ID: 1092243704

View in Genome Browser
Species Human (GRCh38)
Location 12:6851227-6851249
Sequence GTGCATCCAGAGGTGGAATT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092243704 Original CRISPR GTGCATCCAGAGGTGGAATT GGG (reversed) Exonic
900668063 1:3829082-3829104 CTCCATGGAGAGGTGGAATTGGG - Intronic
902545526 1:17187230-17187252 CTGCATACAGAGGAGGAGTTGGG + Intergenic
904983804 1:34528075-34528097 GTGCATCAATAAATGGAATTGGG - Intergenic
906256988 1:44357914-44357936 GTGCTTCCAGGTGTGGAATCTGG - Intergenic
907410037 1:54277435-54277457 GTGCATCCACATTTGGACTTTGG + Intronic
912936807 1:114010823-114010845 GTGGATCCAGAGCTGGAACCAGG + Intergenic
914328712 1:146646150-146646172 GTCAATACAGAGGTGGACTTTGG + Intergenic
915603661 1:156937869-156937891 GTTCATCCAGAGCTGGAGTCAGG - Intronic
919022789 1:192129779-192129801 ATGAATTCAGAGGTGGACTTAGG - Intergenic
919808428 1:201394720-201394742 GTGCATCCAGAGGAGGGAGCTGG - Intronic
920104913 1:203545572-203545594 GTTCATGCTGAGGTGGAATGTGG - Intergenic
921469668 1:215532998-215533020 AAGCTTCCAGAGGTAGAATTAGG + Intergenic
923441856 1:234028195-234028217 GTGCAAACAGAGGTGGAAGATGG - Intronic
924281082 1:242438157-242438179 GTGCATCCAGAGGAGAGTTTAGG - Intronic
1071007642 10:80901056-80901078 GTGTGTCCAGATGTGAAATTTGG + Intergenic
1074149627 10:110746590-110746612 GGGCATCTCCAGGTGGAATTTGG - Intronic
1075808939 10:125210326-125210348 GTGCATCCAGAGCTGGACCTGGG + Intergenic
1076497531 10:130906726-130906748 GTCCATCCACAGCTGGAACTTGG - Intergenic
1080472393 11:32558994-32559016 GTGAAGACAGAGGTGGAAATTGG - Intergenic
1081250099 11:40819407-40819429 CTCCATCCAGTGGTGGAAGTGGG - Intronic
1081955192 11:47085948-47085970 GTGCATGGGGAGGGGGAATTAGG + Intronic
1084241254 11:67822035-67822057 GAGGATCCAGAGGTGGGATGTGG + Intergenic
1084734600 11:71096375-71096397 GTGCACAGAGAGGTGGAAATGGG + Intronic
1084831190 11:71770598-71770620 GAGGATCCAGAGGTGGGATGTGG - Intergenic
1085957195 11:81413850-81413872 GTTAATACAGAGGTGGAATGGGG - Intergenic
1086450944 11:86916393-86916415 GTAAAGCCAGAGGTGGATTTGGG - Intronic
1092062835 12:5564953-5564975 GGGCACCCAGAGTGGGAATTGGG + Intronic
1092243704 12:6851227-6851249 GTGCATCCAGAGGTGGAATTGGG - Exonic
1092785621 12:12023905-12023927 AAGCATCCAGAGATGGAAATGGG + Intergenic
1096716548 12:53494792-53494814 AAGCTTGCAGAGGTGGAATTAGG - Intronic
1097703532 12:62845020-62845042 CAGAAGCCAGAGGTGGAATTTGG - Intronic
1099726441 12:86434727-86434749 GTGAATCCAAAGGCCGAATTTGG + Intronic
1104013127 12:124946291-124946313 GAGCATCCACAGTTGTAATTAGG - Intergenic
1104494517 12:129224509-129224531 GTGCAACCAGAGCTGGCTTTAGG + Intronic
1110195747 13:72785965-72785987 GTGCATCTAGAACTGTAATTTGG - Intronic
1119560737 14:75587543-75587565 GTGAATCCAGAGCTGGGATGAGG + Intronic
1119573956 14:75701572-75701594 GTGAATGCAGAGGAGGATTTTGG + Intronic
1122423278 14:101590647-101590669 GTGGATGCTGAGGTGGATTTGGG - Intergenic
1123137686 14:106044815-106044837 GTGGAACCAGAGTTTGAATTAGG + Intergenic
1124959454 15:34383626-34383648 GTGCAGCCAGAGGTGGTCCTGGG - Intronic
1124976080 15:34529847-34529869 GTGCAGCCAGAGGTGGTCCTGGG - Intronic
1126924469 15:53567622-53567644 GTGTATTCAGAAGTGGAATTTGG - Intronic
1127599973 15:60525475-60525497 GTGTATACAGAAGTGGAAGTGGG - Intronic
1128739520 15:70074063-70074085 GTGCATCGTGCTGTGGAATTTGG - Intronic
1129117063 15:73370226-73370248 CTCCATCCAGAGTAGGAATTTGG + Intergenic
1130389023 15:83438589-83438611 ATGCTACCAGAGGAGGAATTCGG - Intergenic
1131549990 15:93349117-93349139 TTGCCTCCAAAGGTGAAATTAGG - Intergenic
1132393835 15:101458025-101458047 GTCCCTCCAGAGGTGGAGCTGGG + Intronic
1133713967 16:8429175-8429197 GAGCATCCAGATGTAGCATTCGG + Intergenic
1135392155 16:22102917-22102939 GTGGATCAAGGGGTGGAATCAGG - Intronic
1135773692 16:25237383-25237405 GAGCAAGCTGAGGTGGAATTTGG - Exonic
1135990147 16:27213734-27213756 GTGCATGCAGAAGTGGAGGTGGG + Exonic
1140004853 16:71064793-71064815 GTCAATACAGAGGTGGACTTTGG - Exonic
1140130261 16:72154407-72154429 GAGGAGTCAGAGGTGGAATTTGG - Exonic
1141446604 16:84062852-84062874 GTCCTTCCAGACCTGGAATTCGG - Intronic
1142920674 17:3182662-3182684 GTCCATCCAGAGGTGGTACAGGG + Intergenic
1144043145 17:11430699-11430721 GTGCATCCAGAAATAGAAGTCGG - Intronic
1144729533 17:17518543-17518565 GTGCATCCAGAGGTGGTCAGGGG - Intronic
1147008089 17:37420917-37420939 GTGACTCCAGAGGCCGAATTTGG + Intronic
1151175022 17:72281030-72281052 GTGCATGCATAGGTGGAGGTGGG - Intergenic
1157620880 18:49016935-49016957 GTGCCTCCTGAGGAGGAACTAGG - Intergenic
1158696813 18:59710784-59710806 GTGCATACAGAGCTAGAGTTTGG + Intergenic
1158882935 18:61798526-61798548 TTGGATCCAAATGTGGAATTGGG - Intergenic
1160345794 18:78130814-78130836 GTGCACACACAGGTGGATTTGGG + Intergenic
1161722350 19:5910140-5910162 GTTCATCCAGAGGAGAAAATGGG - Exonic
1161904507 19:7146057-7146079 GTTCATCAAGAGGTGCAATAAGG - Intronic
1165003725 19:32787518-32787540 ATGCCCCCAGAGGTGGAATCTGG + Intronic
1165475876 19:36030537-36030559 GTGCAGCCAGAGTTGGATGTAGG - Intronic
1165620962 19:37247318-37247340 GTGATTCCAGAGGTGAAATAAGG + Exonic
1166300654 19:41910357-41910379 CAGCATCCAGAGGTGGAGTTGGG + Intronic
929260419 2:39861184-39861206 GTGCATAGAATGGTGGAATTAGG + Intergenic
930661248 2:54055741-54055763 ATGCACCCAGAGGTCCAATTTGG + Intronic
931998131 2:67858416-67858438 GTTCATTCAGAGTTGGAATTTGG - Intergenic
937824421 2:126351240-126351262 ATATATCCAGAAGTGGAATTGGG - Intergenic
939028161 2:137039089-137039111 GTGCAGCCAGAAGTTGAACTTGG + Intronic
948863407 2:240763711-240763733 GTGCCCCCAGAGCTGGACTTGGG + Intronic
1169475795 20:5930166-5930188 GTGCAGACAGAGGTGGCAGTGGG - Intergenic
1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG + Intergenic
1175435696 20:58945991-58946013 GTGGATCCAGAGATGGAGTGGGG + Intergenic
1181859565 22:25807750-25807772 CTTCATCTAGGGGTGGAATTTGG - Intronic
1182625735 22:31644631-31644653 GTGGAACCAGAGGTGGGATTAGG + Intronic
1182992531 22:34781872-34781894 GTGCATCCAGAGAGAGAAATGGG - Intergenic
1184521746 22:44998629-44998651 GTGTACCCAGAGCTGGGATTCGG - Intronic
951118645 3:18896279-18896301 AGGCATGCATAGGTGGAATTAGG - Intergenic
951925879 3:27908407-27908429 TTGCATCCAGAGGCGGAAAAAGG + Intergenic
956002249 3:64741759-64741781 GTCCAACCAGAAGTGGAATTTGG - Intergenic
957056723 3:75448941-75448963 GAGGATCCAGAGGTGGGATGTGG + Intergenic
959776795 3:110174409-110174431 GTGGACCAAGAGGTGGAAGTAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962317692 3:134368980-134369002 ATGCACCCAGAAGGGGAATTCGG - Intronic
964904352 3:161700954-161700976 GTGGGTCCAGAGGTGGCATCTGG - Intergenic
970616726 4:17774556-17774578 ATGCACCCAGAGGAGGTATTTGG - Intronic
971181975 4:24337233-24337255 GACCCTCCACAGGTGGAATTGGG - Intergenic
971198177 4:24488964-24488986 GTGCATCCAGAGATGGGCCTGGG - Intergenic
972275702 4:37555601-37555623 GTGGCTCGAGAGGTGGATTTTGG + Intronic
972679285 4:41289854-41289876 TTGAATCCAGAGGTGGAGGTTGG + Intergenic
973148497 4:46859701-46859723 GGGCAACCAGAGGTTGCATTTGG - Intronic
975029047 4:69591003-69591025 GTGTTCCCAGAGGTGGTATTTGG + Intronic
975807253 4:78125976-78125998 CTGCCCCCAGAGGTGGAATCTGG + Intronic
976455767 4:85245673-85245695 GTCCATGCAGAGGAGGAGTTTGG - Intergenic
977728813 4:100327689-100327711 GTAAATCCAGGGGTGGAACTAGG + Intergenic
979586205 4:122420740-122420762 GTGCATGTAGATGTGTAATTTGG - Intronic
979647778 4:123092235-123092257 GTGAAACCAGAGGCAGAATTAGG - Intronic
979976754 4:127206373-127206395 GAGCATCCAGGGGTGGATTGTGG - Intergenic
984372484 4:178884699-178884721 ATGCTTCCAGAGGAGGGATTAGG + Intergenic
984876865 4:184376621-184376643 GTGAAGACAGAGGTGGAGTTTGG + Intergenic
986157671 5:5192570-5192592 GTGCAGTCAGAGGTGGAATAAGG - Intronic
986245411 5:6002479-6002501 GTGTTTGCTGAGGTGGAATTGGG - Intergenic
986736884 5:10674621-10674643 GAGAATGCAGAGGTGCAATTGGG + Intergenic
989113386 5:37928590-37928612 GTGCAACCAAAGGAGGAAATGGG + Intergenic
992547685 5:77830992-77831014 GGGCATCCAGTGGTGTAACTTGG + Intronic
992676761 5:79112700-79112722 GTTCATCTGGAGCTGGAATTGGG - Intronic
993582366 5:89678124-89678146 GTGCATTCAGAAGTGCCATTTGG - Intergenic
993591514 5:89800948-89800970 CTGCCCCCAGAGGTGGAATCTGG - Intergenic
1000369230 5:160519134-160519156 GTGCAGACAGAGCTGGAATTGGG - Intergenic
1003642113 6:7884618-7884640 GTGCACCCAGTGGGAGAATTTGG - Intronic
1003814274 6:9819931-9819953 TTTCTTCCAGAGGTGGACTTTGG - Intronic
1008893185 6:56519706-56519728 GTGTCAACAGAGGTGGAATTGGG + Intronic
1013227837 6:108133398-108133420 GTGCATACAGAGTTGCCATTTGG + Intronic
1014276038 6:119390326-119390348 CTCCATCAAGAGGTGGAGTTTGG + Intergenic
1014869307 6:126572107-126572129 GAGCATCCATATGTGGCATTAGG + Intergenic
1015872588 6:137792275-137792297 GTGTATCAAGAGGTGGCAATAGG - Intergenic
1015961083 6:138650051-138650073 GTCTATCCAGATGTGGAGTTGGG - Intronic
1016588198 6:145713696-145713718 GTGTACCCAGAAGTGGAATATGG - Intronic
1016713397 6:147198240-147198262 GCGAATCCAGGGGTGGAATGCGG + Intergenic
1017671304 6:156771949-156771971 GTGCGGCCAGAGCTGGAATCGGG - Intergenic
1021930020 7:25571034-25571056 GGGGATCCAGAGGAAGAATTTGG + Intergenic
1022371492 7:29775814-29775836 GTGCATTCAGAGGAGGAATAGGG - Intergenic
1024291151 7:47805456-47805478 GTGCCCACAGAAGTGGAATTAGG + Intronic
1024943711 7:54787990-54788012 GGGCCTCCAGAGTTGGAAATGGG - Intergenic
1026893755 7:73998401-73998423 GGGCAGCCAGAGGTGGGAGTGGG + Intergenic
1027674780 7:81143719-81143741 GTGCATCCAGAGATGCATCTGGG - Intergenic
1029686908 7:102154955-102154977 ATGCATTCAGAGGAGGATTTAGG + Intronic
1032519958 7:132536406-132536428 GTGCATGCAGAGGTGGAGGTAGG - Intronic
1033145533 7:138867731-138867753 GTGTTTCCAGAGGTGGCACTCGG + Intronic
1035024929 7:155819016-155819038 GTTCATCCAGAGGTGGGAGAAGG + Intergenic
1035626480 8:1075002-1075024 GTGCAGCCAGGGGTGGAGTGGGG + Intergenic
1042396981 8:68304285-68304307 ATGTATCCAGAAGTGGAATTGGG - Exonic
1043313192 8:78887361-78887383 TTGCATGCAGAGGTAGAATTAGG + Intergenic
1046591897 8:116216921-116216943 ATGCATCCAGAGGTGAGAGTTGG - Intergenic
1050585161 9:7103281-7103303 GTGCATCAAGAAGTAGAATATGG - Intergenic
1052016503 9:23474587-23474609 GAGCATTCAGGGGTGGAAATGGG - Intergenic
1052359153 9:27535839-27535861 TTTCATCCAGAGGTTGAATTTGG - Intergenic
1058579728 9:106441832-106441854 ATGCAGCCAGAGGTTAAATTAGG - Intergenic
1185506368 X:634528-634550 GTGCATCCCGCGGTGGAAAGGGG - Intronic
1187251305 X:17600687-17600709 ATTCATGGAGAGGTGGAATTTGG + Intronic
1188982115 X:36735811-36735833 GAGCATCCAGAGGTAAGATTTGG - Intergenic
1193016455 X:76739106-76739128 GTTCATCCAGAGGTGCCCTTTGG - Intergenic
1193409083 X:81141196-81141218 GTGAATCCAGAGGTGCTATCTGG - Intronic
1193683666 X:84552300-84552322 GTGGGTCCAGAGGTGGTTTTGGG + Intergenic
1194229318 X:91302049-91302071 GTGCATCCAGAAGTGCCATCTGG - Intergenic
1199114020 X:143968752-143968774 GTGAATGGAGTGGTGGAATTAGG + Intergenic