ID: 1092242451

View in Genome Browser
Species Human (GRCh38)
Location 12:6843547-6843569
Sequence TTCCCTGAACCCCTCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092242451_1092242458 -5 Left 1092242451 12:6843547-6843569 CCCCTCCTGAGGGGTTCAGGGAA 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1092242458 12:6843565-6843587 GGGAACCCTGGGCTTCCAGTGGG 0: 1
1: 0
2: 0
3: 21
4: 184
1092242451_1092242457 -6 Left 1092242451 12:6843547-6843569 CCCCTCCTGAGGGGTTCAGGGAA 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1092242457 12:6843564-6843586 AGGGAACCCTGGGCTTCCAGTGG 0: 1
1: 0
2: 0
3: 31
4: 237
1092242451_1092242461 1 Left 1092242451 12:6843547-6843569 CCCCTCCTGAGGGGTTCAGGGAA 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1092242461 12:6843571-6843593 CCTGGGCTTCCAGTGGGCTGTGG 0: 1
1: 0
2: 6
3: 57
4: 536
1092242451_1092242463 14 Left 1092242451 12:6843547-6843569 CCCCTCCTGAGGGGTTCAGGGAA 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1092242463 12:6843584-6843606 TGGGCTGTGGCTCTGCAGCCAGG 0: 1
1: 0
2: 4
3: 53
4: 653
1092242451_1092242464 15 Left 1092242451 12:6843547-6843569 CCCCTCCTGAGGGGTTCAGGGAA 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1092242464 12:6843585-6843607 GGGCTGTGGCTCTGCAGCCAGGG 0: 1
1: 0
2: 5
3: 52
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092242451 Original CRISPR TTCCCTGAACCCCTCAGGAG GGG (reversed) Intronic
900003436 1:28944-28966 TTCCCAGAACCCGGCAGGGGCGG + Intergenic
900724729 1:4208498-4208520 TGCCCTGACCCCCGCAGGAAAGG - Intergenic
901663940 1:10815919-10815941 TTCCCTGACACCCACAGGAGGGG + Intergenic
902520160 1:17011466-17011488 TCCCCTGCACCCCTCAGCCGCGG - Intronic
904072472 1:27812153-27812175 TTCCCTGCAGCCATGAGGAGTGG + Exonic
904183612 1:28685104-28685126 TTCTCTGAACCCCCATGGAGGGG + Intronic
908488638 1:64620430-64620452 ATCTGTGAACCCCTTAGGAGGGG - Intronic
911404290 1:97417081-97417103 TTCCCTAAACCCTACAAGAGAGG + Intronic
912480254 1:109977628-109977650 TTCCCTGAACCCCTATAAAGAGG + Intergenic
916024804 1:160824102-160824124 TACCCTCAACCCTTGAGGAGAGG - Intronic
917651544 1:177082658-177082680 TCCCCTGAACAACTGAGGAGTGG - Intronic
920991545 1:210944502-210944524 GTCCCAGAACCCCTGAGGCGAGG - Intronic
920994197 1:210971970-210971992 TTCCCTTGACCCCTGAAGAGGGG - Intronic
922235780 1:223721570-223721592 TTCCCTGGGCCCCTCAGAGGTGG + Intronic
922354701 1:224764733-224764755 TTCCCTGCACCCCCCATGACAGG + Intergenic
923296143 1:232596829-232596851 GTCCCTGCACTTCTCAGGAGTGG - Intergenic
1062866028 10:855392-855414 TTCACTGGAACCCTCAGAAGAGG + Intronic
1067179110 10:43971688-43971710 TTCCCTGAGGCCCTCACCAGAGG - Intergenic
1069306337 10:66975475-66975497 TTTCCTGAAATCCTCAGGAAAGG - Intronic
1071872013 10:89806364-89806386 TCCCCTGATCCCCTCAGAAAAGG - Intergenic
1071885118 10:89941278-89941300 TACCCTGACCCCATGAGGAGAGG + Intergenic
1073486143 10:103820338-103820360 CTCCCAGGTCCCCTCAGGAGGGG + Intronic
1073995926 10:109315423-109315445 ATCCCTGAACCCTCTAGGAGAGG + Intergenic
1075148483 10:119904246-119904268 TTCACTGAACTCCTCAGTATAGG - Exonic
1075711224 10:124531467-124531489 TTCCATGAACTCCTCTAGAGAGG + Intronic
1076008451 10:126967248-126967270 TGCCCTCAACCCCTAAGAAGGGG + Intronic
1076252955 10:128997548-128997570 CTCCCTGAATCCCTAAGGATGGG - Intergenic
1077406934 11:2386885-2386907 TTCCCTGCAACCCTCGGCAGAGG + Intronic
1077475916 11:2790422-2790444 GACCCTGAACCCCATAGGAGGGG + Intronic
1077975330 11:7242317-7242339 TTCCCTGGACCCATCTGGGGTGG + Intronic
1078916510 11:15783678-15783700 TTCCCTCAGGCCCTCAGGTGCGG - Intergenic
1079092110 11:17488364-17488386 TTCCCTTCACCTCTCAGGAGAGG + Intergenic
1079325650 11:19489122-19489144 TTCCCTTTACCCCACAGAAGAGG + Intronic
1080936293 11:36867495-36867517 TTCCCTCAAACCCTGTGGAGTGG - Intergenic
1082095020 11:48122833-48122855 GCCCCTGCAGCCCTCAGGAGGGG + Intronic
1082819553 11:57535518-57535540 TTCTCTGCACCTCTCATGAGTGG - Intergenic
1083772560 11:64876648-64876670 TTTCCTGAACCAGTCAGGTGGGG + Intronic
1083802528 11:65054609-65054631 GTACCTGCCCCCCTCAGGAGTGG - Exonic
1084116216 11:67044532-67044554 TTCCCTGGACCCCTCAAGTCGGG + Intronic
1084251413 11:67902211-67902233 TTCCCTCCACCAATCAGGAGGGG + Intergenic
1084431810 11:69115517-69115539 TTCCCAGGACCCCTCACCAGCGG + Intergenic
1084907028 11:72356335-72356357 TTTCCTGAAACCCTTTGGAGAGG + Intronic
1085034313 11:73291040-73291062 GTCCTTGAACCCCTGAGAAGAGG + Intronic
1085733712 11:79020985-79021007 ATCCCTGAAGCACTCAGGAAAGG - Intronic
1085869645 11:80334240-80334262 TTCACTGAGCCCTTCAGGAAGGG + Intergenic
1086396667 11:86422563-86422585 TTGTCTGAAGCCCTGAGGAGAGG - Exonic
1088786552 11:113187326-113187348 TTCCCTGAACCCTTGGGGAAAGG - Intronic
1089339255 11:117746509-117746531 GTGCTTGAAGCCCTCAGGAGAGG + Intronic
1089762744 11:120740373-120740395 TTCCCTCACCCCCGCATGAGTGG + Intronic
1091996894 12:5000855-5000877 TTCCCTCTTCCCCTCAGCAGGGG + Intergenic
1092242451 12:6843547-6843569 TTCCCTGAACCCCTCAGGAGGGG - Intronic
1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG + Intergenic
1100793181 12:98152970-98152992 TGCCCTGAAGCCCTCATCAGTGG - Intergenic
1102649369 12:114427297-114427319 TTCCATGAACTCCACAGAAGTGG - Intergenic
1102773063 12:115495310-115495332 TACAGTGAACCCCTCAAGAGGGG - Intergenic
1108958556 13:56190254-56190276 TTCCCTGATGCCTTCATGAGTGG - Intergenic
1113575226 13:111390496-111390518 CTCCCTGGACCTCTCAGGAGTGG + Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1117402376 14:55370003-55370025 GTCCCTCATCCCCTCAGGTGAGG - Intronic
1119512369 14:75221546-75221568 CTCCCTGAAACCCTCAGCATGGG - Intergenic
1124177227 15:27437811-27437833 CTCCCTGAGGCCCTCAGCAGAGG - Intronic
1125676682 15:41505808-41505830 TGCCCTGCACGCTTCAGGAGAGG + Intronic
1127799067 15:62462319-62462341 TTCACAGAAGCCCCCAGGAGAGG + Intronic
1132002488 15:98194053-98194075 TTCCCTGACCTCCCCAGGAGAGG + Intergenic
1132291087 15:100704403-100704425 TTCCTTGAACCTCAGAGGAGCGG + Intergenic
1134889906 16:17831511-17831533 TTCCCTGAATCCTCCAGCAGAGG - Intergenic
1137024008 16:35455522-35455544 TGCCCAGGACCCCACAGGAGAGG - Intergenic
1146478371 17:33181492-33181514 CTCCCTAGATCCCTCAGGAGTGG - Intronic
1146507058 17:33414531-33414553 TTACCTGGACCTCTCTGGAGGGG + Intronic
1148479227 17:47949331-47949353 CTCCCTCAACCCCCAAGGAGGGG + Intergenic
1148724102 17:49776348-49776370 TCCACTGAGCCCCTCAGTAGTGG - Intronic
1150352770 17:64458686-64458708 CTCCCTGAACCCCTCAGCCTAGG - Intronic
1152231428 17:79115793-79115815 TTCCCGGAGCCCCTGAGGATGGG + Intronic
1154194072 18:12253530-12253552 TTCCCAGAACCCCTCACTACAGG - Intergenic
1156492375 18:37503886-37503908 TTCCCTGACCCCATCTGGAGTGG + Intronic
1159030449 18:63225601-63225623 TTCCCTGAACGCTTCATGGGTGG + Intronic
1159905893 18:74091924-74091946 TTCCCTCAACCTCTCTAGAGAGG - Intronic
1160222337 18:76986256-76986278 TTCCCTCAAGTCTTCAGGAGAGG - Intronic
1160635189 19:70552-70574 TTCCCAGAACCCGGCAGGGGCGG + Intergenic
1161032511 19:2064715-2064737 CTCCCTGGACCCCTCAGGCCAGG - Intergenic
1161717287 19:5883424-5883446 TGCCCCGAACCCCTGAGGACAGG + Intronic
1162064209 19:8115317-8115339 TCCCCTGAACAGCTCAGGAAGGG - Intronic
1163282940 19:16328165-16328187 GTCCCTGAACCCCACTGGAAGGG + Intergenic
1163523871 19:17808434-17808456 TCCCCTGGGTCCCTCAGGAGTGG - Intronic
1167505553 19:49869315-49869337 TTCCCTGACCCCCTCAGGGATGG - Exonic
1168104282 19:54157020-54157042 TTTCCTGGCCCCCTCAGGAGAGG - Exonic
925538465 2:4941083-4941105 TTCCCTAAACACCTGAGGAATGG + Intergenic
928111857 2:28516969-28516991 TTCCCTCAAGGCCTCAGGAAGGG - Intronic
929914847 2:46126402-46126424 TGCCTTGGACCCCTTAGGAGGGG + Intronic
932416868 2:71578844-71578866 TTCCCTGAAACCTTCTGCAGGGG + Intronic
932925161 2:75964854-75964876 TTCCATAAAGCCCTCAGGCGTGG + Intergenic
934904174 2:98184725-98184747 CTCCCTGCAGCCCTCTGGAGTGG + Intronic
935175983 2:100649029-100649051 TTCCCTGACCCCTTCATGGGTGG - Intergenic
937872782 2:126797977-126797999 TCCCCAGAGCCCCTCAGGTGAGG + Intergenic
941630084 2:167874801-167874823 TCCCCTGAACCCCTCCAGACAGG + Intergenic
944310765 2:198231526-198231548 TTTCCTGAACTCCTCAGGAGGGG + Intronic
944785102 2:203062350-203062372 TAACCTTCACCCCTCAGGAGTGG - Intronic
945687598 2:212991243-212991265 GTCCCTGAATACCTCAGCAGGGG - Intergenic
946195828 2:218032699-218032721 TTCCCTAAACCCCTGAAGGGGGG + Intergenic
946200270 2:218067509-218067531 TTCCCTAAGCCCCTGAAGAGGGG + Intronic
946471489 2:219964868-219964890 TTCCCTGACCCCTTCACAAGTGG - Intergenic
948680310 2:239629331-239629353 TTCCCTGGTCCCTTCCGGAGAGG - Intergenic
1169665578 20:8032202-8032224 AACCCTGAATCACTCAGGAGGGG - Intergenic
1171248741 20:23633413-23633435 CTCCCTGACCCCCTCACCAGGGG + Intronic
1171262582 20:23747313-23747335 CTCCCTGACCCCCTCACCAGGGG + Intergenic
1171271726 20:23823520-23823542 CTCCCTGACCCCCTCACCAGAGG + Intergenic
1171283173 20:23918293-23918315 CTCCCTGACCCCCTCACCAGGGG + Intergenic
1172210670 20:33195950-33195972 ATCCCTGAACCCCAAATGAGGGG - Intergenic
1173453876 20:43188947-43188969 TTCCCCGAACTTTTCAGGAGCGG + Intronic
1173998198 20:47356133-47356155 TTCCCAGAACCTCTTTGGAGAGG + Intronic
1174581916 20:51578262-51578284 TTCCCTGAACCAATCACCAGTGG - Intergenic
1176191221 20:63811088-63811110 GTCCCAGAACCCCACAGGATGGG + Intronic
1176191264 20:63811214-63811236 GTCCCAGAACCCCACAGGATGGG + Intronic
1176288652 21:5032994-5033016 TTCCCAGAACCCCCCAAGGGTGG + Intronic
1176389757 21:6157427-6157449 TTCCCTGAAAGCTTGAGGAGGGG + Intergenic
1178855868 21:36250055-36250077 TTCCCTCAACCCATGAGGACAGG - Intronic
1179733710 21:43380811-43380833 TTCCCTGAAAGCTTGAGGAGGGG - Intergenic
1179868532 21:44230481-44230503 TTCCCAGAACCCCCCAAGGGTGG - Intronic
1181021886 22:20107891-20107913 TACCCTCCACCCCTCAGGAGTGG - Intronic
1181260408 22:21593275-21593297 TTCTCTGAGCTCCTCAGGAGGGG + Intronic
1182566019 22:31200005-31200027 TCCCCTGCACCCCTGATGAGAGG - Intronic
1182909586 22:33971013-33971035 TTCCCTAACCCCATCATGAGCGG - Intergenic
1183781590 22:40002415-40002437 GTCCCTGAACCTCTGAGGATGGG + Intronic
1184971940 22:48028929-48028951 TTCCCTCAATCCCTCAGGTGTGG - Intergenic
1185069717 22:48649327-48649349 TTCCCAGAAACCCTCAGGGCTGG - Intronic
1185275911 22:49950171-49950193 TCCCCTGAGCCCCTCTAGAGTGG - Intergenic
949956575 3:9274282-9274304 TTCCCTGACCCCTTCACAAGTGG + Intronic
950303874 3:11903742-11903764 TGCCATCAACCCTTCAGGAGTGG - Intergenic
950568258 3:13784280-13784302 TTGACTGAACCCTTCAGGTGGGG - Intergenic
950978997 3:17281099-17281121 TTCCCTGACCCCTTCACGGGTGG - Intronic
951225595 3:20117279-20117301 TTACCTGAAGCCATCAGAAGTGG + Intronic
954563445 3:51578553-51578575 TTCCTTGACCCCCTCATGGGTGG + Intronic
954628835 3:52037440-52037462 CTCCCAGAAACCCTCAGGACAGG + Intergenic
958158994 3:89792034-89792056 TTCTATGAACCCCTCAGGCATGG - Intergenic
958196429 3:90246939-90246961 TTCCCTAAAGCCCTCAGGCATGG + Intergenic
960109086 3:113827882-113827904 TTCCCTGAAGCCCTCTCAAGTGG + Intergenic
960822649 3:121750529-121750551 TTCCTTAAACCCCTAAGGAAAGG + Intergenic
961003802 3:123391268-123391290 TGGCCTGAAAGCCTCAGGAGTGG - Intronic
965550646 3:169961685-169961707 TTCCATGAAGCCCTCATGAATGG - Intergenic
965838086 3:172872999-172873021 TTCCCTGAACCACTCTGCATTGG - Intergenic
966272739 3:178127633-178127655 TTCCCTGACCCCTTCACGGGTGG - Intergenic
967532703 3:190567205-190567227 TCCCCTTATCCCCTCAGGAATGG + Intronic
967812735 3:193774300-193774322 TTCGCAGAACTCTTCAGGAGAGG + Intergenic
968594888 4:1477202-1477224 TTCCCTCAACCTCTCCCGAGGGG + Intergenic
968594893 4:1477211-1477233 CTCCCTGGGCCCCTCGGGAGAGG - Intergenic
968769201 4:2493104-2493126 TTCCCTGCACCACTCAAGACAGG - Intronic
968928396 4:3562373-3562395 TTCCCTGAACCCCAGAGTGGAGG + Intergenic
970993061 4:22235555-22235577 TTCCTTGAAATCCTAAGGAGTGG + Intergenic
974611759 4:64227378-64227400 TTATGTTAACCCCTCAGGAGAGG - Intergenic
978385168 4:108170872-108170894 TTTCATCAAACCCTCAGGAGGGG + Intergenic
979846800 4:125523320-125523342 TTCTCTGACCCCCTCGTGAGGGG - Intergenic
982179182 4:152734151-152734173 TTCCCTGAAGCCCTCTGCAGTGG - Intronic
984682512 4:182625788-182625810 TTCCCTCAACGCCACTGGAGAGG - Intronic
985590447 5:761769-761791 TTCCCTAAATCCCTTAGGATTGG + Intronic
986307686 5:6527978-6528000 TTCCTTGGACCCTTCAGGAAAGG + Intergenic
986897057 5:12384021-12384043 TTCTCTGAACCCTTGAGGATAGG + Intergenic
988055363 5:26087438-26087460 TTCCCTGAACCCCACTGGTGGGG - Intergenic
990444387 5:55880670-55880692 TTCCCTAGACCCCTTAGCAGAGG - Intronic
996638424 5:125723560-125723582 TTACCTGAACACCACAGAAGTGG - Intergenic
997641705 5:135452721-135452743 TTCCCTGAGGGTCTCAGGAGAGG + Intergenic
998614097 5:143720482-143720504 CTCCCTGAACCAATCAGCAGTGG - Intergenic
998675397 5:144402313-144402335 TTCCCTGGCCACCTAAGGAGAGG - Intronic
1001573665 5:172747857-172747879 TTCCATTACCCCATCAGGAGTGG + Intergenic
1004291605 6:14372818-14372840 TTCACTGAACCCCTCAGAAGGGG + Intergenic
1004782945 6:18932393-18932415 TTTCCTGACCTCCTCAGGAAGGG - Intergenic
1004801882 6:19157587-19157609 ATCCCTGGACCTCTGAGGAGAGG - Intergenic
1007254476 6:40519060-40519082 TTCCCTGACCCCTGCAGAAGGGG - Intronic
1009524529 6:64727973-64727995 TTCCCTGACCCCTTCACGGGTGG + Intronic
1012263164 6:97111372-97111394 TTCCCTGACCCCTTCACGGGCGG + Intronic
1012610282 6:101209657-101209679 TTCCCTCACACCCTAAGGAGTGG - Intergenic
1013355645 6:109343873-109343895 GTCCCTGAGCCCCAAAGGAGGGG + Intergenic
1016183032 6:141170778-141170800 TTCCCTGACCCCGTCATGGGTGG + Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018165987 6:161097158-161097180 ATACCTGAATCCCTCTGGAGTGG - Exonic
1019017537 6:168890793-168890815 GCCCCTGAAGCCCTCAGCAGGGG - Intergenic
1020697813 7:11437130-11437152 TTCCCAGAGCCCCTCAGGCCAGG - Intronic
1021911778 7:25392771-25392793 TTCCCAGAACTCCTCACCAGTGG + Intergenic
1022490423 7:30813385-30813407 TTCCATGAACCCCACAGCACGGG - Intronic
1024098708 7:46007047-46007069 TTCTCTGCACCCCTCAGGCTGGG + Intergenic
1025254593 7:57375012-57375034 TTCCCTGAGCTCCTGAGTAGAGG - Intergenic
1027250917 7:76398134-76398156 TTCCCTGATCTCCTGAGGAACGG + Intronic
1030524858 7:110640670-110640692 TTCTCTGAACCCCTCAGGCTGGG + Intergenic
1032390298 7:131551586-131551608 TTCACTGGACTTCTCAGGAGGGG - Intronic
1032498638 7:132382196-132382218 TTCCCTGAAGCCCAGAGAAGAGG + Intronic
1033269564 7:139918566-139918588 TTCCCTTCCCCGCTCAGGAGGGG + Intronic
1035438282 7:158875719-158875741 TTCCTTGGTCCCCTCAGCAGTGG + Intronic
1038012441 8:23485951-23485973 TTCCCTGAAACTCCCAGGAGAGG + Intergenic
1042907257 8:73784660-73784682 TTCCCTGAACCACCCTAGAGTGG + Intronic
1044274489 8:90284231-90284253 TTCCCTGACCCCTTCATGTGTGG - Intergenic
1047566776 8:126052647-126052669 TTCCCTGAACCCCTTTGAATAGG - Intergenic
1049886242 9:29058-29080 TTCCCAGAACCCGGCAGGGGCGG + Intergenic
1053803280 9:41777515-41777537 TTCCCTGAACCCCAGAGTGGAGG + Intergenic
1054141982 9:61537609-61537631 TTCCCTGAACCCCAGAGTGGAGG - Intergenic
1054191574 9:61988825-61988847 TTCCCTGAACCCCAGAGTGGAGG + Intergenic
1054461742 9:65468787-65468809 TTCCCTGAACCCCAGAGTGGAGG - Intergenic
1054646797 9:67598887-67598909 TTCCCTGAACCCCAGAGTGGAGG - Intergenic
1056735190 9:89203378-89203400 TTAACTGAAGCCCTCAGGAATGG - Intergenic
1059786437 9:117591333-117591355 TTCCCTGAACCCTCCAGGCTAGG - Intergenic
1061408463 9:130405486-130405508 TCCACTGAACCCATCTGGAGAGG - Intronic
1061502831 9:131013557-131013579 GGCCCTGAGCCCCTCAGGACAGG - Intronic
1061881458 9:133571223-133571245 CTCCCTGAACCTCTGAGGAATGG - Intronic
1062020245 9:134315952-134315974 TGCCCTGACCTCCTCAGGGGAGG - Intergenic
1186127025 X:6425613-6425635 TTCCCTGACCCCTTCATGGGTGG + Intergenic
1186888190 X:13935964-13935986 TTACCTGAACCCTCCAGAAGAGG + Intronic
1187324565 X:18274390-18274412 TTCCCTGACCCCTTCATGGGTGG - Intronic
1190725875 X:53190261-53190283 TTCCATGAACTCTGCAGGAGAGG - Intergenic
1192085013 X:68087355-68087377 TTCCCAGAAGCCTTCAGGAGAGG - Intronic
1196748492 X:119093457-119093479 TTACCTGAACCCCACACAAGTGG + Intronic
1199432373 X:147776141-147776163 AGCTCTGAACCCCTCACGAGAGG + Intergenic
1199510063 X:148611764-148611786 TTCCCTGAACCCACCCGTAGTGG + Intronic
1200117633 X:153776338-153776360 TTCCCTGACTCCCTCCAGAGTGG + Exonic
1201639204 Y:16160615-16160637 TTCCCTGACCCTTTCAGGGGTGG - Intergenic
1201663609 Y:16424712-16424734 TTCCCTGACCCTTTCAGGGGTGG + Intergenic