 CTGGGCTGACCCGGGCAGGGCGG + Intronic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1058187676 9:101874580-101874602 CAGAGAAGACCCAGGGAAGAAGG - Intergenic
1059578998 9:115523183-115523205 CTTAGCTGAGCCAGGCAAAGAGG + Intergenic
1059679378 9:116571342-116571364 GTGAGAAGACCCAGGGAAGGAGG - Intronic
1060292357 9:122315585-122315607 TTTAGCTGATACAGGGAAGGAGG - Intronic
1060413780 9:123416658-123416680 CCGAGCTGGGCCAGGGCAGGAGG + Intronic
1062503452 9:136861136-136861158 CTGAGCTGCCCCAGGGGCTGTGG + Intronic
1186462335 X:9758202-9758224 CTGAACTGACACAGAGAAGCTGG - Intronic
1188143509 X:26581938-26581960 TTGGGCTGAAACAGGGAAGGGGG + Intergenic
1190059555 X:47202060-47202082 CTGAGCTGAGTCGGGGCAGGAGG + Intronic
1190805507 X:53832263-53832285 CTGAGCTGGCCCAGTGTAAGGGG + Intergenic
1192429458 X:71102475-71102497 CTGAGCTGAGCCAGGCTAGCTGG + Exonic
1193301283 X:79891843-79891865 CCAAACTGACCCAGGGAAGAAGG + Intergenic
1193739822 X:85203685-85203707 TTGAGCTGACCCGGGGCAGAAGG - Intergenic
1193858863 X:86639784-86639806 CTGAGCTGACCCAGGGCAGAAGG + Intronic
1195473627 X:105260463-105260485 CTGAGCTGACCAGGGGCAGAAGG - Intronic
1196084827 X:111673739-111673761 CTGACCAGACCGTGGGAAGGGGG + Intronic
1200057830 X:153470770-153470792 CAGGGCGGACACAGGGAAGGGGG + Intronic
1200057840 X:153470793-153470815 CGGGGCGGACACAGGGAAGGGGG + Intronic
1200097459 X:153670879-153670901 CTGAGCTGCCCCAGGGCCAGGGG - Intronic