ID: 1092247942

View in Genome Browser
Species Human (GRCh38)
Location 12:6873597-6873619
Sequence CGCCCCCACGGCGAAGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092247924_1092247942 30 Left 1092247924 12:6873544-6873566 CCGGGCGGTTAACCTCGGGTCTC 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1092247931_1092247942 -8 Left 1092247931 12:6873582-6873604 CCCTCCCCGAGGCCCCGCCCCCA 0: 1
1: 2
2: 20
3: 256
4: 2215
Right 1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1092247927_1092247942 18 Left 1092247927 12:6873556-6873578 CCTCGGGTCTCAGTCCCGGGCTG 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1092247928_1092247942 4 Left 1092247928 12:6873570-6873592 CCCGGGCTGTGACCCTCCCCGAG 0: 1
1: 0
2: 3
3: 23
4: 261
Right 1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1092247929_1092247942 3 Left 1092247929 12:6873571-6873593 CCGGGCTGTGACCCTCCCCGAGG 0: 1
1: 0
2: 4
3: 32
4: 205
Right 1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1092247932_1092247942 -9 Left 1092247932 12:6873583-6873605 CCTCCCCGAGGCCCCGCCCCCAC 0: 1
1: 0
2: 23
3: 233
4: 1909
Right 1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092247942 Original CRISPR CGCCCCCACGGCGAAGGCCC GGG Intronic
901012363 1:6209045-6209067 CGCCCCCACCCCCAAGTCCCCGG - Intronic
901483152 1:9539793-9539815 CGCGCCCGGGGCGAAGGCCGAGG - Intronic
906917191 1:50023998-50024020 CGCCCCCGCGGCGCGAGCCCGGG + Intergenic
907311742 1:53542730-53542752 CACCCCCAGGGCGTAGCCCCAGG - Intronic
915323083 1:155066788-155066810 TGCCCCCACTACGAAGGCCCAGG + Exonic
915530675 1:156500640-156500662 CGCGCCCACGACGGGGGCCCAGG - Exonic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
920519407 1:206612415-206612437 TGCCCCCACGGCTGAGGGCCTGG - Exonic
922705636 1:227788717-227788739 CGCCCCCGCCGCGGAGTCCCGGG + Intergenic
923631307 1:235650445-235650467 CGCCCCAACGGCCCAGGCGCTGG - Intronic
1064231077 10:13529312-13529334 CGCCCCCACGGCGAGGTGCACGG - Intergenic
1083441350 11:62678730-62678752 TGCCCCCAGGGAGAAGGCTCTGG - Exonic
1083936521 11:65872571-65872593 CGCCCCTGCGGCGAAGGCCGAGG + Intronic
1089688033 11:120169300-120169322 CGCCCCCACGGCCCCGGCCGTGG - Intronic
1090358390 11:126155969-126155991 AGGCCCCACGGAGAGGGCCCGGG + Intergenic
1091404958 12:203492-203514 CACCCCCGCGGCGGACGCCCGGG - Intronic
1091549987 12:1530117-1530139 CACCCCCGCGGCGAGGCCCCCGG + Intronic
1091724313 12:2834855-2834877 CGCCCCCACCGAGCAGCCCCTGG - Exonic
1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG + Intronic
1096191645 12:49623652-49623674 CGCCCCATCGGCCACGGCCCGGG - Intronic
1104602026 12:130161196-130161218 GGCGCCCACCGCGAACGCCCTGG + Intergenic
1113576879 13:111401380-111401402 CTCCCCCACGGGGCAGGACCTGG + Intergenic
1114736559 14:25049324-25049346 TGCCCCCAGGGCGCTGGCCCTGG - Intronic
1115399241 14:32939135-32939157 CGCCGCCACGGCCACGGCCACGG + Intronic
1122806949 14:104264623-104264645 CGCCCCCAAGGGCAAGGACCGGG + Intergenic
1126113292 15:45187768-45187790 CGCCCCCCCCGCGGAAGCCCAGG + Intronic
1126775938 15:52100564-52100586 CACCCCCACGGGAAAGCCCCAGG - Intergenic
1127007196 15:54583917-54583939 CACCCCCACGGGAAAGCCCCAGG + Intronic
1128638767 15:69320053-69320075 CACCCCAACGGGGAAGGCTCTGG - Intronic
1129461821 15:75703538-75703560 AGTCTCCACGGGGAAGGCCCAGG + Intronic
1132500442 16:282517-282539 TGCCCTCACCGCGCAGGCCCCGG - Exonic
1132604796 16:789145-789167 CGCGCCCACTCCGGAGGCCCTGG - Intronic
1132779415 16:1614454-1614476 CGCCCCCACGCCGCCGCCCCCGG - Intronic
1132845951 16:2001003-2001025 CGGACTCAGGGCGAAGGCCCAGG - Exonic
1137057089 16:35751028-35751050 GACCCCCACGGAGAGGGCCCGGG - Intergenic
1137477152 16:48818620-48818642 CTCCCCCCAGGCGCAGGCCCAGG - Intergenic
1147150342 17:38510475-38510497 CGCCCAGACGGCGAGGGCGCGGG + Exonic
1152319527 17:79600682-79600704 GGCTCCCACCTCGAAGGCCCGGG + Intergenic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1160592532 18:79952144-79952166 CGGCCCCCCGGCGACGGCCCCGG - Intergenic
1161112448 19:2477781-2477803 CGCCCCCAGGGCGGAGATCCAGG + Exonic
1161984765 19:7647215-7647237 CGCCCCCACGGCCAGCTCCCAGG + Exonic
1162079357 19:8209298-8209320 CGCCCCCACGGCCCCGCCCCGGG + Intronic
1162128224 19:8510839-8510861 CGCCCCCGCGGGTAAGGCCGAGG - Exonic
1162372982 19:10290047-10290069 CGCAGCCCTGGCGAAGGCCCTGG - Exonic
1162421037 19:10566170-10566192 CGCCCCTGCGGGGAAGGCCGCGG + Intergenic
1163149219 19:15401245-15401267 CGCCCCCACCTCGCATGCCCTGG + Exonic
1163581960 19:18144551-18144573 GGCCCCCAAGGCGGCGGCCCCGG - Exonic
1164759762 19:30719939-30719961 CGCGCCCTCGGCGGTGGCCCAGG - Intergenic
1165305547 19:35000619-35000641 CGCCCCCACCCCGATCGCCCCGG - Intronic
1166735064 19:45079220-45079242 CGCCCCCGCTGCAGAGGCCCGGG - Intronic
1167797583 19:51719776-51719798 CACCCCGGCGGCGTAGGCCCAGG + Exonic
929127711 2:38536203-38536225 CGTTCCCACCGCGAAGGCCCGGG + Intergenic
932492637 2:72131778-72131800 CGCCCCCACTGCGTCTGCCCAGG - Exonic
932621401 2:73266495-73266517 CGCCCCCACCTCCACGGCCCAGG + Exonic
936403134 2:112181544-112181566 CGCCCCCTTCGCGTAGGCCCTGG + Intronic
937119477 2:119431814-119431836 CGCCCCTGCGGAGAAGTCCCGGG + Intronic
946131661 2:217611362-217611384 AGGCCCCAGGGGGAAGGCCCAGG + Intronic
948899651 2:240949868-240949890 GGGCTCCACGGGGAAGGCCCTGG - Intronic
1175433148 20:58921486-58921508 TGCCCCCACGAGGAAGGCCCTGG + Intergenic
1176062658 20:63179054-63179076 CGCCCCCACAGCGGGCGCCCTGG + Intergenic
1176111331 20:63412104-63412126 CGGCCCCACTGCGGAGACCCGGG + Intronic
1178050222 21:28738633-28738655 AGCCCCCAGGGAGAAGGCCCAGG - Intergenic
1179444300 21:41420588-41420610 CGCCCCCACCGCGAATTTCCCGG - Exonic
1183167285 22:36157209-36157231 CTCCCCCACGGCAATGGCCCAGG + Intronic
1183442292 22:37830081-37830103 CCCCCCCATGGCCATGGCCCTGG - Intergenic
1185302517 22:50089971-50089993 CGACCCCAAGGCGCATGCCCAGG + Intronic
953421551 3:42757240-42757262 CTCCTCCAAGGCAAAGGCCCTGG + Intronic
954864659 3:53718477-53718499 CACACCCAAGGCGATGGCCCGGG - Intronic
967493646 3:190120421-190120443 CCGCCCCCCGGCGAGGGCCCCGG - Exonic
968053270 3:195671226-195671248 CGCCCCCATCGCGAAGGACCTGG + Intergenic
968102541 3:195977135-195977157 CGCCCCCATCGCGAAGGACCTGG - Intergenic
968655903 4:1778341-1778363 CGGCCCCCTGGCGACGGCCCTGG - Intergenic
968765352 4:2465542-2465564 GGCCCCCAGTGTGAAGGCCCTGG - Intronic
968765376 4:2465614-2465636 GGCCCCCAGTGTGAAGGCCCTGG - Intronic
988578001 5:32444835-32444857 CGCCCGCACCGCCGAGGCCCCGG - Intergenic
992879049 5:81087072-81087094 CACCGCCTCGGCGAAGGCCGTGG - Intronic
1002574034 5:180161496-180161518 AGACGCCACGGCGATGGCCCCGG - Intronic
1002931898 6:1640662-1640684 CATCCCCACAGCGCAGGCCCAGG + Intronic
1006107799 6:31727229-31727251 CGCCCCCACAGCTGAGGGCCTGG - Exonic
1019422440 7:957335-957357 CTGCCCCACGGAGGAGGCCCCGG - Intronic
1020080406 7:5283294-5283316 CCCCTCCATGGCGAGGGCCCAGG - Intronic
1020272887 7:6607489-6607511 GGCCCCCTCGGGGACGGCCCAGG - Intronic
1023937297 7:44748954-44748976 GGCCGCCACGGCGAGGGGCCGGG + Exonic
1024074473 7:45811589-45811611 CGCCCCCACGGCGGCCTCCCGGG + Intergenic
1024074804 7:45812947-45812969 CGCCCCCACGGCGGCCTCCCGGG + Intergenic
1026837393 7:73647873-73647895 CGCCCGCGCGGAGAAGGCGCCGG - Intergenic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1031134771 7:117873159-117873181 TGCCCACACGGCGGAGGCCGCGG - Intronic
1034429777 7:151035471-151035493 CACTCCCACGGCCAAGGCCCAGG - Intronic
1034531101 7:151696996-151697018 TGCCCCCAGAGCGCAGGCCCAGG + Intronic
1034558415 7:151864289-151864311 CGCCTCCAGTGCAAAGGCCCAGG + Intronic
1035167860 7:157002420-157002442 CGCCCCCCAGACGGAGGCCCAGG - Intronic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1036807922 8:11847858-11847880 AGCCCCCACGGAGAAGACCTGGG + Intronic
1037815464 8:22109510-22109532 CGCCCCCTCGGTGAATGCCGCGG - Intergenic
1037827018 8:22165566-22165588 CGGCCCCCCGGCGACGGGCCAGG + Intronic
1038184815 8:25263798-25263820 TTCCCCCACTGCGAATGCCCAGG + Intronic
1038429841 8:27491277-27491299 CGGCCGCACGGAGGAGGCCCTGG + Exonic
1043502859 8:80873990-80874012 CGCCCCCCCGGCGGCTGCCCAGG + Intronic
1060666703 9:125436078-125436100 CGCCCCCACCTCTGAGGCCCAGG - Intergenic
1060849334 9:126861092-126861114 CGCCCCCAGGGCTAGGGGCCCGG - Intronic
1060939443 9:127535208-127535230 GGCCCTCACGGAGCAGGCCCTGG + Intronic
1061721956 9:132557350-132557372 TGCCCCCACGGCGGTGGCTCTGG - Intronic
1062442741 9:136578459-136578481 CGCCCCCACCGCTGTGGCCCAGG + Intergenic
1062461892 9:136665756-136665778 GGCCCCCACGGCGCGGGCTCGGG + Intronic
1062570780 9:137184217-137184239 AGCCGACATGGCGAAGGCCCTGG + Intronic
1062570842 9:137184583-137184605 AGCAGACACGGCGAAGGCCCTGG + Intronic
1186973249 X:14872935-14872957 CGCCCCCTCTGCGAAGTCCTGGG + Intronic
1189491309 X:41473509-41473531 GGCCCCCACGGCCCAGGCGCTGG - Exonic
1191025464 X:55908736-55908758 CGCCCCGTCGGCCCAGGCCCCGG + Intergenic
1197749926 X:129957302-129957324 GGCCCCCACGCCGAGGGCTCGGG - Intergenic
1200128413 X:153829027-153829049 CGCACCCCCGGAGAAGGGCCGGG + Intronic