ID: 1092250902

View in Genome Browser
Species Human (GRCh38)
Location 12:6895855-6895877
Sequence CTCAAACTGGAGTGCAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 766
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 718}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092250902_1092250909 12 Left 1092250902 12:6895855-6895877 CCCAAACTGCACTCCAGTTTGAG 0: 1
1: 0
2: 2
3: 45
4: 718
Right 1092250909 12:6895890-6895912 ACCCTGTCTCAGGCCAGGGGTGG 0: 1
1: 1
2: 8
3: 43
4: 396
1092250902_1092250905 2 Left 1092250902 12:6895855-6895877 CCCAAACTGCACTCCAGTTTGAG 0: 1
1: 0
2: 2
3: 45
4: 718
Right 1092250905 12:6895880-6895902 ACAAAGCAAGACCCTGTCTCAGG 0: 13
1: 118
2: 550
3: 1125
4: 1908
1092250902_1092250906 7 Left 1092250902 12:6895855-6895877 CCCAAACTGCACTCCAGTTTGAG 0: 1
1: 0
2: 2
3: 45
4: 718
Right 1092250906 12:6895885-6895907 GCAAGACCCTGTCTCAGGCCAGG 0: 3
1: 7
2: 16
3: 89
4: 420
1092250902_1092250912 15 Left 1092250902 12:6895855-6895877 CCCAAACTGCACTCCAGTTTGAG 0: 1
1: 0
2: 2
3: 45
4: 718
Right 1092250912 12:6895893-6895915 CTGTCTCAGGCCAGGGGTGGTGG 0: 1
1: 0
2: 20
3: 211
4: 1671
1092250902_1092250908 9 Left 1092250902 12:6895855-6895877 CCCAAACTGCACTCCAGTTTGAG 0: 1
1: 0
2: 2
3: 45
4: 718
Right 1092250908 12:6895887-6895909 AAGACCCTGTCTCAGGCCAGGGG 0: 1
1: 0
2: 3
3: 31
4: 344
1092250902_1092250907 8 Left 1092250902 12:6895855-6895877 CCCAAACTGCACTCCAGTTTGAG 0: 1
1: 0
2: 2
3: 45
4: 718
Right 1092250907 12:6895886-6895908 CAAGACCCTGTCTCAGGCCAGGG 0: 1
1: 1
2: 4
3: 40
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092250902 Original CRISPR CTCAAACTGGAGTGCAGTTT GGG (reversed) Intronic
900050402 1:591689-591711 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
901097413 1:6693421-6693443 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
901266625 1:7915428-7915450 CCCAGACTGGAGTGCAGTGGTGG + Intergenic
901385181 1:8903479-8903501 CCCAGGCTGGAGTGCAGTTGCGG - Intergenic
901578922 1:10224459-10224481 TCCAAACTGGAGTGCAGTGATGG + Intronic
901611467 1:10501866-10501888 CCCAAGCTGGAGTGCAGTGGGGG - Intronic
901706605 1:11078298-11078320 CCCAGACTGGAGTGCAGTGGCGG + Intronic
902421078 1:16280729-16280751 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
902675052 1:18002938-18002960 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
902687816 1:18090343-18090365 CCCAGGCTGGAGTGCAGTGTAGG + Intergenic
902828436 1:18993971-18993993 CCCAGGCTGGAGTGCAGTTGTGG - Intergenic
902933680 1:19748780-19748802 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
903687580 1:25143148-25143170 CTCAGGCTGGAGTGCAGTAGCGG - Intergenic
903842130 1:26250982-26251004 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
904108849 1:28109050-28109072 CCCAAGCTGGAGTGCAGGCTCGG - Intergenic
904135112 1:28306114-28306136 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
904754968 1:32763612-32763634 CCCAGACTGGAGTGCAGTAGCGG + Intronic
904854303 1:33485450-33485472 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
906025401 1:42669223-42669245 CTCAGCCTGCACTGCAGTTTCGG - Intronic
906622927 1:47299302-47299324 CCCAGACTGGAGTGCAGTGGTGG - Intronic
907063775 1:51458692-51458714 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
907543366 1:55237254-55237276 CCCAGACTGGAGTGCAGTCTGGG + Intergenic
907696122 1:56731031-56731053 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
908524264 1:64972744-64972766 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
908700157 1:66890255-66890277 CCCAGACTGGAGTGCAATCTTGG - Intronic
909124980 1:71656453-71656475 CCCAAGCTGGAGTGCAGTGGCGG + Intronic
909561263 1:77011311-77011333 TTCAAACTGGAGTGGAGAATTGG + Intronic
910323095 1:85971515-85971537 CTCAAAATGGGTTGCAGTATGGG + Intronic
911173085 1:94790948-94790970 CTAAAACTGGATTGTAGTTATGG + Intergenic
912274059 1:108238388-108238410 CTCAGGCTGGAGTGCAATTGTGG + Intronic
912287208 1:108381474-108381496 CTCAGGCTGGAGTGCAATTGTGG - Intronic
912294160 1:108455935-108455957 CTCAGGCTGGAGTGCAATTGTGG - Intronic
912318569 1:108689338-108689360 CCCAGACCGGAGTGCAGTGTTGG + Intergenic
912803395 1:112736297-112736319 CTCAGACTAGAGTGCAGTAGTGG + Intergenic
912809185 1:112780973-112780995 CCCAGGCTGGAGTGCAGTGTTGG + Intergenic
913008533 1:114659457-114659479 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
913400881 1:118431592-118431614 CCCAGGCTGGAGTGCAGTTGTGG - Intergenic
915080333 1:153347734-153347756 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
915395206 1:155578387-155578409 CCCACACTGGCGTGCAGTCTTGG + Intergenic
915700304 1:157785761-157785783 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
916077798 1:161212608-161212630 CCCAGACTGGAGTGCAATCTCGG + Intronic
916210945 1:162359510-162359532 CTCTAACTGAAGGTCAGTTTAGG - Intronic
916294965 1:163208303-163208325 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
920159491 1:203985267-203985289 CTAAGACTGGAATGCAGTTTGGG - Intergenic
921039048 1:211412078-211412100 CTGAAACTGGATTGCAGTAATGG + Intergenic
921126865 1:212185554-212185576 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
921245865 1:213239293-213239315 CCCAGACTGGAGTGCAGTGGTGG - Intronic
922108046 1:222529475-222529497 CACAAACTGCAGTCCAGTATAGG - Intronic
923186265 1:231576490-231576512 CCCACACTGGAGTGCAGTGGTGG - Intronic
923489209 1:234468423-234468445 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
924539175 1:244964979-244965001 CCCAAGCTGGAGTGCAGTGGTGG - Intergenic
924695122 1:246391335-246391357 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1064022029 10:11816767-11816789 CCCAAGCTGGAGTGCAGTGGTGG - Intergenic
1064471933 10:15644308-15644330 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1065328892 10:24573409-24573431 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1065538510 10:26737678-26737700 CCCAGGCTGGAGTGCAGTCTCGG - Intronic
1066324769 10:34347104-34347126 CTCAAAATGGAGTTAAATTTAGG + Intronic
1066524205 10:36258544-36258566 GTCAAACTGGGGTACAGTCTGGG + Intergenic
1067309249 10:45096801-45096823 CCCAGGCTGGAGTGCAGTGTCGG + Intergenic
1067375582 10:45725524-45725546 CCCAGGCTGGAGTGCAGTCTCGG - Intergenic
1068020403 10:51575334-51575356 CTCAAACTGCAGTGTGGTGTTGG - Intronic
1068234809 10:54219548-54219570 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
1068621197 10:59185031-59185053 CCCAGACTGGAGTGCAGTGGCGG + Intronic
1069243173 10:66167793-66167815 CTCAAACTGCACAGCAGTCTAGG - Intronic
1069303761 10:66942006-66942028 ATAAACCTGGGGTGCAGTTTTGG + Intronic
1069575200 10:69522331-69522353 CCCAGGCTGGAGTGCAGTTGTGG - Intergenic
1069708529 10:70474522-70474544 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1070266547 10:74908505-74908527 CCCAGGCTGGAGTGCAATTTCGG - Intronic
1070615385 10:77965882-77965904 CCCAGACTGGAGTGCAATCTTGG + Intergenic
1071285208 10:84138495-84138517 CCCAGGCTGGAGTGCAGTTGCGG + Intergenic
1071614369 10:87061465-87061487 CCCAGGCTGGAGTGCAGTCTCGG - Intronic
1072098729 10:92208634-92208656 CCCAGGCTGGAGTGCAGTTGGGG + Intronic
1073260925 10:102189672-102189694 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
1073270303 10:102257349-102257371 CCCAGGCTGGAGTGCAGTTGTGG + Intronic
1073546277 10:104352262-104352284 CCCACACTGGAGTGCAGCGTAGG + Intergenic
1073804383 10:107081086-107081108 CTGAAACTGAACTGCAGTTATGG - Intronic
1074152479 10:110769759-110769781 CCCAGGCTGGAGTGCAGTGTTGG + Intronic
1074311997 10:112330084-112330106 CCCAGGCTGGAGTGCAGTGTCGG - Intergenic
1074894439 10:117762786-117762808 CTCAAACAAGTGTGCAATTTAGG - Intergenic
1074990008 10:118696598-118696620 CCCAAGCTGGAGTGCAGTAGCGG - Intronic
1075169453 10:120099938-120099960 CACACACTGGCTTGCAGTTTGGG - Intergenic
1075785467 10:125046493-125046515 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
1075996450 10:126880299-126880321 CTCTAACTGGAATGCAATTATGG + Intergenic
1078333502 11:10445357-10445379 CTCAAACTGGAGTGGAGGGGTGG + Intronic
1078424191 11:11235817-11235839 CCCAAGCTGGAGTGCAGTGGCGG - Intergenic
1078455806 11:11474019-11474041 CCCAGGCTGGAGTGCAGTGTCGG - Intronic
1079047842 11:17123963-17123985 TTAAAACTGGAGTCTAGTTTTGG - Intronic
1079236159 11:18692193-18692215 CCCAAGCTGGAGTGCAGTGGCGG + Intergenic
1079737278 11:24012769-24012791 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1080649532 11:34211149-34211171 CCCAAGCTGGAGTGCAGTAATGG + Intronic
1080801628 11:35615550-35615572 CTCAAAGTGGAATGCAGTTTTGG - Intergenic
1080849685 11:36057330-36057352 CACAAACTTGAGTGTAGATTAGG - Intronic
1081368748 11:42271987-42272009 CCCAAGCTGGAGTGCAGTGGAGG + Intergenic
1081990780 11:47336445-47336467 CCCAGACTGGAGTGCAGTCCTGG - Intronic
1082234322 11:49804668-49804690 CCCAAGCTGGAGTGCAGTGGCGG + Intergenic
1082732811 11:56820881-56820903 CACAAGCTGGAGTGCAGTGGTGG - Intergenic
1083454206 11:62767526-62767548 CCCAAGCTGGAGTGCAGTGGAGG - Intergenic
1083461638 11:62817005-62817027 CTCAGGCTGGAGTGCAGTGGCGG + Intronic
1083563063 11:63689798-63689820 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1083761341 11:64819982-64820004 CCCAGACTGGAGTGCAGTAGTGG + Intergenic
1083799797 11:65040042-65040064 CCCAGACTGGAGTGCAGTGGTGG + Exonic
1083939242 11:65886417-65886439 GTCAAACTGCAGGGCAGTTAGGG + Exonic
1083982154 11:66181252-66181274 CCCAGGCTGGAGTGCAGTGTCGG + Intronic
1085212590 11:74794839-74794861 CCCAGCCTGGAGTGCAGTGTTGG + Intronic
1086189311 11:84059717-84059739 GTCAAAGTGGACTGGAGTTTAGG - Intronic
1086617268 11:88836750-88836772 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
1087440668 11:98179420-98179442 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1088203860 11:107369949-107369971 CCCAGGCTGGAGTGCAGTGTTGG + Intronic
1089455479 11:118623177-118623199 CTCAGACTGGCGTGAAGCTTGGG + Intronic
1089862911 11:121605962-121605984 CCCACACTGGAGTGCAGTGGAGG + Intronic
1091032861 11:132206784-132206806 CTCAAATTGGAGTTTATTTTAGG - Intronic
1091389286 12:116265-116287 CTCTAACTGTAGTGCAGACTTGG - Intronic
1091922728 12:4318903-4318925 CCCAGGCTGGAGTGCAGTGTTGG + Intergenic
1092250902 12:6895855-6895877 CTCAAACTGGAGTGCAGTTTGGG - Intronic
1092666376 12:10804116-10804138 CTCAGGCTGGAGTGCTATTTTGG + Intergenic
1093368617 12:18336468-18336490 TCCAAACTGGAGTTTAGTTTGGG - Intronic
1094128684 12:27051280-27051302 CCCAGACTGGAGTGCAGTGGTGG - Intronic
1094148306 12:27253965-27253987 CCCAACCTGGAGTGCAGTGCTGG + Intronic
1094562690 12:31570151-31570173 CCCAGGCTGGAGTGCAGTGTTGG - Intronic
1095480380 12:42628888-42628910 CCCAGGCTGGAGTGCAGTTGGGG + Intergenic
1095676448 12:44924596-44924618 CCCAGACTGGAGTGCAGTGAGGG + Intergenic
1096268243 12:50141895-50141917 CCCAAGCTGGAGTGCAGTTGTGG - Intronic
1096412435 12:51387138-51387160 CCCATACTGGAGTGCAGTGGCGG + Intronic
1096640287 12:52989013-52989035 CCCAGACAGGAGAGCAGTTTGGG - Intergenic
1097110883 12:56657258-56657280 CCCAAACTGGAATGCAGTGGTGG + Intergenic
1097114984 12:56690433-56690455 CTCAGGCTGGAGTGCAGTAGTGG + Intergenic
1097848463 12:64389536-64389558 CTCAGGCTGGAGTGCAGGTGGGG + Intronic
1098895601 12:76056958-76056980 CCCAGGCTGGAGTGCAGTCTCGG - Intronic
1099409622 12:82308924-82308946 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1099874331 12:88386103-88386125 CTCATGTTGGAGTGCAGTTGCGG + Intergenic
1099935189 12:89117115-89117137 CTCAAACTGGATTCCAGTTTGGG + Intergenic
1100141108 12:91619990-91620012 TTTAGACTGGAGTCCAGTTTAGG - Intergenic
1100166942 12:91926472-91926494 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1100423220 12:94458152-94458174 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1100545243 12:95596214-95596236 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
1101173423 12:102123279-102123301 TTGAAGCTGGAGTCCAGTTTGGG - Intronic
1101347434 12:103899688-103899710 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
1101735606 12:107460614-107460636 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1102711787 12:114934346-114934368 CCCAGGCTGGAGTGCAGTTTTGG - Intergenic
1102841805 12:116132867-116132889 CCCAGGCTGGAGTGCAGTGTCGG - Intronic
1102959355 12:117082156-117082178 CTCATGCTGGAGTGCAATCTTGG - Intronic
1103291759 12:119851988-119852010 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1103576215 12:121879232-121879254 CCCAGACTGGAGTGCAATCTCGG - Intergenic
1103653937 12:122455582-122455604 CCCAGGCTGGAGTGCAGTCTCGG - Intergenic
1103665537 12:122561494-122561516 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1104556974 12:129809369-129809391 CCAAAACTGGAATGCAGGTTGGG + Intronic
1104583212 12:130026204-130026226 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
1105035620 12:132918618-132918640 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1105321380 13:19325349-19325371 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1105560731 13:21488293-21488315 CTCAGGCTGGAGTGCAATCTTGG + Intergenic
1105671060 13:22616646-22616668 CCCAGGCTGGAGTGCAGTCTTGG + Intergenic
1107298299 13:38937975-38937997 CCCAGGCTGGAGTGCAGTTGTGG - Intergenic
1107326998 13:39255062-39255084 CTAAATCTAGACTGCAGTTTTGG - Intergenic
1107407424 13:40127670-40127692 CTCAAACTTGAGTGCACATCAGG - Intergenic
1107520352 13:41174557-41174579 CCCAAACTGGAATGCAGTGATGG + Intergenic
1107524860 13:41220278-41220300 CCCAGACTGGAGTGCAGTGGTGG - Intronic
1107633944 13:42372832-42372854 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1108339785 13:49487376-49487398 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1108416704 13:50205006-50205028 CTCAAGCTGGAGTACAGTGGTGG + Intronic
1109109293 13:58295449-58295471 CCCAGACTGGAATGCAGTGTTGG + Intergenic
1109412160 13:61984483-61984505 TTCAACCTGGATTGCAGTTTTGG - Intergenic
1109772003 13:66987452-66987474 GTCAAACTGGAATGCAGATGAGG - Intronic
1110227338 13:73133321-73133343 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1110255781 13:73432566-73432588 CCCAAGCTGGAGTGCAGTGGCGG + Intergenic
1110859565 13:80333084-80333106 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1111127065 13:83923880-83923902 CCCAGGCTGGAGTGCAGTTCTGG - Intergenic
1112014762 13:95322571-95322593 CCCAGGCTGGAGTGCAGTCTTGG + Intergenic
1112340804 13:98551576-98551598 CACAGAGTGGACTGCAGTTTGGG - Intronic
1112574621 13:100624297-100624319 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
1112740452 13:102467211-102467233 TTGAAGCTGGATTGCAGTTTTGG - Intergenic
1113074268 13:106452685-106452707 CCCAGGCTGGAGTGCAATTTCGG + Intergenic
1113350380 13:109523859-109523881 CCCAGTCTGGAGTGCAGTCTCGG + Intergenic
1113398359 13:109969509-109969531 CTCAGGCTGGAGTGCAGTGATGG + Intergenic
1113830862 13:113294717-113294739 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
1114561600 14:23596110-23596132 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1115415158 14:33123902-33123924 CTGAGACTGGAGTGCAGTGGTGG + Intronic
1116568155 14:46478504-46478526 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1117127591 14:52647017-52647039 CCCAAGCTGGAGTGCAGTGGGGG + Intronic
1117348168 14:54854460-54854482 CTCCATCTGGAGTGTATTTTGGG - Intronic
1117679583 14:58189980-58190002 CCCAGGCTGGAGTGCAGTCTCGG - Intronic
1117860167 14:60082016-60082038 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
1118187077 14:63547189-63547211 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
1118441106 14:65812498-65812520 CTCAAGCTGGAATGCAGTGATGG + Intergenic
1119167248 14:72504794-72504816 CCCAGGCTGGAGTGCAGTGTCGG + Intronic
1120303867 14:82742676-82742698 CCCAGGCTGGAGTGCAGTCTTGG + Intergenic
1120324028 14:83003026-83003048 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
1120673559 14:87391957-87391979 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1121763809 14:96468173-96468195 CTCAGGCTAGAGTGCAGTGTTGG - Intronic
1122674498 14:103399969-103399991 CTCAGGCTGGAGTGCAGTGGCGG + Intronic
1123016959 14:105380327-105380349 CTGAAGCTGGAGTGAATTTTGGG - Intronic
1202843199 14_GL000009v2_random:143204-143226 CCCAGACTGGAGTGCAGTAGTGG - Intergenic
1202912600 14_GL000194v1_random:133455-133477 CCCAGACTGGAGTGCAGTAGTGG - Intergenic
1124468001 15:29956836-29956858 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1124550328 15:30674791-30674813 CTCAGGCTGGAGTGCAGTAGTGG - Intronic
1125900463 15:43341879-43341901 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1126048313 15:44664646-44664668 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1127492803 15:59481035-59481057 CTCAGGCTGGAGTGCAGTTGTGG + Intronic
1127623692 15:60759393-60759415 CTCAACCTGGATTCCAGTTGAGG - Intronic
1127785619 15:62352248-62352270 CCCAGGCTGGAGTGCAGTCTTGG - Intergenic
1128038921 15:64552690-64552712 CTCAGGCTGGAGTGCAGTGATGG + Intronic
1128099462 15:64986635-64986657 CCCAGGCTGGAGTGCAGTCTTGG - Intronic
1128303876 15:66585067-66585089 CCCAGGCTGGAGTGCAGTCTTGG - Intronic
1128321817 15:66699866-66699888 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1129049521 15:72768624-72768646 CCCAGACTGGAGTGCAGTGGTGG - Intronic
1130070281 15:80641250-80641272 CTCAGACTGGACTGTAGTTTGGG - Intergenic
1130344458 15:83029824-83029846 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1130423754 15:83774887-83774909 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1131235266 15:90691417-90691439 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1132916112 16:2345838-2345860 CCCAAGCTGGAGTGCAGTGGCGG + Intergenic
1133072845 16:3257863-3257885 CTCAGGCTGGAGTGCAGTAGTGG + Intergenic
1133389735 16:5400140-5400162 CCCAGGCTGGAGTGCAGTCTTGG + Intergenic
1134102600 16:11462470-11462492 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1134194608 16:12149884-12149906 TTCTAACTGGAGTGCACTCTGGG - Intronic
1134556023 16:15165848-15165870 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1134572362 16:15302130-15302152 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1134730019 16:16453919-16453941 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1134916607 16:18077583-18077605 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1134937414 16:18257982-18258004 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1135071259 16:19353691-19353713 CCCAGGCTGGAGTGCAGTTGTGG - Intergenic
1135426280 16:22339486-22339508 CCCAAGCTGGAGTGCAGTGGTGG - Intergenic
1135426467 16:22341058-22341080 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1135632965 16:24050305-24050327 CTCCAACTGGAGTGTTGTCTAGG - Intronic
1135977926 16:27123208-27123230 CCCAGGCTGGAGTGCAGTCTCGG - Intergenic
1136574511 16:31115567-31115589 CCCAAGCTGGAGTGCAGTGGAGG + Intergenic
1137514511 16:49131329-49131351 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1137603900 16:49774580-49774602 CTCCAACAGGGGTGCAGTTAGGG - Intronic
1137835167 16:51584799-51584821 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1138035844 16:53605128-53605150 CCCAAGTTGGAGTGCAGTCTTGG - Intronic
1138644735 16:58416323-58416345 CCCAGGCTGGAGTGCAGTTGTGG + Intergenic
1138862439 16:60774742-60774764 CTCGGACTGCAGTGCAGATTTGG + Intergenic
1139689826 16:68633559-68633581 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1139711159 16:68777581-68777603 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1140247050 16:73260731-73260753 CCCAGGCTGGAGTGCAGTCTTGG + Intergenic
1140495757 16:75386680-75386702 CCCAGGCTGGAGTGCAGTGTCGG - Intronic
1140905820 16:79408217-79408239 CCCAAGCTGGAGTGCAGTGATGG + Intergenic
1141081330 16:81055760-81055782 CCCAAGCTGGAGTGCAGTGTTGG + Intronic
1141573133 16:84946714-84946736 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1141977376 16:87526254-87526276 CTCAGGCTGGAGTGCAGTAGTGG + Intergenic
1142036718 16:87866972-87866994 CCCAGACTGGAGTGCAGTGGCGG + Intronic
1142892417 17:2952845-2952867 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1143051380 17:4128812-4128834 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1143745485 17:8990995-8991017 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
1143862407 17:9900432-9900454 CTCAGACTGCACTGCAGTCTCGG + Intronic
1143878200 17:10009276-10009298 CCCAGACTGGAGTGCAGTGGCGG - Intronic
1143978275 17:10846257-10846279 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1144454527 17:15408032-15408054 CCCAGGCTGGAGTGCAGTGTGGG - Intergenic
1144484343 17:15652504-15652526 CCCAGGCTGGAGTGCAGTGTGGG + Intronic
1144752475 17:17658713-17658735 CCCAGGCTGGAGTGCAGTGTGGG - Intergenic
1144833718 17:18145670-18145692 CCCAGACTGGAGTGCAGTGGTGG - Intronic
1144934276 17:18885512-18885534 CTCAGGCTGGAGTGCGATTTTGG + Intronic
1145089394 17:19974146-19974168 TTCAAGCTGGAGTGCAGTGGCGG - Intronic
1146088903 17:29856530-29856552 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1146362700 17:32190836-32190858 CCCAGACTGGAGTGCAGTGATGG + Intronic
1146411409 17:32588898-32588920 CCCAGACTGGAGTGCAGTGGTGG - Intronic
1146925160 17:36739535-36739557 CTCAGCCTGGAGTGCAGTGGCGG + Intergenic
1147346185 17:39797120-39797142 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1147392459 17:40118801-40118823 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1147393683 17:40124627-40124649 CTCAGACTGTACTGCAGTCTAGG + Intronic
1147396188 17:40144717-40144739 CCCAGGCTGGAGTGCAGTTGTGG + Intronic
1147404603 17:40201855-40201877 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
1147574473 17:41590746-41590768 CCCAGACTGGAGTGCAGTGGTGG + Intergenic
1148005332 17:44423195-44423217 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1148015628 17:44519997-44520019 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1148434536 17:47672439-47672461 CTCAGGCTGGAGTGCGGTCTCGG + Intronic
1148602629 17:48906005-48906027 CCCAGACTGGAGTGCAGTGATGG - Intergenic
1148694510 17:49550868-49550890 TCCAGACTGGAGTGCAGTTGTGG + Intergenic
1148707515 17:49648799-49648821 CCCAGACTGGAGTGCAGTGGCGG + Intronic
1148738376 17:49877974-49877996 CCCAAGCTGGAGTGCAGTGGCGG - Intergenic
1149470645 17:56913095-56913117 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
1149811325 17:59676154-59676176 CCCAAGCTGGAGTGCAGTGGAGG - Intronic
1150117312 17:62564491-62564513 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1151736480 17:75944189-75944211 CCCAGACTGGAGTGCAGTGGTGG - Exonic
1152180934 17:78821468-78821490 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1152217772 17:79044415-79044437 GACAAACTGGAGGGCAGGTTGGG - Intronic
1153002126 18:465144-465166 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1153234965 18:2977151-2977173 CCCAGTCTGGAGTGCAGTGTAGG - Intronic
1153284699 18:3447584-3447606 CTCAAACTTGTTTGGAGTTTCGG - Intronic
1153445131 18:5163245-5163267 CTCTAAATGCAGTGCAGATTTGG - Intronic
1153854665 18:9134798-9134820 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
1154052709 18:10976669-10976691 TTCAAACTGTATTGCAGTATAGG + Intronic
1154078651 18:11232212-11232234 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
1154323176 18:13370751-13370773 CTTAGACTGGAGTGCAGTGGTGG + Intronic
1155226179 18:23731546-23731568 CACAAACTGGTGTGCAGTCATGG + Intronic
1155464018 18:26115472-26115494 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1155899819 18:31375063-31375085 CTCAGGCTGGAGTGCAGTAGTGG - Intergenic
1156788878 18:40948459-40948481 TTCAAAGTGGAGACCAGTTTAGG + Intergenic
1157220702 18:45826785-45826807 CTCAGACTGGAGTCCAGCTCGGG + Intronic
1157662270 18:49455904-49455926 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1158255636 18:55545489-55545511 CTCAGGCTGGAGTGCAGTGGCGG + Intronic
1158472265 18:57747408-57747430 CCCAGACTGGAGTGCAGTGGTGG - Intronic
1158916388 18:62135664-62135686 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1159132106 18:64290949-64290971 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1161255215 19:3305023-3305045 CCCAAGCTGGAGTGCAGTGGCGG - Intergenic
1161303439 19:3554392-3554414 CTCAGGCTGGAGTGCAGTAGCGG - Intronic
1161387529 19:4004128-4004150 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1161424163 19:4193257-4193279 CCCAGACTGGAGTGCAGTGGAGG - Intronic
1162206647 19:9061151-9061173 CCCAAGCTGGAGTGCAGTGATGG + Intergenic
1162389844 19:10382917-10382939 CCCAAGCTGGAGTGCAGTGGTGG - Intergenic
1162503834 19:11070501-11070523 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1162535230 19:11259598-11259620 CTCAGGCTGGAGTGCAGTGGCGG + Intronic
1162583311 19:11543738-11543760 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1162650699 19:12086789-12086811 CCCAGACTGGAGTGCAGTGGTGG + Intergenic
1162710160 19:12587177-12587199 CCCAGGCTGGAGTGCAGTTGTGG + Intronic
1162817643 19:13206055-13206077 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1163052139 19:14692554-14692576 CCCAGGCTGGAGTGCAGTGTGGG + Intronic
1163151996 19:15421071-15421093 CCCAAGCTGGAGTGCAGTGTAGG - Exonic
1163310007 19:16508432-16508454 CTCAGGCTGGAATGCAGTTGGGG + Intronic
1164082122 19:21867663-21867685 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
1165030539 19:32995113-32995135 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1165400038 19:35593338-35593360 CTCAGGCTGGAGTGCAGTGTTGG - Intergenic
1165471069 19:36004918-36004940 CTCAGACTGGAGTGCAGTGGTGG + Intronic
1165617531 19:37215107-37215129 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1166089513 19:40499068-40499090 CTCAGACTGGAGTGCAGTGGGGG + Intronic
1166327040 19:42057412-42057434 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1166565892 19:43765359-43765381 CTCAAGCTGGAATGAAGTTGCGG + Intergenic
1167379645 19:49131209-49131231 CCCAGGCTGGAGTGCAGTGTCGG + Intronic
1167523008 19:49968026-49968048 CTCAGGCTGGAGTGCAGTGACGG + Intergenic
1167606483 19:50483603-50483625 CCCAAGCTGGAGTGCAGTGGCGG + Exonic
1167809431 19:51815524-51815546 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
1167927382 19:52832550-52832572 CCCAAGCTGGAGTGCAGTGATGG - Intronic
1167993296 19:53379156-53379178 CTCAAGCTGGAGTGCAGTGGTGG + Intronic
1168029459 19:53668236-53668258 CCCAGCCTGGAGTGCAGTTGTGG + Intergenic
1168415882 19:56167974-56167996 CCCAGACTGGAGTGCAGTGGTGG + Intergenic
1202646408 1_KI270706v1_random:145946-145968 CCCAATCTGGAGTGCAGTGATGG - Intergenic
926105702 2:10149169-10149191 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
926137788 2:10348734-10348756 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
926259812 2:11248664-11248686 CTCAGGCTGGAGTGCAGTGTTGG - Intronic
926291755 2:11537003-11537025 CCCAGGCTGGAGTGCAGTGTTGG + Intronic
926409568 2:12588834-12588856 CTCAAAATGATGTGTAGTTTTGG - Intergenic
926439292 2:12870841-12870863 CACAAACAAGAGTGCTGTTTTGG - Intergenic
927144608 2:20154489-20154511 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
927395548 2:22646518-22646540 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
927622050 2:24671601-24671623 CCCAGGCTGGAGTGCAGTTGCGG + Intronic
927729980 2:25462744-25462766 CCCAGACTGGAGTGCAGTGGCGG + Intronic
927907491 2:26870660-26870682 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
928379329 2:30804123-30804145 GTCCAACTGGAGTTCAGTATGGG + Intronic
929289194 2:40169900-40169922 CTCAAGCTGGAGTGCAGTGGTGG - Intronic
929457979 2:42079530-42079552 ATCTTACTGGGGTGCAGTTTGGG + Intergenic
930192100 2:48470475-48470497 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
930305811 2:49673292-49673314 CCCAAACTGGAGTGCAGTGATGG + Intergenic
930332799 2:50007301-50007323 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
930968021 2:57355948-57355970 CCCAGGCTGGAGTGCAGTTGTGG + Intergenic
931353192 2:61510893-61510915 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
931526080 2:63156040-63156062 CTCAGACTGGAGAGCAGTGGCGG + Intronic
931711421 2:64991468-64991490 CCCAGACTGGAGTGCAGTGTTGG + Intronic
931949418 2:67345701-67345723 CCCAGGCTGGAGTGCAGTTGCGG + Intergenic
932016870 2:68037314-68037336 CCCAAGCTGGAGTGCAGTGGCGG - Intergenic
932229732 2:70073026-70073048 CACAGGCTGGAGTGCAGTGTTGG - Intergenic
932530175 2:72521737-72521759 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
932723913 2:74161015-74161037 CCCAGACTGGAGTGCAGTGGCGG - Intronic
932748160 2:74352360-74352382 CCCAGACTGGAGTGCAGTGGTGG + Intronic
932979461 2:76647089-76647111 CCCAGACTGGAGTGCAGTGGCGG + Intergenic
933316414 2:80720602-80720624 CCCAGACTGGAGTGCAGTGGGGG + Intergenic
933730579 2:85453181-85453203 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
933906469 2:86898735-86898757 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
934025002 2:87994910-87994932 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
935030129 2:99313591-99313613 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
935295774 2:101647990-101648012 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
935462151 2:103349933-103349955 CTCAAATTTTAGTGCAGTTCTGG - Intergenic
935776078 2:106473001-106473023 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
935988141 2:108694480-108694502 CTCAGGCTGGAGTACAGTGTTGG + Intergenic
936365695 2:111852943-111852965 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
936812560 2:116419287-116419309 CCCAGGCTGGAGTGCAGTTGTGG - Intergenic
938211702 2:129471102-129471124 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
939415175 2:141887036-141887058 CCCAACCTGGAGTGCAGTGATGG + Intronic
939477756 2:142708044-142708066 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
939490139 2:142867126-142867148 CTCAGAGTGGAATGGAGTTTAGG - Intergenic
939926248 2:148177397-148177419 CTCAAACTGTAATGCACTTAAGG - Intronic
939954936 2:148519914-148519936 CCCAGACTGGAGTGCAGTGGCGG + Intergenic
940528733 2:154851197-154851219 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
941255967 2:163231284-163231306 CTCAAACTACAGTGCAGTTCTGG + Intergenic
941439259 2:165513060-165513082 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
942135441 2:172920431-172920453 CTCAAACTGGACTTCAGTCAAGG + Intronic
942978534 2:182049288-182049310 CCCAGACTGGAGTGCAGTGGTGG - Intronic
943463706 2:188201952-188201974 TTCAAACTTGAAAGCAGTTTAGG - Intergenic
943660288 2:190552675-190552697 CCCAAGCTGGAGTGCAGTGGTGG - Intergenic
943753395 2:191533436-191533458 CACTAACAGAAGTGCAGTTTGGG + Intergenic
943757217 2:191569274-191569296 CTCGAACTGGAGTCAAGTTGAGG - Intergenic
944322658 2:198366300-198366322 CCCAAGCTGGAGTGCAGTGATGG + Intronic
944546849 2:200807412-200807434 CCCAGACTGGAGTGCAGTGGCGG + Intergenic
944576882 2:201098608-201098630 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
944755856 2:202760947-202760969 CCCAGGCTGGAGTGCAGTATTGG + Intronic
944936752 2:204577612-204577634 CTCAAGCTGGAGTGCAATGGTGG + Intronic
945821820 2:214673928-214673950 CTCAGACTGGAGGGCAGTGGCGG - Intergenic
946204608 2:218094623-218094645 CTCAGCCTGGAGTGCAATCTTGG - Intergenic
946540682 2:220680974-220680996 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
946731852 2:222717452-222717474 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
946862350 2:224012558-224012580 CCCAGACTGGAGTGCAGTGGTGG - Intronic
947323885 2:228953484-228953506 TTCATATTGCAGTGCAGTTTTGG - Intronic
947477319 2:230461904-230461926 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
947601447 2:231453223-231453245 CCCAGGCTGGAGTGCAGTGTCGG + Intergenic
947811511 2:233007199-233007221 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
947971709 2:234330585-234330607 CCCAGGCTGGAGTGCAGTCTTGG + Intergenic
948115000 2:235488603-235488625 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
948197900 2:236108653-236108675 CTTGACCTGGAGTGCACTTTCGG + Intronic
948900265 2:240953117-240953139 GTCAAACAGGAGTGCAGGCTTGG + Intronic
1169445033 20:5664735-5664757 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
1170223543 20:13965911-13965933 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1170305921 20:14937494-14937516 CTCAGACTGTGGTCCAGTTTGGG + Intronic
1170700315 20:18697187-18697209 CCCAGACTGGAGTGCAGTGGCGG - Intronic
1170980917 20:21212044-21212066 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
1172144438 20:32746241-32746263 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1172239910 20:33406067-33406089 CCCAGGCTGGAGTGCAGTTGCGG - Intergenic
1172263649 20:33591429-33591451 CTCAGGCTGGAGTGCAGTAGTGG - Intronic
1172304064 20:33869265-33869287 CTCAAAATGGAATTAAGTTTTGG + Intergenic
1172995275 20:39065747-39065769 CTCAGACTGGAGTGCAGTGGGGG + Intergenic
1173052847 20:39581364-39581386 CTCAAACTGGAGGGCTTCTTTGG - Intergenic
1173129841 20:40381726-40381748 CCCAAGCTGGAGTGCAGTGGCGG + Intergenic
1173789416 20:45818053-45818075 CAGAACCTGGAGGGCAGTTTGGG - Intergenic
1173947918 20:46966172-46966194 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1174275006 20:49397251-49397273 CTCAAACTGGAGTGCTGTGGCGG - Intronic
1174472105 20:50768776-50768798 CCCAGGCTGGAGTGCAGTTGTGG - Intergenic
1174911598 20:54613949-54613971 CCCAGACTGGAGTGCAGTGGCGG - Intronic
1175222221 20:57423840-57423862 CTCAAGCTGGAGGGCAGTGGTGG + Intergenic
1175321307 20:58090307-58090329 AGCACACTGGAGTGCAGTCTGGG - Intergenic
1175333580 20:58180558-58180580 CTCAGACTGGAGGGCAGTGGCGG - Intergenic
1176036269 20:63038900-63038922 CCCAAGCTGGAGTGCAGTGGCGG + Intergenic
1176605465 21:8826811-8826833 CCCAATCTGGAGTGCAGTGATGG + Intergenic
1176631956 21:9148128-9148150 CCCAGACTGGAGTGCAGTAGTGG - Intergenic
1176641347 21:9306731-9306753 CCCAGACTGGAGTGCAGTAGTGG + Intergenic
1177399118 21:20579492-20579514 CTCAGACTGGAGTGCAGTGGTGG + Intergenic
1177743185 21:25178553-25178575 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
1179213243 21:39344211-39344233 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1179833221 21:44011695-44011717 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1180347760 22:11718416-11718438 CCCAATCTGGAGTGCAGTGATGG + Intergenic
1180374650 22:12079497-12079519 CCCAGACTGGAGTGCAGTAGTGG + Intergenic
1180387846 22:12195981-12196003 CCCAGACTGGAGTGCAGTAGTGG - Intergenic
1180606693 22:17064403-17064425 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1180677062 22:17594149-17594171 CGCAGGCTGGAGTGCAGTCTTGG - Intronic
1180768081 22:18358747-18358769 CTCAGGCTGGAGTGCAGTAGTGG + Intergenic
1180865713 22:19118326-19118348 CCCAGGCTGGAGTGCAGTTGCGG - Intronic
1181099444 22:20529640-20529662 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1181219714 22:21358871-21358893 CCCAGGCTGGAGTGCAGTGTTGG + Intergenic
1181360114 22:22327744-22327766 CTCAGACTGGAGTCCAGTGATGG - Intergenic
1183128912 22:35813885-35813907 ATCAAACTGGAGTGCAGGGATGG + Intronic
1183139724 22:35925473-35925495 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
1183147952 22:36012535-36012557 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1183680125 22:39323496-39323518 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1183960510 22:41409083-41409105 CTCAGGCTGGAGTGCAGTGCAGG + Intergenic
949553851 3:5135329-5135351 CCCAGACTGGAGTGCAGTCTTGG + Intronic
949769475 3:7563683-7563705 ATGAAACTGGAGTGGAGGTTCGG + Intronic
949799763 3:7890672-7890694 CCCAGGCTGGAGTGCAGTTGCGG - Intergenic
949955667 3:9266740-9266762 CTCCAAATGGAGTGCAGTGGAGG - Intronic
950527006 3:13530063-13530085 TGCAAACTAGAGAGCAGTTTGGG + Intergenic
950778003 3:15366944-15366966 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
951233221 3:20204027-20204049 CCCAAGCTGGAGTGCAGTAGTGG + Intergenic
951478938 3:23139302-23139324 CCCAGGCTGGAGTGCAGTGTCGG - Intergenic
951565725 3:24010940-24010962 CTCAGGCTGGAGTGCAATCTTGG - Intergenic
951930632 3:27963259-27963281 CTCAGGCTGGAGTGCAATCTCGG + Intergenic
952281609 3:31928720-31928742 CCCAGACTGGAGTGCAGTGGCGG - Intronic
953500934 3:43433413-43433435 CTCAAACTGAAGTGCAGCACAGG - Intronic
954023088 3:47759576-47759598 CCCAGACTGGAGTGCAGTGGTGG - Intronic
954468090 3:50669038-50669060 CTCACGCTGGAGTGCAGTGGTGG + Intergenic
954738729 3:52729359-52729381 CCCAGGCTGGAGTGCAGTATTGG - Intronic
954770746 3:52965961-52965983 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
954873169 3:53783452-53783474 CTTAAAATGGATTGGAGTTTAGG + Intronic
955206156 3:56897921-56897943 CTCATGCTGGAGTGCAGTGGTGG + Intronic
955245948 3:57225392-57225414 CCCAGGCTGGAGTGCAGTTTCGG + Intronic
955248189 3:57248825-57248847 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
955293476 3:57714132-57714154 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
955631074 3:60976147-60976169 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
955749318 3:62171497-62171519 CTAAAACTGGACTGCAGTGATGG - Intronic
956478071 3:69644375-69644397 CCCAGGCTGGAGTGCAGTCTTGG - Intergenic
956635605 3:71361526-71361548 CTCACACTCGATTGCAGGTTTGG + Intronic
956766912 3:72491810-72491832 CCCAAGCTGGAGTGCAGTGACGG - Intergenic
956964705 3:74445303-74445325 CCCAAACTGGAGTGCAGTGGTGG + Intronic
958795222 3:98700074-98700096 CACAAGCTGGAGTGCAGTGGTGG + Intergenic
958838987 3:99180403-99180425 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
959074205 3:101733571-101733593 CCCAGACTGGAGTGCAGTGGCGG + Intronic
959167194 3:102795172-102795194 CTTATATTGGAGTGCAGTTAAGG + Intergenic
959194906 3:103167307-103167329 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
959647186 3:108716699-108716721 CCCAAGCTGGAGTGCAGTGGCGG + Intergenic
959761408 3:109970052-109970074 CCCAGGCTGGAGTGCAGTCTCGG + Intergenic
960099911 3:113730256-113730278 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
960441453 3:117693922-117693944 CCCAGGCTGGAGTGCAGTTCTGG + Intergenic
960571296 3:119187730-119187752 CTCCATCAGGAGTGCAGCTTTGG - Intronic
961138275 3:124532756-124532778 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
961177074 3:124844515-124844537 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
962518917 3:136180020-136180042 CCCAAGCTGGAGTGCAGTGGAGG - Intronic
962805682 3:138925519-138925541 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
962979860 3:140478638-140478660 CTAAAACTGGATTGCAGTGATGG + Intronic
963164631 3:142188481-142188503 CCCAGGCTGGAGTGCAGTCTCGG - Intronic
963194729 3:142514220-142514242 CTCAGGCTGGAGTGCAGTCTCGG - Intronic
964013216 3:151915709-151915731 CACAAACTATATTGCAGTTTTGG + Intergenic
964131500 3:153292944-153292966 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
964247952 3:154675832-154675854 CTTAGGCTGGAATGCAGTTTGGG + Intergenic
964354605 3:155838636-155838658 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
964597552 3:158453421-158453443 CCCAGGCTGGAGTGCAGTTTTGG + Intronic
965069275 3:163896680-163896702 GTCAAACTGCAGTGCATTTGAGG + Intergenic
965202958 3:165683930-165683952 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
965964436 3:174469469-174469491 CCCAGACTGGAGTGCAGTGGCGG + Intronic
965966770 3:174501119-174501141 CTCAGGCTGGAGTGCAGTGGCGG + Intronic
966612937 3:181886249-181886271 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
966816734 3:183895988-183896010 CTCAAGCTGGAGTACATCTTTGG - Intergenic
967318746 3:188175127-188175149 CTCAGCCTGGAGTGCAGTCGTGG + Intronic
967666730 3:192181671-192181693 CCCAGACTGGAGTGCAGTAGCGG + Intronic
967722115 3:192826932-192826954 CCCAGACTGGAGTGCAGTGGTGG + Intronic
968200043 3:196745156-196745178 CTCAGGCTGGAGTGCAGTGTTGG + Intronic
968282508 3:197487702-197487724 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1202745548 3_GL000221v1_random:98291-98313 CCCAGACTGGAGTGCAGTAGTGG - Intergenic
968824122 4:2880516-2880538 CCCAAGCTGGAGTGCAGTGGCGG + Intronic
969780995 4:9403974-9403996 CCCAGGCTGGAGTGCAGTGTCGG - Intergenic
971064288 4:23011934-23011956 TTCAAACTAGAGTTCAATTTGGG - Intergenic
971234233 4:24826913-24826935 CTCAAACTTGAGAGAGGTTTGGG + Intronic
971655737 4:29342218-29342240 CCCAGGCTGGAGTGCAGTTTTGG + Intergenic
971778876 4:31004641-31004663 CCCAGGCTGGAGTGCAGTGTCGG - Intronic
971871236 4:32241774-32241796 TTTAATCTGAAGTGCAGTTTGGG + Intergenic
972519877 4:39843659-39843681 CTCAGGCTGGAGTGCAGTGATGG - Intronic
972584994 4:40429644-40429666 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
972845990 4:42990232-42990254 CCCAGGCTGGAGTGCAGTGTCGG + Intronic
973124224 4:46564429-46564451 CCCAGGCTGGAGTGCAGTTGTGG + Intergenic
973330884 4:48909296-48909318 CTCAGGCTGGAGTGCAGTCCAGG + Intergenic
973372634 4:49264093-49264115 CCCAATCTGGAGTGCAGTGATGG - Intergenic
973701352 4:53540338-53540360 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
973768394 4:54184466-54184488 CTCAGCCTGGAGTGCAGTGGCGG - Intronic
973891462 4:55371693-55371715 CCCAGACTGGAGTGCAGTGGTGG + Exonic
975419217 4:74142729-74142751 CTAAAACTGGAGTGCACGTAGGG - Intronic
975597398 4:76062601-76062623 CCCAGACTGGAGTGCAGTGGTGG + Intronic
975647943 4:76564207-76564229 TGCAAACGGAAGTGCAGTTTGGG - Intronic
976258311 4:83121640-83121662 CTTATACTGCAGAGCAGTTTAGG + Intronic
976516495 4:85973883-85973905 CCCAAGCTGGAGTGCAGTGGCGG + Intronic
976654893 4:87478478-87478500 CCCAGGCTGGAGTGCAGTGTTGG + Intronic
977337918 4:95721383-95721405 CTTAGACTGCAGGGCAGTTTAGG - Intergenic
977600702 4:98931094-98931116 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
977942277 4:102872117-102872139 CCCACACTGGAGTGCAGTGTCGG + Intronic
978687594 4:111464967-111464989 CCCAAGCTGGAGTGCAGTAGTGG - Intergenic
979770084 4:124513475-124513497 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
979930082 4:126619043-126619065 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
980589786 4:134870540-134870562 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
980666105 4:135938219-135938241 CCCAGACTGGAGTGCAGTGGCGG + Intergenic
981108676 4:140910804-140910826 CTCAGACTGGAGGGCAGGTGAGG - Intronic
981164399 4:141540429-141540451 CCCAGACTGGAGTGCAGTGGCGG + Intergenic
981519554 4:145647897-145647919 CCCAGGCTGGAGTGCAGTTGCGG + Intronic
981600620 4:146484309-146484331 CTCAGGCTGGAGTGCAGTGTTGG - Intronic
982006882 4:151071971-151071993 CCCAGACTGGAGTGCAGTGGAGG - Intergenic
982265256 4:153533026-153533048 CCCAGGCTGGAGTGCAGTGTTGG + Intronic
982682603 4:158449260-158449282 CCCAAGCTGGAGTGCAGTGGAGG - Intronic
982766215 4:159351906-159351928 CCCAAGCTGGAGTGCAGTGGCGG - Intronic
983592122 4:169425591-169425613 CCCAGGCTGGAGTGCAGTCTTGG + Intronic
984159286 4:176231800-176231822 CCCAAGCTGGAGTGCAGTATTGG - Intronic
984488085 4:180398144-180398166 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
984616918 4:181908866-181908888 CTTAAAGTGGATTGCAGATTTGG + Intergenic
984830634 4:183969659-183969681 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
984865239 4:184275248-184275270 ATCAAACTGGAGTTCAGTCTGGG + Intergenic
984904416 4:184613573-184613595 CAGAAACTGGAGTTCAGATTGGG + Intergenic
985211016 4:187594613-187594635 CTCAGGCTGGAGTGCAGTGGCGG + Intergenic
985263527 4:188137343-188137365 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
985313216 4:188626617-188626639 CTCAAACGGGACTGAAGATTAGG + Intergenic
1202756236 4_GL000008v2_random:64940-64962 CCCAGACTGGAGTGCAGTAGTGG + Intergenic
985648659 5:1097078-1097100 CTCCACCAGGAGTGCAGCTTGGG + Intronic
986736035 5:10667979-10668001 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
987184959 5:15407877-15407899 CCCAAGCTGGAGTGCAGTGATGG + Intergenic
988050585 5:26024926-26024948 CTCAACCTGGAGTGCAGTGGTGG + Intergenic
988057095 5:26111330-26111352 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
988137084 5:27187661-27187683 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
988816684 5:34841001-34841023 CCCAGACTGGAGTGCAGTGATGG - Intronic
989778500 5:45237063-45237085 CCCAGACTGGAGTGCAGTGGCGG + Intergenic
990010138 5:50987506-50987528 CCCAGACTGGAGTGCAGTGGGGG - Intergenic
990290381 5:54344601-54344623 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
990399737 5:55426440-55426462 CCCAGACTGGAGTGCAGTGGTGG + Intronic
991060932 5:62374882-62374904 CCCAGACTGGAGTGCAGTGGTGG - Intronic
991386358 5:66094776-66094798 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
991926983 5:71715393-71715415 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
992510986 5:77434652-77434674 CCCAGGCTGGAGTGCAGTCTTGG - Intronic
992802784 5:80308976-80308998 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
992860923 5:80909089-80909111 CTCAGTCTGGAGTGCAGTGGTGG + Intergenic
993350014 5:86838466-86838488 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
993614907 5:90098855-90098877 CCAACACTGTAGTGCAGTTTGGG - Intergenic
994273425 5:97808445-97808467 CCCAGGCTGGAGTGCAGTTGCGG + Intergenic
994484834 5:100378844-100378866 CCCACACTGGAGTGCAGTGGTGG - Intergenic
994904586 5:105822041-105822063 CCCAGACTGGAGTGCAGTGGTGG + Intergenic
994981918 5:106886125-106886147 CTGAGACTGGAGTGCAGTGGTGG - Intergenic
995080080 5:108040835-108040857 ATAAAAGTGGAGTGCAGCTTTGG + Intronic
995296124 5:110524216-110524238 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
995484276 5:112623710-112623732 CCCAGGCTGGAGTGCAGTGTTGG + Intergenic
995569002 5:113459493-113459515 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
996065840 5:119078491-119078513 CACAGGCTGGAGTGCAGTTGTGG + Intronic
996081330 5:119261455-119261477 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
996152865 5:120061455-120061477 CTTAAATTGGAGAGCAGTGTTGG + Intergenic
996511098 5:124316701-124316723 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
997127990 5:131247682-131247704 CTCAGGCTGGAGTGCAGTGGCGG + Intronic
997224342 5:132197563-132197585 CCCAGACTGGAGTGCAGTGGTGG - Intronic
997476093 5:134143380-134143402 TTCAAACTGGAGACCAGATTGGG + Intronic
997496416 5:134330670-134330692 CCCAGACTGGAGTGCAGTTGTGG - Intronic
997537759 5:134635801-134635823 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
997542758 5:134677791-134677813 CCCAGACTGGAGTACAGTGTGGG - Intronic
997915446 5:137920158-137920180 CGCAGACTGGAGTGCAGTGGTGG - Intronic
998429935 5:142062080-142062102 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
999282176 5:150373121-150373143 CCCAAGCTGGAGTGCAGTAGCGG + Intronic
999894278 5:156012653-156012675 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1000046551 5:157526661-157526683 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1000508321 5:162149654-162149676 CTCAGGCTGGAGTGCAGTGGCGG + Intronic
1002047784 5:176551742-176551764 CCCAAGCTGGAGTGCAGTAGCGG + Intronic
1002168115 5:177360522-177360544 CTCAGACTGCACTGCAGTCTGGG + Intronic
1002169011 5:177364974-177364996 CTCAAACTTCAGTGCAGAGTGGG - Intronic
1002388267 5:178887839-178887861 CCCAAGCTGGAGTGCAGTGGTGG - Intronic
1004306324 6:14504864-14504886 CTCAGTCTGGAGTGCAGTGGCGG - Intergenic
1004357219 6:14940434-14940456 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1004652334 6:17622420-17622442 CACAAACTGGAGTACAGTGGTGG - Intronic
1005057690 6:21745393-21745415 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1005076284 6:21910865-21910887 CCCAGACTGGAGTGCAATCTCGG - Intergenic
1005774483 6:29116012-29116034 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
1005942221 6:30569126-30569148 CCCAACCTGGAGTGCAGTGGCGG + Intergenic
1006008606 6:31023085-31023107 CTCAGGCTGGAGTGCAGTGATGG - Intronic
1006344869 6:33472670-33472692 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1006435349 6:34023200-34023222 CTCACACAGGAGTGGGGTTTGGG - Intronic
1006486659 6:34348437-34348459 CTCAGGCTGGAGTGCAGTAGTGG - Intronic
1006541512 6:34743867-34743889 CCCAAGCTGGAGTGCAGTGGCGG - Intergenic
1006758679 6:36440053-36440075 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1007201044 6:40109363-40109385 CTAGGACTGGACTGCAGTTTGGG + Intergenic
1007614042 6:43170250-43170272 CCCAACCTGGAGTGCAGTGGCGG - Intergenic
1008099321 6:47374570-47374592 CCCACGCTGGAGTGCAGTATTGG + Intergenic
1008700649 6:54095549-54095571 CTGTAACTGGAATGCAGTTGGGG + Intronic
1009311322 6:62156690-62156712 CTCAGGCTGGAGTGCAGTGCAGG + Intronic
1009979259 6:70707646-70707668 CCCAAGCTGGAGTGCAGTAGTGG + Intronic
1011923094 6:92606799-92606821 CCCAAGCTGGAGTGCAGTGGCGG - Intergenic
1012356608 6:98322011-98322033 CCCACACTGGAGTGCAGTGGTGG - Intergenic
1012897398 6:104966494-104966516 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1013123419 6:107160387-107160409 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1013466771 6:110424496-110424518 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1013503797 6:110778981-110779003 CTCACACTGAAGTCCAGTTTTGG - Intronic
1013511864 6:110852093-110852115 CCCAGGCTGGAGTGCAGTTGTGG + Intronic
1013772095 6:113639279-113639301 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1013904234 6:115196560-115196582 ATAAACCTGGAGTGCAATTTTGG + Intergenic
1014440551 6:121469084-121469106 CCCAGACTGGAGTGCAGTGGTGG + Intergenic
1014576097 6:123075009-123075031 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1015183322 6:130384075-130384097 CTCAGGCTGGAGTGCAGTGTTGG - Intronic
1015707584 6:136104864-136104886 CTCAAAGTGCAGTGTAGTTATGG + Intronic
1016829628 6:148421039-148421061 CCCAGACTGGAGTGCAGTGGCGG - Intronic
1017064135 6:150513040-150513062 CTCAAGCTGGAGTGCAATCATGG - Intergenic
1017465960 6:154694055-154694077 CCCAGACTGGAGTGCAGTAATGG + Intergenic
1017930431 6:158949362-158949384 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1018262926 6:161988441-161988463 CTCAGGCTGGAGTGCAGTGCGGG - Intronic
1018569853 6:165197240-165197262 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1018725472 6:166609548-166609570 CCCAGGCTGGAGTGCAGTCTTGG + Intronic
1018985434 6:168633071-168633093 CTCAAACAGCAGTGCAGATTGGG - Intronic
1019102760 6:169644964-169644986 CTCAGGCTGGAGTGCAGTGGCGG - Intronic
1020571144 7:9863585-9863607 ATGAATCTGCAGTGCAGTTTGGG + Intergenic
1020589585 7:10117668-10117690 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1021670229 7:23028486-23028508 CCCAGACTGGAGTGCAGTGGTGG + Intergenic
1022075714 7:26967949-26967971 CCCAAGCTGGAGTGCAGTGGTGG + Intronic
1022164958 7:27749833-27749855 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1023099048 7:36694445-36694467 CCCAGACTGGAGTGCAATCTCGG - Intronic
1024280321 7:47713350-47713372 CCCAAGCTGGAGTGCAGTGGCGG + Intronic
1025050727 7:55731873-55731895 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1025856155 7:65280994-65281016 CCCAGACTGGAGTGCAGTAGTGG + Intergenic
1026175328 7:67991597-67991619 CCCAAGCTGGAGTGCAATCTTGG + Intergenic
1026205989 7:68257878-68257900 CCCAGGCTGGAGTGCAATTTTGG - Intergenic
1026954707 7:74369810-74369832 CTCAGGCTGGAGTGCAGTGGAGG - Intronic
1026954754 7:74370111-74370133 CTCAGGCTGGAGTGCAGTGGAGG - Intronic
1026994868 7:74608963-74608985 CCCAGGCTGGAGTGCAGTATCGG + Intergenic
1027152584 7:75743076-75743098 CTCAGGCTGGAGTGCAGTAGCGG + Intergenic
1027179845 7:75930863-75930885 CCCAGGCTGGAGTGCAGTGTTGG + Intronic
1027488378 7:78790474-78790496 CCCAGGCTGGAGTGCAGTGTTGG + Intronic
1027678238 7:81186206-81186228 TTCAAACAGCAGTGCAGTTGGGG - Intronic
1028646037 7:93097670-93097692 CACACACTGGAGTGGAGGTTGGG - Intergenic
1028956174 7:96694420-96694442 CTCAAACTGGAATGGAGATTGGG - Intronic
1029516364 7:101025905-101025927 CCCAGGCTGGAGTGCAGTCTTGG - Intronic
1029529486 7:101115814-101115836 CCCAGGCTGGAGTGCAGTTGGGG + Intergenic
1029845643 7:103409748-103409770 CTCAGGCTGGAGTGCAGTGATGG + Intronic
1030780209 7:113591605-113591627 CCCAGACTGGAGTGCAGTGGGGG - Intergenic
1031120767 7:117719156-117719178 CCCAGACTGGAGTGCAGTGGCGG - Intronic
1031497772 7:122472176-122472198 CTAAAACTGGAGGACAGGTTAGG + Intronic
1031598118 7:123671015-123671037 CTCATTTGGGAGTGCAGTTTGGG - Intergenic
1032028266 7:128460740-128460762 CCCAGACTGGAGTGCAGTGGTGG + Intergenic
1032190770 7:129764352-129764374 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1033051683 7:138010293-138010315 CTGAGACTGGAGTGCAGTGGTGG + Intronic
1033073280 7:138224260-138224282 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1033912588 7:146283408-146283430 CTCAGGCTGGAGTGCAGTTGTGG + Intronic
1034132592 7:148734288-148734310 CCCAGGCTGGAGTGCAGTTGTGG + Intronic
1034438059 7:151072696-151072718 CCCAGGCTGGAGTGCAGTTTTGG + Intronic
1034628651 7:152513750-152513772 CCCAAGCTGGAGTGCAGTGGCGG - Intergenic
1034907453 7:154963216-154963238 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1036278432 8:7377909-7377931 CCCAGGCTGGAGTGCAGTGTTGG - Intronic
1036343091 8:7933981-7934003 CCCAGGCTGGAGTGCAGTGTCGG + Intronic
1036598400 8:10236585-10236607 CTCAAGCTAGAGTGCAGTGGTGG + Intronic
1036838427 8:12094745-12094767 CCCAGGCTGGAGTGCAGTGTCGG + Intergenic
1036860218 8:12340993-12341015 CCCAGGCTGGAGTGCAGTGTCGG + Intergenic
1036950821 8:13137642-13137664 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1037227733 8:16614074-16614096 CTCAAAATGGGGTGTAATTTGGG + Intergenic
1037409718 8:18583386-18583408 CCCAAACTGGAGTGCAATGGCGG - Intronic
1037568431 8:20137573-20137595 AGGAAACTGGAGTCCAGTTTAGG + Intergenic
1037797943 8:22011771-22011793 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
1038499053 8:28028396-28028418 CTCCACCGGGACTGCAGTTTTGG - Intronic
1039045313 8:33444276-33444298 CTCCAACTGGGGTGCATTTCTGG - Intronic
1039417581 8:37408949-37408971 CCCAGGCTGGAGTGCAGTGTTGG - Intergenic
1039569339 8:38574682-38574704 CCCAGGCTGGAGTGCAGTTGCGG + Intergenic
1039744050 8:40407812-40407834 CCCAGGCTGGAGTGCAGTTGTGG - Intergenic
1039974209 8:42346420-42346442 CTCAGGCTGGAGTGCAGTGGTGG + Intronic
1040399172 8:47030913-47030935 CCCAGGCTGGAGTGCAGTTGCGG - Intergenic
1040488890 8:47901104-47901126 CTCAGGCTGGAGTGCAGTGGGGG - Intronic
1040508218 8:48070835-48070857 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1041139283 8:54798054-54798076 CTCAAGCTGGAGTGCAGTGGTGG + Intergenic
1041217373 8:55614411-55614433 CCCAAGCTGGAGTGCAGTGGCGG + Intergenic
1041355827 8:56998837-56998859 CTCAGACTGGAGTGCAGTGGTGG - Intergenic
1042173345 8:66014361-66014383 CTCAGGCTGGAGTGCAGTGGGGG + Intergenic
1042548421 8:69971665-69971687 CTGAAGCTGGAGTGCAGTGGCGG - Intergenic
1043059185 8:75478269-75478291 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1043182015 8:77096981-77097003 CTCAAACTGGAATGTAAGTTAGG - Intergenic
1044321114 8:90802937-90802959 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1045283190 8:100767203-100767225 CCCAAGCTGGAGTGCAGTGGTGG - Intergenic
1045902515 8:107301041-107301063 TTCAAACTAGAGTGTAGTTGTGG + Intronic
1046126977 8:109922054-109922076 CCCCAACTGGAGTGCAGTGGTGG + Intergenic
1046273031 8:111920649-111920671 CTCACACTTGAATGCAGTGTAGG + Intergenic
1046377747 8:113409124-113409146 CTCAGCCTGGAGTGCAGTGGTGG + Intronic
1047335903 8:123936037-123936059 CTCAAACAGCTGTGCAGTGTTGG + Intronic
1049193569 8:141303035-141303057 CCCCAGCTGGAGTGCAGTGTGGG + Intronic
1050025522 9:1330959-1330981 CTCAAACCAGAGTGGAGGTTTGG - Intergenic
1051120957 9:13751941-13751963 CTCAAACTGTAAAGCAGGTTTGG - Intergenic
1051527757 9:18065937-18065959 CTGAAGCTGGAGTGCAGTGGGGG - Intergenic
1051622483 9:19065976-19065998 CCCACACTGGAGTGCAGTGGCGG + Intronic
1051869989 9:21726586-21726608 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1051983408 9:23051787-23051809 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1052088284 9:24294732-24294754 GTCAAACTGAAGTGGAGTTTTGG - Intergenic
1052472501 9:28917493-28917515 CCCAGGCTGGAGTGCAGTTGTGG + Intergenic
1052584470 9:30408508-30408530 CCCAGACTGGAGTGCAGCTGTGG - Intergenic
1052979125 9:34434860-34434882 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1054863432 9:69975939-69975961 CCAGAGCTGGAGTGCAGTTTAGG + Intergenic
1055422684 9:76160811-76160833 CCCAGGCTGGAGTGCAGTGTTGG + Intronic
1055445296 9:76376299-76376321 CCCAGACTGGAGTGCAGTGGTGG - Intergenic
1055460268 9:76512942-76512964 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1055720928 9:79174165-79174187 TTCCAACTGGAGTTCAGTGTAGG + Intergenic
1055910345 9:81343462-81343484 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1057224606 9:93284732-93284754 CTTAAACTGGGCTGCAGGTTGGG - Intronic
1059096930 9:111426928-111426950 CCCAGACTGGAGTGCAGTAGTGG - Intronic
1059174362 9:112155659-112155681 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1059205697 9:112462771-112462793 CTCAGACTGGACTGTAGTTATGG - Intronic
1059314040 9:113409315-113409337 CCCAAGCTGGAGTGCAGTGATGG - Intronic
1059964347 9:119599157-119599179 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1060440685 9:123636357-123636379 CCCAGACTGGAGTGCAGTGGTGG + Intronic
1060603361 9:124893041-124893063 CACAAACTGGACTGCAGCCTGGG - Intronic
1061538544 9:131264764-131264786 CTCAGGCTGGAGTGCAGTGGCGG + Intronic
1061893971 9:133637361-133637383 TTCAAACTGGAGGGGACTTTAGG + Intronic
1203687838 Un_GL000214v1:12015-12037 CCCAGACTGGAGTGCAGTAGTGG + Intergenic
1203714168 Un_KI270742v1:128241-128263 CCCAGACTGGAGTGCAGTAGTGG - Intergenic
1203552868 Un_KI270743v1:178903-178925 CCCAATCTGGAGTGCAGTGATGG + Intergenic
1203648437 Un_KI270751v1:92038-92060 CCCAGACTGGAGTGCAGTAGTGG - Intergenic
1185475418 X:412655-412677 CCCAGGCTGGAGTGCAGTGTTGG + Intergenic
1185764754 X:2716377-2716399 CTCAGGTTGGAGTGCAGTGTTGG + Intronic
1185869388 X:3650834-3650856 CTCAGGCTGGAGTGCAGTGGTGG - Intronic
1185948347 X:4402646-4402668 CTCATGCTGGAGTGCAGTGGTGG + Intergenic
1186443470 X:9605888-9605910 CTGAAACTGGAGTGCATTGGTGG - Intronic
1189154330 X:38741481-38741503 CCCAGGCTGAAGTGCAGTTTCGG + Intergenic
1189407692 X:40739995-40740017 CTCAGGCTGGAGTGCAGTGGCGG - Intergenic
1189593049 X:42536063-42536085 CCCAGGCTGGAGTGCAGTGTCGG + Intergenic
1189648475 X:43160882-43160904 CTTAAAATGGAAGGCAGTTTTGG + Intergenic
1189986610 X:46558889-46558911 CCCAGACTGGAGTGCAGTGGCGG - Intergenic
1190845676 X:54188250-54188272 CCCAAGCTGGAGTGCAGTGGTGG + Intergenic
1192970864 X:76228410-76228432 CTAAGACTAGAGTGCAGTTTTGG + Intergenic
1193778171 X:85669446-85669468 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1194368460 X:93038984-93039006 CCCAGACTGGAGTGCAGTGGCGG + Intergenic
1194572842 X:95574356-95574378 CCCAAGCTGGAGTGCAGTGGCGG - Intergenic
1196242181 X:113354561-113354583 CTCAAACAAGGGAGCAGTTTAGG + Intergenic
1196321060 X:114340919-114340941 CTCAGACTGGAGTGCAATCTCGG + Intergenic
1196710229 X:118754592-118754614 CCCAGACTGGAGTGCAGTGGTGG - Intronic
1198303278 X:135352523-135352545 CTCAAAATGCAATCCAGTTTTGG - Intronic
1199443499 X:147895839-147895861 CTCAGGCTGGAGTGCAGTGGTGG + Intergenic
1199454176 X:148009138-148009160 CTGAGACTGGAGTGCAGTGGTGG - Intronic
1200676663 Y:6155261-6155283 CCCAGACTGGAGTGCAGTGGCGG + Intergenic
1201168413 Y:11233352-11233374 CCCAGACTGGAGTGCAGTAGTGG - Intergenic
1201254329 Y:12092122-12092144 GTCAAACTTGAGGGTAGTTTTGG + Intergenic
1201551255 Y:15219132-15219154 CTCAGGCTGGAGTGCAGTGGTGG - Intergenic
1201609783 Y:15828132-15828154 CCCAGGCTGGAGTGCAGTGTTGG + Intergenic
1201723162 Y:17125066-17125088 CCCAGACTGGAGTGCAGTGATGG - Intergenic
1202090937 Y:21188784-21188806 CTCAGGCTGGAGTGCAGTAGTGG + Intergenic