ID: 1092243747

View in Genome Browser
Species Human (GRCh38)
Location 12:6851448-6851470
Sequence TATCAAGGAGGCGTCACCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 607}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092243747_1092243756 28 Left 1092243747 12:6851448-6851470 CCAGGGGTGACGCCTCCTTGATA 0: 1
1: 0
2: 2
3: 18
4: 607
Right 1092243756 12:6851499-6851521 GAGCCGTCCGTGGCAGGCTGAGG 0: 1
1: 0
2: 2
3: 11
4: 132
1092243747_1092243752 0 Left 1092243747 12:6851448-6851470 CCAGGGGTGACGCCTCCTTGATA 0: 1
1: 0
2: 2
3: 18
4: 607
Right 1092243752 12:6851471-6851493 AGGGTACTTCTGTTCAGTATCGG 0: 1
1: 0
2: 0
3: 9
4: 75
1092243747_1092243754 22 Left 1092243747 12:6851448-6851470 CCAGGGGTGACGCCTCCTTGATA 0: 1
1: 0
2: 2
3: 18
4: 607
Right 1092243754 12:6851493-6851515 GCCTGCGAGCCGTCCGTGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1092243747_1092243753 18 Left 1092243747 12:6851448-6851470 CCAGGGGTGACGCCTCCTTGATA 0: 1
1: 0
2: 2
3: 18
4: 607
Right 1092243753 12:6851489-6851511 ATCGGCCTGCGAGCCGTCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092243747 Original CRISPR TATCAAGGAGGCGTCACCCC TGG (reversed) Exonic
905105967 1:35563763-35563785 TGTGAAGCAGGCGTCACGCCTGG - Exonic
906893302 1:49741704-49741726 GATCAAGGGGGCTTCATCCCTGG + Intronic
908672960 1:66568671-66568693 GATCAAGCAGGCTTCATCCCTGG + Intronic
909382470 1:75015048-75015070 GATCAAGTAGGCTTCATCCCGGG - Intergenic
910308104 1:85789888-85789910 GATCAAGTTGGCTTCACCCCCGG - Intronic
910398831 1:86818123-86818145 GATCAAGTAGGCTTCATCCCTGG + Intergenic
910717742 1:90250794-90250816 TATCAAGTTGGCTTCATCCCTGG + Intergenic
910813145 1:91258215-91258237 GATCAAGTAGGCTTCATCCCTGG + Intergenic
911310391 1:96285654-96285676 AATCAAGTAGGCTTTACCCCTGG - Intergenic
911504355 1:98730063-98730085 GATCAAGTAGGCTTCATCCCTGG + Intronic
911744605 1:101426698-101426720 GATCAAGTAGGCTTCATCCCCGG - Intergenic
912000090 1:104821551-104821573 GATCAAGTAGGCTTCATCCCTGG + Intergenic
912133020 1:106625110-106625132 TATCAAGTTGGCTTCATCCCTGG - Intergenic
912884845 1:113460074-113460096 GATCAAGTAGGCTTCATCCCTGG + Intronic
913512864 1:119577993-119578015 GATCAAGTAGGCTTCATCCCTGG + Intergenic
915653958 1:157342628-157342650 GATCAAGTAGGCTTCATCCCTGG - Intergenic
916985610 1:170188177-170188199 AATCAAGTAGGCTTCATCCCTGG - Intergenic
917144685 1:171876451-171876473 TATCAAGGAGGCTTCACAACAGG - Intronic
917266976 1:173231249-173231271 GATCAAGTGGGCTTCACCCCTGG + Intergenic
917712147 1:177696309-177696331 TATCAAGTGGGCCTCATCCCTGG + Intergenic
917998244 1:180463860-180463882 GATCAAGTAGGCTTCATCCCTGG + Intronic
918159768 1:181887444-181887466 GATCAAGTGGGCTTCACCCCTGG - Intergenic
918943535 1:191031007-191031029 GATCAAGTAGGCTTCATCCCTGG + Intergenic
919164461 1:193874674-193874696 GATCAAGTAGGCTTCATCCCTGG + Intergenic
919436934 1:197573755-197573777 TATCAAGTCGGCTTCATCCCTGG + Intronic
921275620 1:213516567-213516589 GATCAAGTAGGCTTCATCCCTGG - Intergenic
922716361 1:227875619-227875641 GATCAAGGCGGCTTCATCCCTGG + Intergenic
923853796 1:237824331-237824353 GATCAAGTAGGCTTCATCCCTGG + Intronic
924926678 1:248690896-248690918 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1063562327 10:7140594-7140616 GATCAAGTGGGCGTCATCCCTGG + Intergenic
1063941010 10:11129215-11129237 TATCAAGTCGGCTTCATCCCTGG - Intronic
1064199285 10:13271292-13271314 TATCAATGATGGGTCACCACCGG + Intergenic
1064563532 10:16616670-16616692 GGTCAAGTAGGCTTCACCCCTGG + Intronic
1064848105 10:19678993-19679015 GATCAAGGTGGCTTCAACCCCGG - Intronic
1065074601 10:22064505-22064527 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1065606369 10:27422042-27422064 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1066150637 10:32612752-32612774 GATCAAGTCGGCTTCACCCCGGG - Intronic
1066495876 10:35941379-35941401 TATCAAGAAGGCGTCATCCCAGG + Intergenic
1066509438 10:36079931-36079953 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1066784829 10:38991940-38991962 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1067006492 10:42668940-42668962 GATCAAGCAGGCTTCATCCCTGG + Intergenic
1067191825 10:44077096-44077118 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1067193693 10:44094710-44094732 GATCAAGGTGGCTTCATCCCTGG + Intergenic
1069226850 10:65955725-65955747 GATCAAGTAGGCTTCATCCCTGG - Intronic
1069260258 10:66385745-66385767 GATCAAGTAGGCTTCATCCCTGG + Intronic
1069277216 10:66607611-66607633 GATCAAGGAGGCTTCATGCCTGG + Intronic
1069349780 10:67511532-67511554 AATCAAGTAGGCTTCATCCCTGG - Intronic
1071063100 10:81597360-81597382 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1071258874 10:83900845-83900867 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1071351176 10:84747207-84747229 GATCAAGCAGGCTTCATCCCTGG + Intergenic
1072364049 10:94690828-94690850 AATCAAGTAGGCTTCATCCCTGG + Intronic
1072394008 10:95019794-95019816 AATCAAGTTGGCTTCACCCCTGG - Intergenic
1074000277 10:109365207-109365229 GATCAAGTAGGCTTTACCCCTGG - Intergenic
1075925296 10:126246538-126246560 AATCAAGTAGGCTTCATCCCTGG + Intronic
1076158856 10:128225903-128225925 GATCAAGTTGGCTTCACCCCTGG - Intergenic
1076724897 10:132408697-132408719 TGTCAAGGAGCAGTCACCGCAGG + Intronic
1077952462 11:6975231-6975253 TATCAAGTGGGCTTCATCCCTGG - Intronic
1078339661 11:10489649-10489671 TATCAAGTAGGCAGCACCCAGGG - Intronic
1078952046 11:16145154-16145176 GATCAAGTGGGCTTCACCCCTGG + Intronic
1079474250 11:20812273-20812295 TATCAAGTAGGATTCATCCCAGG - Intronic
1079510214 11:21201964-21201986 GATCAAGTCGGCTTCACCCCTGG - Intronic
1079558615 11:21793199-21793221 TATCAAGTTGGCTTCATCCCTGG - Intergenic
1079934897 11:26605254-26605276 CATCAAGTTGGCTTCACCCCTGG - Intronic
1080346514 11:31331715-31331737 GATCAAGTAGGCTTCATCCCTGG - Intronic
1081064372 11:38521889-38521911 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1082184128 11:49159468-49159490 AATCAAGTAGGCTTCATCCCAGG - Intronic
1082286800 11:50326440-50326462 GATCAAGTGGGCGTCATCCCTGG - Intergenic
1082599907 11:55136495-55136517 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1082668748 11:56007817-56007839 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1082684167 11:56218116-56218138 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1082694269 11:56340843-56340865 AATCAAGTAGGCGTTACTCCTGG + Intergenic
1083073141 11:60007962-60007984 AATCAAGTCGGCTTCACCCCTGG - Intergenic
1083086667 11:60154882-60154904 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1083095899 11:60251050-60251072 GATCAAGGCGGCTTCATCCCTGG - Intergenic
1084327093 11:68406741-68406763 CGTCAAGGAGGCCTCAGCCCTGG + Exonic
1086422829 11:86654400-86654422 GATCAAGTGGGCTTCACCCCTGG + Intronic
1086442443 11:86842086-86842108 TATCAAGTCAGCTTCACCCCTGG + Intronic
1086526568 11:87734347-87734369 TATCAAGTAGGCTTCATCACAGG - Intergenic
1086608790 11:88728678-88728700 TATCAAGTCGGCTTCATCCCTGG + Intronic
1086682225 11:89685904-89685926 AATCAAGTAGGCTTCATCCCAGG + Intergenic
1086973848 11:93110932-93110954 GATCAAGTTGGCTTCACCCCTGG + Intergenic
1087293896 11:96347257-96347279 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1087363859 11:97195062-97195084 AATCAAGTAGGCTTCATCCCTGG - Intergenic
1087378832 11:97378756-97378778 AATCAAGTAGGCTTTACCCCTGG + Intergenic
1087560680 11:99785654-99785676 TATCAAGTCGACTTCACCCCTGG + Intronic
1087573788 11:99964495-99964517 TATCAAGTGGGCTTCATCCCTGG - Intronic
1087620105 11:100530926-100530948 GATCAAGTAGGCTTTACCCCTGG + Intergenic
1087925578 11:103914751-103914773 GATCAAGTTGGCGTCATCCCTGG + Intronic
1088012494 11:105019960-105019982 GATCAAGGGGGCTTCATCCCTGG + Intronic
1088418360 11:109614955-109614977 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1090315364 11:125782347-125782369 TATCAAGTTGGCTTCATCCCTGG + Intergenic
1090928118 11:131270081-131270103 TATCAAGTTGGCTTCATCCCTGG - Intergenic
1090933052 11:131316322-131316344 GATCAAGTTGGCTTCACCCCTGG + Intergenic
1092243747 12:6851448-6851470 TATCAAGGAGGCGTCACCCCTGG - Exonic
1092709314 12:11318010-11318032 GATCAAGTGGGCGTCATCCCTGG + Intergenic
1093477065 12:19567868-19567890 GATCAAGTGGGCTTCACCCCTGG + Intronic
1093717838 12:22403893-22403915 GATCAAGTTGGCGTCATCCCTGG + Intronic
1094135067 12:27116557-27116579 TATCAAGTTGGCATCATCCCAGG - Intergenic
1094206688 12:27847920-27847942 TATCAAGCTGGCTTCATCCCAGG - Intergenic
1094245590 12:28288536-28288558 AATCAAGGAGGCTTTATCCCTGG - Intronic
1094755767 12:33466526-33466548 TATCAAGTTGGCTTCATCCCTGG + Intergenic
1094875987 12:34643317-34643339 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1095356754 12:41283663-41283685 GATCAAGGTGGCTTCATCCCTGG + Intronic
1095542694 12:43329538-43329560 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1095553689 12:43474643-43474665 GATCAAGTAGGCTTCATCCCTGG + Intronic
1095610725 12:44124740-44124762 GATCAAGCAGGCTTCATCCCTGG - Intronic
1095713813 12:45319453-45319475 GATCAAGTAGGCTTCATCCCTGG - Intronic
1095720553 12:45395645-45395667 GATCAAGTAGGCTTCATCCCTGG + Intronic
1095836218 12:46641824-46641846 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1095911460 12:47430568-47430590 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1097543880 12:60974398-60974420 TATCAAGTGGGCTTCATCCCTGG - Intergenic
1097583308 12:61484743-61484765 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1097917127 12:65032786-65032808 GATCAAGTTGGCTTCACCCCTGG - Intergenic
1098053587 12:66479723-66479745 GATCAAGTAGGCTTCATCCCTGG + Intronic
1098116013 12:67177613-67177635 TATCAAGTTGGCTTCATCCCTGG + Intergenic
1098664893 12:73149959-73149981 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1098674411 12:73270608-73270630 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1098732708 12:74059352-74059374 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1099309696 12:81003079-81003101 GATCAAGTAGGCTTCATCCCTGG + Intronic
1099870958 12:88348568-88348590 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1100653292 12:96614167-96614189 GATCAAGGGGGCTTCATCCCTGG + Intronic
1100720377 12:97351746-97351768 AATCAAGTAGGCTTCATCCCTGG - Intergenic
1101313756 12:103610024-103610046 TATCAAGTGGGCTTCATCCCTGG - Intronic
1104155997 12:126132927-126132949 AATCAAGTAGGCTTTACCCCTGG - Intergenic
1105221668 13:18334930-18334952 CATGAAGGAAGCCTCACCCCAGG - Intergenic
1105430124 13:20329110-20329132 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1105474345 13:20717919-20717941 TGTCACTCAGGCGTCACCCCCGG - Intronic
1105776212 13:23663352-23663374 GATCAAGCAGGCTTCATCCCTGG - Intronic
1106492953 13:30245208-30245230 GATCAAGTTGGCTTCACCCCTGG + Intronic
1106817205 13:33421749-33421771 GATCAAGGTGGCTTCATCCCTGG + Intergenic
1106912931 13:34482603-34482625 TATCAAGTGGGCTTCATCCCTGG - Intergenic
1107157193 13:37182598-37182620 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1107577959 13:41747935-41747957 GATCAAGTGGGCTTCACCCCTGG - Intronic
1108172210 13:47753079-47753101 TATCAAGTTGGCTTCATCCCTGG + Intergenic
1108188415 13:47911751-47911773 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1108567027 13:51710091-51710113 GATCAAGTAGGCTTCATCCCTGG + Intronic
1108978031 13:56474135-56474157 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1109270278 13:60248235-60248257 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1109317052 13:60762278-60762300 GATCAAGTAGGCCTCATCCCCGG - Intergenic
1109916933 13:69001476-69001498 GATGAAGTAGGCTTCACCCCTGG + Intergenic
1109926747 13:69151653-69151675 TATCAAGGGGGGGCCTCCCCCGG - Intergenic
1110498199 13:76194015-76194037 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1110699459 13:78529846-78529868 GATCAAGGTGGCTTCATCCCTGG + Intergenic
1110790088 13:79578190-79578212 TATCAAGTTGGCTTCATCCCTGG - Intergenic
1110890624 13:80693403-80693425 GATCAAGTTGGCGTCATCCCTGG + Intergenic
1111457550 13:88504802-88504824 TATCAAGTAGGCTTTATCCCTGG - Intergenic
1112254084 13:97812875-97812897 GATCAAGTAGGCTTCACTCCTGG + Intergenic
1113033135 13:106016649-106016671 TATCAAGTGGGCTTCATCCCTGG - Intergenic
1113227233 13:108172576-108172598 GATCAAGTAGGCTTCATCCCCGG + Intergenic
1113974629 13:114217679-114217701 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1114425433 14:22617968-22617990 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1114562083 14:23600577-23600599 TATAAAGGAGGCGTCACACCTGG + Intergenic
1114608422 14:24017537-24017559 GATCAAGGTGGCTTCATCCCTGG + Intergenic
1115295017 14:31815872-31815894 TATCAAGTCGGCTTCATCCCTGG - Intronic
1116078336 14:40141902-40141924 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1116227277 14:42168379-42168401 TATCAAGTTGGCTTCATCCCTGG - Intergenic
1116334839 14:43644151-43644173 TATCAAGTGTGCTTCACCCCAGG + Intergenic
1116362935 14:44024880-44024902 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1117111393 14:52459720-52459742 AATCAAGTAGGCTTCATCCCTGG + Intronic
1117188128 14:53262764-53262786 GATCAAGAAGGCTTCATCCCTGG - Intergenic
1117194060 14:53321855-53321877 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1117577675 14:57115872-57115894 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1117640166 14:57789799-57789821 TATCAAGTTGGCTTCATCCCTGG + Intronic
1118078221 14:62326467-62326489 TATCAAGTGGGCTTCATCCCTGG - Intergenic
1120118611 14:80650755-80650777 GATCAAGCAGGCTTCATCCCTGG - Intronic
1120271422 14:82318420-82318442 AATCAAGTAGGCTTCATCCCTGG - Intergenic
1123161252 14:106280198-106280220 GATCAAGTAGGCTTTACCCCTGG + Intergenic
1123179521 14:106455709-106455731 GATCAAGTAGGCTTTACCCCTGG - Intergenic
1202842525 14_GL000009v2_random:135486-135508 GATCAAGTCGGCTTCACCCCTGG - Intergenic
1202911914 14_GL000194v1_random:125727-125749 GATCAAGTCGGCTTCACCCCTGG - Intergenic
1123609336 15:22073263-22073285 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1124197281 15:27642900-27642922 AATCAAGTTGGCTTCACCCCTGG + Intergenic
1126159610 15:45597991-45598013 GATCAAGTAGGCTTCATCCCTGG + Intronic
1126871368 15:52991900-52991922 AATCAAGTAGGCTTCATCCCAGG - Intergenic
1127125367 15:55806429-55806451 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1127330697 15:57936813-57936835 AATCAAGTAGGCTTCATCCCTGG - Intergenic
1127570951 15:60240964-60240986 AATCAAGTGGGCTTCACCCCTGG + Intergenic
1127855994 15:62953946-62953968 AATCAAGGAGGTGACACCCAAGG + Intergenic
1129468804 15:75738829-75738851 CTTCAAGTAGGCGCCACCCCGGG + Intergenic
1129489702 15:75912109-75912131 AATCAAGTCGGCTTCACCCCTGG - Intronic
1129584990 15:76853466-76853488 AATCAAGTAGGCTTCATCCCCGG + Intronic
1130029815 15:80302247-80302269 GATCAAGTAGGCTTCACCCCTGG - Intergenic
1131924267 15:97364655-97364677 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1202981575 15_KI270727v1_random:365048-365070 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1135268054 16:21045011-21045033 GATCAAGTAGGCTTCATCCCTGG - Intronic
1135595770 16:23741731-23741753 TATCAATAAGGGATCACCCCAGG - Intergenic
1136366609 16:29812006-29812028 TAAGAAGGAGGCGTCTCTCCTGG + Intronic
1136695158 16:32073327-32073349 GATCAAGTAGGCTTTACCCCTGG + Intergenic
1136795657 16:33016586-33016608 GATCAAGTAGGCTTTACCCCTGG + Intergenic
1136874264 16:33837795-33837817 GATCAAGTAGGCTTTACCCCTGG - Intergenic
1137000724 16:35228084-35228106 GATCAAGTGGGCGTCATCCCTGG - Intergenic
1137224845 16:46493645-46493667 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1137239643 16:46644637-46644659 TATCAAGTTGGCTTCATCCCTGG + Intergenic
1137503762 16:49032492-49032514 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1138711941 16:58979845-58979867 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1138776071 16:59725604-59725626 GATCAAGTAGGCTTCATCCCTGG - Intronic
1139299093 16:65929200-65929222 GATCAAGTCGGCTTCACCCCTGG + Intergenic
1139683716 16:68585815-68585837 GATCAAGTGGGCGTCATCCCTGG - Intergenic
1142256347 16:89015537-89015559 TATGCAGGTGGCTTCACCCCTGG + Intergenic
1203097914 16_KI270728v1_random:1278244-1278266 GATCAAGTAGGCTTTACCCCTGG + Intergenic
1145417353 17:22729522-22729544 CATCAAGTAGGCTTCATCCCTGG - Intergenic
1149395463 17:56237097-56237119 AATCAAGTAGGCTTCATCCCTGG - Intronic
1149737543 17:59010138-59010160 TCTCAAGGAGTGGTCACCTCTGG + Intronic
1153313070 18:3696534-3696556 GATCAAGTAGGCTTCATCCCTGG - Intronic
1153371729 18:4324672-4324694 AATCAAGTAGGCTTTACCCCTGG + Intronic
1154182875 18:12152389-12152411 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1154403787 18:14068778-14068800 GATCAAGTGGGCGTCATCCCTGG + Intronic
1156115753 18:33785479-33785501 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1156116300 18:33790677-33790699 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1156956719 18:42975358-42975380 GATCAAGTAGGCCTCATCCCTGG - Intronic
1157010611 18:43644019-43644041 TATCAAGTGGGCTTCATCCCTGG + Intergenic
1158968313 18:62643138-62643160 GGTCAAGGAGCCGTCACCACTGG - Intergenic
1160372294 18:78383838-78383860 TATCATGGAGGCCACACCCATGG + Intergenic
1160692886 19:467884-467906 CATCTCGGAGGGGTCACCCCAGG + Intronic
1161178854 19:2866070-2866092 AATCAAGGAGGCATAATCCCTGG - Intergenic
1161898056 19:7097502-7097524 GATAAAGGAGGGGTCACCGCAGG - Intergenic
1162502932 19:11064827-11064849 TATTTAGAAGGAGTCACCCCTGG + Intronic
1163188587 19:15658759-15658781 CATCAAGGAGAGGTCACCTCTGG + Exonic
1163216205 19:15879374-15879396 CATCAAGGAGAGGTCACCTCTGG - Exonic
1163220385 19:15914333-15914355 CATCAAGGAGAGGTCACCTCTGG - Exonic
1164110924 19:22157860-22157882 GATCAAGTTGGCTTCACCCCTGG - Intergenic
1164495859 19:28760652-28760674 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1167933806 19:52890398-52890420 TACAAAGGAGGCCTCACCCTGGG + Intronic
925078911 2:1044727-1044749 TATCAAGTAGGCTTTATCCCTGG - Intronic
926557748 2:14379319-14379341 GATCAAGCAGGCTTCATCCCTGG + Intergenic
926648915 2:15320051-15320073 GATCAAGTAGGCTTCATCCCTGG + Intronic
927035009 2:19165308-19165330 GATCAAGTGGGCTTCACCCCTGG + Intergenic
928127225 2:28625247-28625269 TACCAAGGAGGCGCCTGCCCTGG + Intronic
928629261 2:33173809-33173831 GATCAAGGGGGCTTCATCCCTGG + Intronic
929280128 2:40068968-40068990 AATCAAGTAGGCTTCACCTCCGG - Intergenic
930546142 2:52769582-52769604 TATCAAGTTGGCTTCATCCCTGG + Intergenic
930673357 2:54174866-54174888 GATCAAGTAGGCTTCATCCCTGG - Intronic
930835628 2:55790452-55790474 GATCAAGTAGGCTTCATCCCTGG - Intergenic
930904832 2:56553937-56553959 AATCAAGTAGGCTTCATCCCTGG - Intergenic
931124804 2:59263250-59263272 GATCAAGTGGGCTTCACCCCTGG + Intergenic
931925595 2:67068699-67068721 GATCAAGTAGGCTTCATCCCTGG - Intergenic
932380032 2:71274051-71274073 GATCAAGTAGGCTTCATCCCTGG + Intergenic
932853021 2:75205407-75205429 AATCAAGTAGGCTTTACCCCTGG - Intergenic
933347691 2:81110368-81110390 GATCAAGTAGGCTTCAACCCTGG + Intergenic
933385245 2:81602250-81602272 TATCAAGGAGGCATCCTCCATGG - Intergenic
934012774 2:87841863-87841885 GATCAAGTAGGCTTCATCCCTGG + Intergenic
934152881 2:89165619-89165641 GATCAAGGTGGCTTCATCCCTGG - Intergenic
934812905 2:97298844-97298866 GATCAAGTAGGCTTCATCCCTGG + Intergenic
934824790 2:97409636-97409658 GATCAAGTAGGCTTCATCCCTGG - Intergenic
934998998 2:98992857-98992879 GATCAAGTGGGCTTCACCCCTGG + Intergenic
935019958 2:99220684-99220706 GATCAAGTAGGCTTCATCCCTGG + Intronic
935710667 2:105895388-105895410 TATTAAGGAACCGGCACCCCAGG + Intergenic
935717400 2:105951506-105951528 GATAAAGGAGGCATCATCCCAGG + Intergenic
935834989 2:107040824-107040846 GATCAAGTAGGCTTCATCCCTGG + Intergenic
936142978 2:109956753-109956775 GATCAAGTTGGCTTCACCCCTGG + Intergenic
936179666 2:110254719-110254741 GATCAAGTTGGCTTCACCCCTGG + Intergenic
936201710 2:110414714-110414736 GATCAAGTTGGCTTCACCCCTGG - Intronic
936418660 2:112343684-112343706 TATCAACCAGTCGTCACCCCAGG + Intergenic
936638616 2:114287390-114287412 GATCAAGTAGGCTTCATCCCTGG + Intergenic
936862626 2:117035721-117035743 GATCAAGTAGGCTTCATCCCTGG + Intergenic
936910255 2:117583486-117583508 GATCAAGTAGGCTTCATCCCTGG + Intergenic
937063657 2:119000208-119000230 GATCAAGGGGGCTTCATCCCTGG + Intergenic
937799230 2:126061642-126061664 AATCAAGTAGGCTTCATCCCTGG + Intergenic
937839471 2:126511155-126511177 ACTCAAGGAGGCGTCAGCCTGGG - Intergenic
939030763 2:137072941-137072963 GATCAAGTAGGCTTCATCCCTGG - Intronic
939425114 2:142025616-142025638 TATCCAAGATGGGTCACCCCGGG + Intronic
939796059 2:146645639-146645661 AATCAAGTAGGCTTCATCCCTGG + Intergenic
939975132 2:148708648-148708670 TATCAAGTTGGCTTCATCCCTGG + Intronic
940144466 2:150531802-150531824 TAGCAAGGACGAGTCACTCCAGG - Intronic
940693711 2:156952874-156952896 GATCAAGTAGGCTTCATCCCTGG - Intergenic
940716065 2:157225076-157225098 TATCAAGTAGGCTTCATCACAGG + Intergenic
941560986 2:167044079-167044101 TATCAAGTAGTCTTCATCCCTGG + Intronic
941704898 2:168647848-168647870 GATCAAGTAGGCTTCATCCCCGG - Intronic
942336471 2:174892348-174892370 TATAAAAGAGGCTTCACCCAGGG + Intronic
943368634 2:186988297-186988319 GATCAAGTAGGCTTCATCCCTGG - Intergenic
943438877 2:187901425-187901447 GATCAAGTAGGCTTCATCCCTGG + Intergenic
943514379 2:188866069-188866091 AATCAAGTTGGCTTCACCCCTGG + Intergenic
943946372 2:194070793-194070815 GATCAAGTAGGCTTCATCCCTGG - Intergenic
944000963 2:194836935-194836957 TATCAAGTGGGCTTCATCCCTGG - Intergenic
944030210 2:195226441-195226463 TATCAAGTGGGCTTCATCCCTGG + Intergenic
944392519 2:199231587-199231609 GATCAAGTAGGCTTCATCCCTGG - Intergenic
945533156 2:210981119-210981141 GATCAAGTAGGCTTCATCCCTGG - Intergenic
947146261 2:227068521-227068543 GATCAAGTGGGCTTCACCCCTGG + Intronic
947193987 2:227542496-227542518 GATCAAGCTGGCTTCACCCCTGG - Intronic
947438263 2:230092039-230092061 AATCAAGTAGGCTTCATCCCTGG + Intergenic
947479831 2:230488858-230488880 GATCAAGTAGGCTTCATCCCTGG - Intronic
949054420 2:241918867-241918889 AATCAAGTAGGCCTCATCCCTGG + Intergenic
1169980947 20:11383337-11383359 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1170053168 20:12169498-12169520 AATCAAGTAGGCTTCATCCCTGG - Intergenic
1171065744 20:22013235-22013257 GATCAAGTGGGCTTCACCCCCGG + Intergenic
1171197959 20:23215967-23215989 CATCAAAGAGGCGTCCACCCAGG + Intergenic
1171733496 20:28740133-28740155 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1173389253 20:42617276-42617298 GATCAAGTAGGCTTCATCCCTGG - Intronic
1175555813 20:59855570-59855592 TTTCAAGTGGGCGTCATCCCTGG - Intergenic
1176631274 21:9140394-9140416 GATCAAGTCGGCTTCACCCCTGG - Intergenic
1177351387 21:19946463-19946485 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1178046552 21:28700952-28700974 GATCAAGGAGGCTTTATCCCTGG + Intergenic
1179418597 21:41217855-41217877 TGTCATGGAGGCGTGTCCCCAGG - Intronic
1180250031 21:46578793-46578815 GATCAAGGTGGCCTCATCCCTGG - Intergenic
1180254447 21:46614851-46614873 GATCAAGGAGGCTTTATCCCTGG - Intergenic
1180575493 22:16769763-16769785 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1181469425 22:23128596-23128618 TAACCAGGAGGGGGCACCCCAGG - Intronic
1181896696 22:26115266-26115288 AATCAAGGAGGCCTCTCTCCTGG + Intergenic
1182152331 22:28037321-28037343 GATCAAGTAGGCTTCATCCCTGG + Intronic
1182179887 22:28336176-28336198 GATCAAGCAGGCTTCATCCCTGG - Intronic
1182817155 22:33175136-33175158 GATCAAGTCGGCTTCACCCCTGG + Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184875114 22:47269450-47269472 TCTCAAGGAGGCCTCAGCCTTGG + Intergenic
1184980170 22:48090128-48090150 TAGGAAGGAGGCGGCAGCCCAGG - Intergenic
949401900 3:3673630-3673652 GATCAAGTGGGCTTCACCCCTGG + Intergenic
949846452 3:8375680-8375702 GATCAAGTTGGCTTCACCCCTGG + Intergenic
951233553 3:20208172-20208194 GATCAAGTAGGCTTCATCCCTGG - Intergenic
951997917 3:28752028-28752050 AATCAAGTAGGCTTCATCCCGGG + Intergenic
952550245 3:34468635-34468657 GATCAAGTAGGCTTCATCCCTGG - Intergenic
952673310 3:35996992-35997014 GATCAAGTAGGCTTCATCCCTGG - Intergenic
953047800 3:39311021-39311043 GATCAAGTTGGCTTCACCCCTGG - Intergenic
953218729 3:40947618-40947640 AATCAAGTAGGCTTCATCCCTGG - Intergenic
953478532 3:43227832-43227854 GATCAAGTAGGCTTCATCCCTGG + Intergenic
954596317 3:51828511-51828533 GATCAAGTAGGCTTCATCCCTGG - Intronic
955282767 3:57610038-57610060 AATCAAGTAGGCTTCATCCCTGG + Intergenic
956156989 3:66308872-66308894 GATCAAGCAGGCTTCATCCCTGG - Intronic
956355192 3:68383518-68383540 GATCAAGTAGGCTTCACCCCTGG - Intronic
956386144 3:68721733-68721755 AATCAAGGTGGCTTCATCCCTGG - Intergenic
956926489 3:73994501-73994523 GATCAAGTGGGCTTCACCCCTGG + Intergenic
957005031 3:74935017-74935039 GATCAAGTGGGCTTCACCCCTGG - Intergenic
957865741 3:86020641-86020663 TATCAAGTGGGCTTCATCCCTGG + Intronic
957930598 3:86873538-86873560 TATCAAGTCGGCTTCACCCCTGG - Intergenic
958015045 3:87930623-87930645 AATCAAGTAGACTTCACCCCAGG - Intergenic
958015647 3:87937274-87937296 GATCAAGTAGGCTTCATCCCAGG + Intergenic
958082478 3:88764258-88764280 AATCAAGTAGGCTTCATCCCTGG - Intergenic
958663555 3:97104482-97104504 GATCAAGTAGGCTTCATCCCTGG - Intronic
958759230 3:98287993-98288015 TATCAAGTAGGCTTCAACCCTGG - Intergenic
958769130 3:98405818-98405840 TATCAGGTAGGCTTCATCCCTGG + Intergenic
958956918 3:100474711-100474733 AATCAAGTAGGCTTCATCCCTGG - Intergenic
959290367 3:104466175-104466197 GATCAAGTGGGCTTCACCCCTGG - Intergenic
959718323 3:109458257-109458279 GATCAAGTAGGCTTCATCCCTGG - Intergenic
959766911 3:110042078-110042100 GATCAAGTAGGCTTCATCCCTGG - Intergenic
960566140 3:119133875-119133897 GATCAAGTTGGCTTCACCCCTGG + Intronic
961818087 3:129561521-129561543 CACCAAGGAGGCCTCAGCCCAGG + Intronic
963614955 3:147525015-147525037 AATCAAGGAGGCTTTATCCCTGG - Intergenic
963925735 3:150949012-150949034 AATCAAGTAGGCTTCATCCCTGG + Intronic
963979603 3:151522494-151522516 AATCAAGTAGGCTTCATCCCTGG + Intergenic
963993667 3:151682071-151682093 GATCAAGAAGGCTTCATCCCTGG + Intergenic
964574215 3:158146466-158146488 GATCAAGTAGGCTTCATCCCTGG - Intronic
964581519 3:158244458-158244480 GATCAAGCAGGCTTCATCCCTGG - Intronic
964860137 3:161192648-161192670 GATCAAGGGGGCTTCATCCCTGG - Intronic
965318103 3:167215783-167215805 GATCAAGTAGGCTTCATCCCTGG + Intergenic
965497745 3:169418550-169418572 GATCAAGTCGGCTTCACCCCTGG + Intronic
965618375 3:170617973-170617995 GATCAAGTCGGCTTCACCCCGGG - Intronic
965880810 3:173385939-173385961 AATCAAGTAGGCTTCATCCCTGG + Intergenic
966477897 3:180371165-180371187 AATCAAGTAGGCTTCATCCCTGG + Intergenic
966487591 3:180488489-180488511 GATCAAGTAGGCTTCATCCCTGG + Intergenic
967396248 3:189012460-189012482 TATCAAGTAGGCTTCATCCCTGG - Intronic
967502744 3:190218928-190218950 AATCAAGTAGGCTTCATCCCTGG - Intergenic
968250815 3:197211445-197211467 AATCAAGTAGGCTTCATCCCGGG + Intronic
970476751 4:16431437-16431459 TATCAAGGAGGAGTCTCCATGGG - Intergenic
972855106 4:43096669-43096691 GATCAAGGGGGCTTCATCCCTGG + Intergenic
973046817 4:45544014-45544036 GATCAAGTAGGCTTCATCCCTGG + Intergenic
973050382 4:45588251-45588273 GATCAAGGCGGCTTCATCCCTGG + Intergenic
973708903 4:53606760-53606782 GATCAAGTAGGCTTCATCCCTGG + Intronic
974114282 4:57561629-57561651 GATCAAGAAGGCTTCATCCCTGG - Intergenic
974261726 4:59533391-59533413 GATCAAGCGGGCTTCACCCCTGG + Intergenic
974325970 4:60415723-60415745 AATCAAGTAGGCTTCATCCCTGG - Intergenic
975008968 4:69324658-69324680 AATCAAGTTGGCTTCACCCCAGG + Intronic
976506140 4:85849785-85849807 GATCAAGTGGGCTTCACCCCTGG - Intronic
976903231 4:90205534-90205556 AATCAAGTAGGCTTCATCCCTGG - Intronic
976925619 4:90491854-90491876 TATCAAGTGGGCTTCATCCCTGG - Intronic
976957203 4:90915319-90915341 GATCAAGTAGGCTTCATCCCTGG + Intronic
977425901 4:96866661-96866683 TATCAAGTCGGCTTCATCCCTGG + Intergenic
977677880 4:99767778-99767800 GATCAAGTAGGCTTCATCCCTGG - Intergenic
977755630 4:100668280-100668302 GATCAAGTAGGCTTCATCCCTGG - Intronic
977775996 4:100919956-100919978 GATCAAGTAGGCTTCATCCCTGG + Intergenic
977888230 4:102276792-102276814 GATCAAGTAGGCTTCATCCCTGG + Intronic
977951199 4:102972294-102972316 TATCAAGTCGGCTTCATCCCTGG + Intronic
978004504 4:103599792-103599814 GATCAAGGGGGCTTCATCCCTGG - Intronic
978039307 4:104039749-104039771 GATCAAGGGGGCTTCATCCCTGG + Intergenic
978064290 4:104377336-104377358 GATCAAGGGGGCTTCATCCCTGG + Intergenic
978163585 4:105579568-105579590 AATCAAGTAGGCTTCATCCCTGG - Intronic
978208545 4:106108411-106108433 GATCAAGTAGGCTTCATCCCCGG + Intronic
978277977 4:106975079-106975101 AATCAAGGTGGCTTCATCCCTGG - Intronic
978743155 4:112161963-112161985 TATCAAGTGGGCTTCATCCCTGG + Intronic
978854548 4:113379516-113379538 TATAATGGAGGCTTAACCCCTGG + Intronic
979012172 4:115386330-115386352 CATCAAGTAGGCTTCATCCCTGG - Intergenic
979116718 4:116833522-116833544 TATCAAGTAGGATTCATCCCTGG + Intergenic
979976395 4:127201636-127201658 GATCAAGTAGGCTTCATCCCTGG + Intergenic
979981631 4:127263421-127263443 GATCAAGTAGGCTTCATCCCTGG - Intergenic
980477560 4:133337212-133337234 GATCAAGTAGGCTTCATCCCCGG - Intergenic
980647395 4:135660132-135660154 TATCAAATAGGCTTCATCCCTGG - Intergenic
980887766 4:138781958-138781980 GATCAAGCAGGCCTCATCCCTGG - Intergenic
981188835 4:141837426-141837448 GATCAAGTGGGCTTCACCCCTGG + Intergenic
981338211 4:143590575-143590597 GATCAAGTAGGCTTCATCCCTGG - Intronic
981513022 4:145578137-145578159 GATCAAGTAGGCTTCATCCCTGG + Intergenic
981514592 4:145593656-145593678 GATCAAGTAGGCTTCATCCCTGG - Intergenic
982874192 4:160624971-160624993 GATCAAGGCGGCTTCATCCCTGG + Intergenic
983435372 4:167708454-167708476 GATCAAGTAGGCTTCATCCCTGG - Intergenic
983487443 4:168348818-168348840 GATCAAGTAGGCTTCATCCCTGG - Intergenic
984217937 4:176937350-176937372 GATCAAGTTGGCGTCATCCCTGG - Intergenic
984894426 4:184524783-184524805 AATCAAGTAGGCTTCATCCCTGG - Intergenic
985072616 4:186182719-186182741 GATCAAGTGGGCTTCACCCCTGG - Intergenic
985193642 4:187404737-187404759 GATCAAGTAGGCTTCATCCCTGG - Intergenic
985204878 4:187524559-187524581 TATCAAGTTGGCTTCATCCCTGG + Intergenic
986014288 5:3744201-3744223 CATCATGGAGGCGTGGCCCCAGG + Intergenic
986906899 5:12505485-12505507 AATCAAGTAGGCTTCATCCCTGG - Intergenic
988593298 5:32567836-32567858 TAAAAAGGAGGCCACACCCCAGG - Intronic
988840491 5:35078862-35078884 GATCAAGTAGGCTTCATCCCTGG + Intronic
989651360 5:43694617-43694639 AATCAAGTAGGCTTCATCCCAGG - Intronic
989940994 5:50149541-50149563 GATCAAGTAGGCTTCATCCCTGG + Intergenic
989950918 5:50296380-50296402 GATCAAGTGGGCTTCACCCCTGG + Intergenic
990648134 5:57867699-57867721 GATCAAGCAGGCTTCATCCCTGG - Intergenic
991167935 5:63585576-63585598 GATCAAGTGGGCTTCACCCCTGG + Intergenic
991241584 5:64467097-64467119 GATCAAGTGGGCTTCACCCCTGG - Intergenic
991243039 5:64480898-64480920 GATCAAGTGGGCTTCACCCCTGG + Intergenic
991488702 5:67163955-67163977 TATGCAGGAGGCGCCACCGCTGG + Exonic
992183182 5:74218247-74218269 TATCAAGCTGGCTTCATCCCTGG + Intergenic
992345613 5:75874208-75874230 GATCAAGTAGGCTTCATCCCTGG + Intergenic
992355683 5:75980518-75980540 TGTCAAGTAGGCTTCATCCCCGG + Intergenic
993043773 5:82844403-82844425 AATCAAGGTGGCTTCATCCCTGG - Intergenic
993301279 5:86214050-86214072 GATCAAGTAGGCTTCATCCCCGG + Intergenic
993366418 5:87039374-87039396 GATCAAGCAGGCTTCATCCCTGG - Intergenic
993420576 5:87696330-87696352 GATCAAGTAGGCTTCATCCCTGG + Intergenic
993435247 5:87884918-87884940 TATCAAGTTGGCTTCATCCCTGG - Intergenic
993692074 5:91014214-91014236 GATCAAGTAGGCTTCAGCCCCGG - Intronic
993821264 5:92619800-92619822 TATCAAGTCGGCTTCATCCCTGG - Intergenic
994277710 5:97858825-97858847 GATCAAGTAGGCTTCATCCCTGG + Intergenic
994897589 5:105725437-105725459 AATCAAGTAGGCTTCATCCCTGG + Intergenic
995428920 5:112053196-112053218 GATCAAGTAGGCTTCATCCCTGG + Intergenic
995644230 5:114293529-114293551 GATCAAGTGGGCGTCATCCCTGG - Intergenic
995959252 5:117819634-117819656 GATCAAGTAGGCTTCATCCCCGG + Intergenic
996306015 5:122048382-122048404 GATCAAGTGGGCTTCACCCCTGG - Intronic
996784169 5:127220364-127220386 GATCAAGTAGGCTTCATCCCTGG + Intergenic
996906509 5:128607153-128607175 GATCAAGTAGGCTTCATCCCTGG - Intronic
996935106 5:128939941-128939963 TATCAAGTGGGCTTCATCCCTGG - Intronic
997053283 5:130408747-130408769 GATCAAGTAGGCTTCATCCCTGG - Intergenic
998294716 5:140956487-140956509 GATCAAGTAGGCTTCATCCCTGG - Intronic
999607195 5:153328981-153329003 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1002369190 5:178737103-178737125 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1005373836 6:25161975-25161997 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1005845077 6:29770835-29770857 TACCTAGGAGGGGACACCCCTGG - Intergenic
1007314516 6:40975593-40975615 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1008238359 6:49077033-49077055 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1008332108 6:50257828-50257850 TATCAAGTAGGCATTATCCCTGG - Intergenic
1008467893 6:51851234-51851256 TATCAAGTCGGCTTCATCCCTGG - Intronic
1009233577 6:61095475-61095497 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1009330747 6:62416953-62416975 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1009511792 6:64560994-64561016 GATCAAGCAGGCTTCATCCCTGG + Intronic
1009519175 6:64660040-64660062 GATCAAGCAGGCTTCATCCCTGG + Intronic
1009634547 6:66248662-66248684 TATCAAGTTGGCTTCATCCCTGG + Intergenic
1009727518 6:67554696-67554718 AATCAAGCTGGCTTCACCCCTGG - Intergenic
1009946138 6:70343557-70343579 TATCAAGTAGGCTTTATCCCTGG - Intergenic
1010178219 6:73054497-73054519 TATCAAGGAGGCTTCGTCCCTGG + Intronic
1010334406 6:74663799-74663821 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1010351994 6:74885620-74885642 GATCAAGTAGGCCTCATCCCTGG - Intergenic
1010526121 6:76902547-76902569 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1010531970 6:76979634-76979656 TATCAAGTCGGCTTCATCCCTGG - Intergenic
1010721561 6:79288455-79288477 TATCAAGTGGGCTTCATCCCTGG + Intergenic
1010820997 6:80415608-80415630 TATCAAGTAGGCTTTATCCCTGG - Intergenic
1011147749 6:84237309-84237331 GATCAAGTTGGCGTCATCCCTGG + Intergenic
1012082719 6:94781774-94781796 GATCAAGTTGGCTTCACCCCTGG - Intergenic
1012155771 6:95818290-95818312 GATCAAGTAGGCTTCATCCCAGG + Intergenic
1012345159 6:98176661-98176683 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1012363600 6:98412655-98412677 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1012372209 6:98521653-98521675 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1012744263 6:103064357-103064379 GATCAAGTAGGCTTCATCCCAGG - Intergenic
1012870445 6:104666966-104666988 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1014461947 6:121706734-121706756 AATCAAGGTGGCTTCAGCCCTGG + Intergenic
1014529229 6:122539519-122539541 GATCAAGTAGGCTTCATCCCTGG - Intronic
1014852450 6:126358544-126358566 AATCAAGGAGGCTTCATTCCTGG - Intergenic
1014872266 6:126611337-126611359 AATCAAGGTGGCTTCATCCCTGG - Intergenic
1015076840 6:129169499-129169521 GATCAAGTAGGCTTCATCCCTGG - Intronic
1015291500 6:131542692-131542714 CATCAAGTCGGCTTCACCCCTGG + Intergenic
1016600470 6:145853034-145853056 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1016778103 6:147928003-147928025 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1017279973 6:152612801-152612823 GATCAAGCTGGCTTCACCCCTGG + Intronic
1017357993 6:153532676-153532698 TATAAAGGAGGCTTCATTCCTGG - Intergenic
1018015384 6:159707922-159707944 GATCAAGGGGGCGTCATCCCTGG + Intronic
1020428974 7:8099932-8099954 TATCAAGTTGGCTTCATCCCTGG + Intergenic
1020574132 7:9903863-9903885 GATCAAGTTGGCTTCACCCCTGG + Intergenic
1021967527 7:25935734-25935756 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1022370510 7:29766628-29766650 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1022539853 7:31125451-31125473 TATGCAGGATGCGTCAACCCTGG - Intergenic
1022616025 7:31930890-31930912 TATCAAGTTGGCTTCATCCCTGG + Intronic
1022878093 7:34556336-34556358 GATCAAGTAGGCTTTACCCCTGG + Intergenic
1023234921 7:38075169-38075191 AATCAAGGAGGCTTCATCCCTGG - Intergenic
1024907594 7:54405580-54405602 GATCAAGTTGGCTTCACCCCTGG - Intergenic
1024990173 7:55228124-55228146 AATCAAGTAGGCTTCATCCCTGG - Intronic
1025521019 7:61730018-61730040 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1025545373 7:62159579-62159601 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1027688521 7:81310089-81310111 GATCAAGTAGGCTTCATCCCCGG + Intergenic
1028159448 7:87469027-87469049 GATCAAGTGGGCTTCACCCCTGG + Intronic
1028433089 7:90770891-90770913 TCTTAAGTAGGCGTCACCCTTGG + Intronic
1029334080 7:99885706-99885728 TATCAAGTAGGCTTTACCCCTGG + Intronic
1029955834 7:104638728-104638750 GATCAAGTAGGCTTCATCCCAGG - Intronic
1030132423 7:106213753-106213775 TATCAAGTGGGCTTCATCCCTGG + Intergenic
1030154408 7:106438801-106438823 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1030268810 7:107648667-107648689 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1030534391 7:110747552-110747574 GATCAAGGTGGCTTCATCCCTGG + Intronic
1030696664 7:112592309-112592331 AATCAAGTAGGCTTCATCCCAGG + Intergenic
1031366319 7:120904506-120904528 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1032407934 7:131670924-131670946 TATAAAGGAAGCTTGACCCCTGG + Intergenic
1033484194 7:141772279-141772301 GATCAAGCAGGCTTCATCCCTGG - Intronic
1034216513 7:149411170-149411192 GATTAAGGAGGCTTCATCCCTGG - Intergenic
1036206290 8:6807693-6807715 TATCCATGACGCTTCACCCCAGG - Intergenic
1037164060 8:15805661-15805683 GATCAAGTAGGCTTCACTCCTGG - Intergenic
1037207245 8:16337966-16337988 TATCAAGTGGGCTTCATCCCTGG - Intronic
1038031663 8:23647529-23647551 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1039169462 8:34726032-34726054 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1039326082 8:36486976-36486998 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1040078342 8:43262917-43262939 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1040090454 8:43393394-43393416 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1040521714 8:48182299-48182321 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1041412118 8:57568109-57568131 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1041715862 8:60931389-60931411 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1041764214 8:61400869-61400891 AATCAAGTAGGCTTCATCCCTGG - Intronic
1042232877 8:66576881-66576903 GATCAAGCAGGCTTCATCCCTGG + Intronic
1042473451 8:69217818-69217840 AATCAAGCAGGCTTCATCCCCGG + Intergenic
1042725881 8:71876419-71876441 GATCAAGTCGGCTTCACCCCTGG - Intronic
1042981801 8:74537953-74537975 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1043298835 8:78701826-78701848 GATCAAGTAGGCTTCATCCCTGG - Intronic
1043396930 8:79846873-79846895 GATCAAGTAGGCTTCACCCCTGG + Intergenic
1043554386 8:81413965-81413987 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1043786296 8:84404508-84404530 AATCAAGTAGGCTTCATCCCTGG - Intronic
1044000971 8:86880829-86880851 GATCAAGGAGGCTTCATCTCTGG + Intronic
1044168924 8:89024632-89024654 TATCAAGTCGGCTTCATCCCTGG - Intergenic
1044214192 8:89588175-89588197 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1044377781 8:91496690-91496712 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1044808720 8:96035454-96035476 AATCAAGTAGGCTTCATCCCTGG - Intergenic
1045581868 8:103490553-103490575 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1046972113 8:120234650-120234672 AATCAAGGCGGCTTCATCCCTGG - Intronic
1047473101 8:125198525-125198547 GATCAAGTAGGCTTCATCCCTGG - Intronic
1048713797 8:137244338-137244360 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1049115527 8:140683657-140683679 AAACAAGTAGGCTTCACCCCTGG + Intronic
1049953280 9:666775-666797 TATCAAGTGGGATTCACCCCAGG - Intronic
1050215306 9:3316179-3316201 TATCAAGTTGGCTTCATCCCTGG + Intronic
1050446143 9:5724894-5724916 TATCAAGTTGGCTTCATCCCTGG - Intronic
1050675647 9:8049771-8049793 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1050852411 9:10304067-10304089 AATCAAGGTGGCTTCATCCCTGG + Intronic
1051089600 9:13390762-13390784 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1051296059 9:15597482-15597504 GATCAAGTAGGCTTCATCCCCGG - Intronic
1051498849 9:17755323-17755345 TATCAAGTAGGCTTTATCCCTGG - Intronic
1051674181 9:19542773-19542795 CATCAAGGTGGCTTCATCCCTGG - Intronic
1051846531 9:21457403-21457425 GATCAAGTTGGCTTCACCCCTGG + Intergenic
1051891791 9:21949841-21949863 TATCAAGCAGGCTTTATCCCTGG + Intronic
1055132990 9:72796526-72796548 AATCAAGTAGGCGTCATCCTTGG + Intronic
1055333149 9:75204968-75204990 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1055356671 9:75444600-75444622 TATCAAGTAGGCTTTATCCCTGG - Intergenic
1055358400 9:75462001-75462023 AATCATGGAGGAGTCAGCCCAGG - Intergenic
1057343044 9:94220541-94220563 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1057639206 9:96800828-96800850 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1057683109 9:97208944-97208966 GATCAAGGGGGCTTCATCCCTGG + Intergenic
1058085704 9:100745807-100745829 GATCAAGTAGGCCTCATCCCTGG - Intergenic
1058350433 9:104015134-104015156 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1061551990 9:131341387-131341409 GATCAAGTTGGCTTCACCCCAGG - Intergenic
1062708984 9:137961704-137961726 AATCAAGTAGGCTTCATCCCTGG - Intronic
1203754101 Un_GL000218v1:108009-108031 GATCAAGTCGGCTTCACCCCTGG - Intergenic
1187069542 X:15874589-15874611 TATCAAGGAGGCCTCACTGAAGG - Intergenic
1187248022 X:17571007-17571029 AATCAAGTTGGCTTCACCCCTGG - Intronic
1187589836 X:20705343-20705365 GATCAAGTGGGCGTCATCCCTGG - Intergenic
1187607493 X:20902101-20902123 AATCAAGTAGGCTTCATCCCTGG - Intergenic
1188319309 X:28715985-28716007 AATCAAGTAGGCTTCATCCCTGG + Intronic
1188454940 X:30353529-30353551 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1188628103 X:32313203-32313225 AATCAAGTAGGCTTCATCCCTGG + Intronic
1188652979 X:32654487-32654509 TATCAAGTGGGCTTCATCCCTGG - Intronic
1188710683 X:33393552-33393574 GATGAAGGAGGCGTTACACCTGG + Intergenic
1188723219 X:33548609-33548631 GATCAAGTAGGCTTCATCCCCGG - Intergenic
1188861910 X:35268545-35268567 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1189303939 X:39972755-39972777 TATCAAGAAGGCAGCACCCCTGG + Intergenic
1189898080 X:45676801-45676823 AATCAAGTAGGCTTCATCCCTGG + Intergenic
1190403580 X:50063813-50063835 GATCAAGTGGGCGTCATCCCTGG + Intronic
1190515453 X:51219329-51219351 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1190551883 X:51591356-51591378 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1190603334 X:52114918-52114940 AATCAAGTCGGCTTCACCCCGGG + Intergenic
1190975890 X:55400326-55400348 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1191032467 X:55989540-55989562 GATCAAGGGGGCTTCATCCCTGG - Intergenic
1191049866 X:56179828-56179850 TGTCAAGTTGGCGTCATCCCTGG - Intergenic
1191113668 X:56829700-56829722 TATCAAGTTGGCTTCATCCCTGG - Intergenic
1191195930 X:57722766-57722788 GATCAAGTAGGCTTCACCCCTGG - Intergenic
1191800140 X:65069786-65069808 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1191814462 X:65228187-65228209 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1191929134 X:66349753-66349775 TATCAAGTGGGCTTCATCCCTGG + Intergenic
1191992858 X:67057955-67057977 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1192865458 X:75127212-75127234 AATCAAGTTGGCTTCACCCCTGG + Intronic
1192932149 X:75817982-75818004 TGTCAAGTAGGCTTCATCCCTGG + Intergenic
1192933337 X:75832076-75832098 TATCAAGTAGGTGTCATCCCTGG - Intergenic
1192949452 X:76001428-76001450 TATAAAGTAGGCTTCATCCCTGG - Intergenic
1193021835 X:76800241-76800263 TACCAAGGAGGAGTCACCTATGG + Intergenic
1193033845 X:76928156-76928178 GATCAAGTGGGCGTCATCCCTGG + Intergenic
1193094479 X:77531434-77531456 GATCAAGATGGCGTCATCCCTGG + Intronic
1193181940 X:78468561-78468583 TATCAAGTGGGCTTCATCCCTGG - Intergenic
1193588538 X:83358387-83358409 GATCAAGTAGGATTCACCCCTGG + Intergenic
1193746826 X:85292273-85292295 AATCAAGTAGGCTTCATCCCTGG - Intronic
1193805447 X:85988161-85988183 GATCAAGAAGGCTTCATCCCCGG + Intronic
1193899073 X:87153109-87153131 TATCAAGTAGGCTTTATCCCTGG - Intergenic
1193931237 X:87555055-87555077 TATCAAGGGGGCTTCATCCCTGG - Intronic
1194040474 X:88936041-88936063 GATCAAGTAGGCTCCACCCCTGG - Intergenic
1194263671 X:91730170-91730192 GATCAAGGTGGCTTCATCCCTGG - Intergenic
1194830305 X:98615607-98615629 TATTAAGTAGGCGTCATCTCTGG - Intergenic
1194854379 X:98911275-98911297 GATCAAGTAGGCTTCATCCCAGG - Intergenic
1194867769 X:99089637-99089659 TATCAAGTAGGCTTCATCACTGG + Intergenic
1195103715 X:101582369-101582391 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1195117390 X:101713415-101713437 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1195544116 X:106096119-106096141 TATCAAGTAGGCTTTATCCCTGG - Intergenic
1195548750 X:106142416-106142438 GATCAAGTAGGCTTCATCCCTGG + Intergenic
1195784787 X:108507375-108507397 AATCAAGTAGGCTTCATCCCTGG + Intronic
1195808701 X:108804619-108804641 GATCAAGGTGGCTTCATCCCTGG + Intergenic
1196096381 X:111805188-111805210 GATCAAGTTGGCTTCACCCCTGG - Intronic
1196139255 X:112243028-112243050 GATCAAGGTGGCTTCATCCCTGG - Intergenic
1196147061 X:112329813-112329835 GATCAAGGTGGCTTCATCCCTGG + Intergenic
1196216981 X:113064581-113064603 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1196218681 X:113086400-113086422 GATCAAGGAGGCTTTATCCCTGG - Intergenic
1197239345 X:124106740-124106762 GATCAAGTGGGCTTCACCCCTGG - Intronic
1197285407 X:124589232-124589254 AATCAAGTAGGCTTCATCCCTGG - Intronic
1197327732 X:125115044-125115066 TATCAAGTTGGCTTCATCCCTGG + Intergenic
1197533988 X:127664655-127664677 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1197553235 X:127920884-127920906 TATTAAGTAGGCTTTACCCCTGG + Intergenic
1198474155 X:136979462-136979484 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1199016458 X:142821325-142821347 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1199131701 X:144196625-144196647 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1199269750 X:145869340-145869362 AATCAAGTAGGCGTTATCCCTGG - Intergenic
1199488632 X:148374523-148374545 GATCAAGTAGGCCTCATCCCTGG + Intergenic
1199857164 X:151768910-151768932 GATCAAGTAGGCTTCATCCCCGG + Intergenic
1200364684 X:155649423-155649445 AATCAAGTAGGCTTCATCCCTGG + Intronic
1200578183 Y:4915380-4915402 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1200899165 Y:8410307-8410329 GATCAAGCAGGCTTCATCCCTGG - Intergenic
1201067244 Y:10109298-10109320 TATCAAGTGGGCTTCATCCCTGG - Intergenic
1201167741 Y:11225657-11225679 GATCAAGTCGGCTTCACCCCTGG - Intergenic
1201263619 Y:12184632-12184654 GATCAAGTAGGCTTCATCCCGGG + Intergenic
1201599888 Y:15716801-15716823 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1201602293 Y:15744678-15744700 GATCAAGTGGGCTTCACCCCTGG - Intergenic
1201732201 Y:17216535-17216557 GATCAAGGAGGCTTCATCCCTGG + Intergenic
1201740175 Y:17315429-17315451 GATCAAGGAGGCTTCATCCCTGG + Intergenic
1201970001 Y:19781594-19781616 GATCAAGTGGGCTTCACCCCTGG + Intergenic
1202361181 Y:24111992-24112014 GATCAAGTAGGCTTCATCCCTGG - Intergenic
1202509597 Y:25558126-25558148 GATCAAGTAGGCTTCATCCCTGG + Intergenic