ID: 1092251961

View in Genome Browser
Species Human (GRCh38)
Location 12:6904560-6904582
Sequence ACTAATGAGCAGAAACTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 655}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092251952_1092251961 18 Left 1092251952 12:6904519-6904541 CCGCTCCACCAAGCCACCTTCCA 0: 1
1: 0
2: 4
3: 58
4: 645
Right 1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG 0: 1
1: 0
2: 2
3: 40
4: 655
1092251957_1092251961 2 Left 1092251957 12:6904535-6904557 CCTTCCAAAGGTCTACCTGAAAA 0: 1
1: 0
2: 3
3: 18
4: 270
Right 1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG 0: 1
1: 0
2: 2
3: 40
4: 655
1092251956_1092251961 5 Left 1092251956 12:6904532-6904554 CCACCTTCCAAAGGTCTACCTGA 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG 0: 1
1: 0
2: 2
3: 40
4: 655
1092251955_1092251961 10 Left 1092251955 12:6904527-6904549 CCAAGCCACCTTCCAAAGGTCTA 0: 1
1: 0
2: 4
3: 44
4: 327
Right 1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG 0: 1
1: 0
2: 2
3: 40
4: 655
1092251951_1092251961 22 Left 1092251951 12:6904515-6904537 CCTTCCGCTCCACCAAGCCACCT 0: 1
1: 0
2: 3
3: 20
4: 264
Right 1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG 0: 1
1: 0
2: 2
3: 40
4: 655
1092251958_1092251961 -2 Left 1092251958 12:6904539-6904561 CCAAAGGTCTACCTGAAAATAAC 0: 1
1: 0
2: 1
3: 4
4: 148
Right 1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG 0: 1
1: 0
2: 2
3: 40
4: 655
1092251954_1092251961 13 Left 1092251954 12:6904524-6904546 CCACCAAGCCACCTTCCAAAGGT 0: 1
1: 1
2: 1
3: 19
4: 189
Right 1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG 0: 1
1: 0
2: 2
3: 40
4: 655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092251961 Original CRISPR ACTAATGAGCAGAAACTATA GGG Intronic
902594439 1:17498970-17498992 ACTAATATCCAGAATCTATAAGG - Intergenic
904900331 1:33852067-33852089 ACTAAGGAGCAGAAACGACTGGG - Intronic
906395787 1:45463113-45463135 ATTAATAACCAGAAAATATAAGG - Intronic
906446252 1:45900879-45900901 ACTAATATCCAGAATCTATAAGG - Intronic
906809868 1:48815166-48815188 ACAAATGACCAAAAAATATATGG - Intronic
906889198 1:49688950-49688972 ATTAATAATCAGAAAATATAAGG - Intronic
906970092 1:50503779-50503801 ACTAATGAGTATATACCATATGG + Intronic
908890390 1:68840315-68840337 ACTAATATTCAGAATCTATAAGG - Intergenic
909234823 1:73139366-73139388 ACTAATGTTTAGAATCTATAAGG - Intergenic
909574027 1:77152613-77152635 ATTAATAACCAGAAAATATAAGG + Intronic
909629397 1:77755786-77755808 AGTAATGTGGTGAAACTATAGGG - Intronic
909708541 1:78616620-78616642 ACTAATGTCCAGAATCTATAAGG + Intergenic
909981713 1:82110067-82110089 ACTAATAATCAGAAAGAATATGG + Intergenic
910644367 1:89497340-89497362 ATTAATAAGCAGAATATATAAGG + Intergenic
911036747 1:93558188-93558210 ACTAATATCCAGAATCTATAAGG - Intergenic
911276926 1:95872609-95872631 AATAATGAGAAGGAACTATGTGG + Intergenic
911599456 1:99832632-99832654 ACTAATATCCAGAATCTATAAGG + Intergenic
911748065 1:101463183-101463205 TCTAATGTCCAGAATCTATAAGG + Intergenic
911903285 1:103531713-103531735 ACTAATGTCCAGAATCTACAAGG - Intronic
912142002 1:106741623-106741645 AATAAAGAGCAGAAAGTAAAAGG - Intergenic
912215057 1:107600219-107600241 ACAAATGAACAGAAACAAAATGG + Intronic
912227032 1:107745604-107745626 ACTAATGAACAGTAAGTATCTGG - Intronic
912303265 1:108538406-108538428 TCTAATATGCAGAATCTATAAGG - Intergenic
912792962 1:112671430-112671452 ATTACTGAGCAGAAACAAAACGG - Exonic
913194727 1:116446246-116446268 ACTAATATCCAGAATCTATAAGG - Intergenic
917078517 1:171232514-171232536 TCTAATGAACAGAAAATATTTGG - Intergenic
917294901 1:173508440-173508462 ACCAATGGGTAGAAACTGTATGG - Intronic
917372672 1:174312480-174312502 ATTAATAACCAGAAAATATAAGG - Intronic
917386704 1:174484282-174484304 ATTAATAACCAGAATCTATAAGG - Intronic
918835148 1:189452742-189452764 ACTAATAACCAGAATATATAAGG - Intergenic
919037049 1:192325824-192325846 TCTAATGCCCAGAATCTATAAGG - Intronic
919226988 1:194716960-194716982 TCTAATGTCCAGAATCTATAAGG - Intergenic
919235091 1:194830633-194830655 TCTTTTGAGCAGAGACTATAAGG - Intergenic
919288010 1:195590213-195590235 ACTAATAACCAGAATATATAAGG + Intergenic
921139115 1:212288404-212288426 ACTAGTGACCAAATACTATATGG - Intronic
921521230 1:216156780-216156802 TCTAATATGCAGAACCTATAAGG + Intronic
921585609 1:216942792-216942814 ACTAATGTCCAGAAACTACAAGG - Intronic
922052461 1:222006687-222006709 TCTAATCACCAGAATCTATAAGG - Intergenic
922549889 1:226486566-226486588 ATTAATAACCAGAAAATATAAGG - Intergenic
923237633 1:232049620-232049642 ACAAATGAGCATAATTTATATGG - Intergenic
923466852 1:234256053-234256075 AAAAATGAGCAGAAACTAGAGGG - Intronic
924073402 1:240307124-240307146 ACTAATATCCAGAATCTATAAGG - Intronic
924183077 1:241458737-241458759 ACGAATAAGCAGAAACTATAAGG + Intergenic
1063260510 10:4384242-4384264 ATTAATGAGCAAAAACATTAAGG - Intergenic
1063312380 10:4965970-4965992 ATAAATGAGCAGAATCAATATGG - Exonic
1063325455 10:5096466-5096488 ATAAATGAGCAGAATCTATATGG - Exonic
1063328645 10:5132691-5132713 ATAAATGAGCAGAATCAATATGG + Intronic
1064572420 10:16708179-16708201 ACTATTGATCAGAAACCTTACGG + Intronic
1065431150 10:25657571-25657593 ATTAATAAGCAGAACATATAAGG - Intergenic
1066753120 10:38680443-38680465 ACTAATATCCAGAATCTATAAGG + Intergenic
1066753301 10:38682623-38682645 ACTAATATCCAGAATCTATAAGG + Intergenic
1067741819 10:48901316-48901338 TTTAATGAACAGAAACCATAGGG - Intronic
1068170315 10:53384328-53384350 ACTAATGCAGAGAAATTATAGGG - Intergenic
1068354005 10:55887009-55887031 ACTAATATCCAGAATCTATAAGG + Intergenic
1068448269 10:57151955-57151977 ATTAATGAACAGAATATATAAGG + Intergenic
1069248401 10:66238134-66238156 AATAAAAAGCAAAAACTATAGGG - Intronic
1069294724 10:66829790-66829812 CCTACTGATCAGAAACTATGAGG + Intronic
1069938407 10:71936124-71936146 ACTAGTGTCCAGAATCTATAAGG - Intergenic
1070234821 10:74612511-74612533 ACTAATATCCAGAATCTATAAGG - Intronic
1070495816 10:77021126-77021148 ATTAATGAGATGAAATTATAGGG + Intronic
1071040078 10:81296940-81296962 GCTAATATGCAGAATCTATATGG - Intergenic
1071064980 10:81620972-81620994 ATTAATGACCAGAATATATAGGG - Intergenic
1071248956 10:83796212-83796234 TCTAATAACCAGAATCTATAAGG + Intergenic
1071401315 10:85275282-85275304 TCTAATGTCCAGAATCTATAAGG - Intergenic
1072604052 10:96963173-96963195 ACTACTGAGCAGATAATATGGGG + Intronic
1073715817 10:106106155-106106177 ACAAATGGGCATAAAATATATGG + Intergenic
1073832523 10:107402323-107402345 ATTAATGGGTAGAAAATATAAGG - Intergenic
1073943772 10:108728458-108728480 ACTAATTTTCAGAATCTATAAGG + Intergenic
1074671966 10:115801160-115801182 ACTAATGAACGGAAAATACAGGG - Intronic
1075245500 10:120818620-120818642 ACAAATGACCACAAACTTTAAGG - Intergenic
1075542067 10:123322877-123322899 ACTAATATCCAGAATCTATAAGG - Intergenic
1077379836 11:2226228-2226250 TCTAATGTCCAGAATCTATAAGG + Intergenic
1077989575 11:7391993-7392015 ACTAATATACAGAATCTATAAGG - Intronic
1078384440 11:10875616-10875638 ACTAATAACCAGAATCTATAAGG - Intergenic
1078514800 11:12012702-12012724 ACTAATATCCAGAATCTATAAGG + Intergenic
1078946706 11:16076366-16076388 TCTAATATGCAGAATCTATAAGG + Intronic
1079642063 11:22817852-22817874 TCTAATATGCAGAATCTATAAGG - Intronic
1079704685 11:23599411-23599433 ACTAATGTCCAGAATCTACAGGG - Intergenic
1079854987 11:25591639-25591661 ACTAATGTCCAGAATCTACAAGG - Intergenic
1079958342 11:26891457-26891479 CCTAATGTCCAGAATCTATAAGG + Intergenic
1080485003 11:32696811-32696833 AGTAGTGATCAGAAACTCTAGGG - Intronic
1080953007 11:37058058-37058080 ACTAATATCCAGAATCTATAAGG + Intergenic
1081000260 11:37661085-37661107 ACAAATTACCAGAAACTTTATGG + Intergenic
1081010268 11:37802026-37802048 ACTAATGTCCAGAATCTATAAGG + Intergenic
1081167582 11:39824840-39824862 ACTAATATCCAGAATCTATAAGG + Intergenic
1081212202 11:40349970-40349992 ACTAATAACCAGAATATATAAGG - Intronic
1081524121 11:43912517-43912539 ACAAATGAGCAGAAAGGACAAGG - Intronic
1083056464 11:59825763-59825785 ACTAATATCCAGAACCTATAAGG - Intergenic
1083506475 11:63162145-63162167 ACTAATCACCAGAATATATAAGG - Intronic
1084253201 11:67918818-67918840 ACTAATGTCCAGAATCTACAGGG - Intergenic
1084819678 11:71677113-71677135 ACTAATGTCCAGAATCTACAGGG + Intergenic
1085138400 11:74116236-74116258 ACTAATATCCAGAATCTATAAGG + Intronic
1085658067 11:78335120-78335142 ATTAATAACCAGAAAATATAAGG - Intronic
1085828317 11:79872038-79872060 TCTAATATGCAGAATCTATAAGG + Intergenic
1086563267 11:88193618-88193640 TCTAATAACCAGAATCTATAAGG - Intergenic
1086986387 11:93254533-93254555 ACTAATAAACAGAATCTACACGG + Intergenic
1087440303 11:98175492-98175514 TCTAATGTCCAGAATCTATAAGG + Intergenic
1087460577 11:98440433-98440455 ATTAATAAGCAGAATATATAAGG - Intergenic
1087692987 11:101343516-101343538 ACTAATATTCAGAATCTATAAGG - Intergenic
1087699162 11:101415921-101415943 ACTTATGAGTGGGAACTATACGG + Intergenic
1087945269 11:104152166-104152188 ACTAAAGAATAAAAACTATAAGG + Intronic
1088216252 11:107513162-107513184 TCTAATATGCAGAATCTATAAGG + Intronic
1088387047 11:109270534-109270556 ACTAATATCCAGAATCTATAAGG - Intergenic
1088420972 11:109646498-109646520 ATAAATGAGAAGAAATTATAGGG + Intergenic
1089092512 11:115889767-115889789 ACAACTGAGCAGAAACAACATGG - Intergenic
1089100134 11:115956155-115956177 TCTAAAGAGCAGAAAATGTAGGG - Intergenic
1090145433 11:124316485-124316507 ATTAATAAGCAGAATATATAAGG - Intergenic
1090757972 11:129811467-129811489 ACTAATATGCAGAATCTACAAGG + Intergenic
1091244106 11:134077327-134077349 ACTAATATCCAGAATCTATAAGG - Intronic
1091336400 11:134771144-134771166 ACTAATATCCAGAATCTATAAGG + Intergenic
1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG + Intronic
1092482992 12:8877448-8877470 ACTAATATCCAGAATCTATAAGG + Intronic
1092950083 12:13494314-13494336 ATTAATGAGCAGAATATATAAGG - Intergenic
1093236530 12:16615266-16615288 ACAAGTAAGCAGAAGCTATAGGG + Intergenic
1093269582 12:17043225-17043247 ACAAATGAAAAGAAACTAAAAGG + Intergenic
1093320851 12:17712656-17712678 ATTAATAACCAGAAAATATAAGG - Intergenic
1093535993 12:20224071-20224093 ATTAATAACCAGAAAATATAAGG + Intergenic
1093674517 12:21921451-21921473 ATTAATGAGCAGAATATATAAGG - Intronic
1093902829 12:24655279-24655301 ACTAATAATCAGAATGTATAAGG - Intergenic
1094085891 12:26591195-26591217 ATTAATAACCAGAATCTATAAGG + Intronic
1094237094 12:28181155-28181177 TCTAATGTCCAGAATCTATAAGG + Intronic
1094440971 12:30476568-30476590 AATAATGACCAGAATATATAAGG + Intergenic
1094789681 12:33897602-33897624 ACTAATAACCAGAATCTAGAAGG + Intergenic
1096036907 12:48480339-48480361 ACTAATATCCAGAATCTATAAGG - Intergenic
1097531532 12:60807507-60807529 ACTAATATTCAGAATCTATAAGG - Intergenic
1097610114 12:61809140-61809162 ATAAATGAGCAGAAAGCATAGGG + Intronic
1097716155 12:62968755-62968777 ACTGATGAGCAGACACTCTCAGG + Intergenic
1098224348 12:68306509-68306531 ACTAATATCCAGAATCTATAAGG + Intronic
1098422309 12:70313170-70313192 ACAAATGACCAATAACTATATGG - Intronic
1098491602 12:71087520-71087542 ATTAATAACCAGAATCTATAAGG - Intronic
1098518992 12:71414116-71414138 ACTAATATCCAGAATCTATAAGG + Intronic
1098658990 12:73069111-73069133 ACTTTTGGGCAGAAACTATGAGG + Intergenic
1098694090 12:73529213-73529235 ACTAATATCCAGAATCTATAAGG - Intergenic
1099314912 12:81072231-81072253 ACTAATAACCAGAATCTATAAGG + Intronic
1099398101 12:82167072-82167094 ACTAATATCCAGAATCTATAAGG + Intergenic
1099537965 12:83868648-83868670 ACTAATGTGTAGAAGCTATAGGG + Intergenic
1100108987 12:91214020-91214042 ACTAATATTCAGAAACTACAAGG - Intergenic
1100132875 12:91518173-91518195 TCTAATGTCCAGAATCTATAAGG + Intergenic
1100483172 12:94999589-94999611 ACTAATATCCAGAAACTACAAGG + Intronic
1100924732 12:99532075-99532097 ACTAATATGCAGAATCTATAAGG - Intronic
1101151262 12:101884686-101884708 ACTACTGAGCAGAGATTATGGGG - Intronic
1101187674 12:102296557-102296579 ACTAATATCCAGAATCTATAAGG - Intergenic
1101888525 12:108690689-108690711 AATAATGAGCAGAAAGCATTAGG - Intronic
1102104337 12:110307725-110307747 ACTAATATCCAGAATCTATAAGG - Intronic
1105645525 13:22313767-22313789 TCTAATGTCCAGAACCTATAAGG - Intergenic
1106209495 13:27628288-27628310 AATATTGAGCACATACTATACGG + Intronic
1106381895 13:29247518-29247540 ACTAATAACCAGAATCTACAAGG + Intronic
1107230345 13:38102149-38102171 ACTAATGAAGAGAAAGTAGAAGG - Intergenic
1108563581 13:51671591-51671613 ACTAATATGCAGAATCTACAAGG - Intronic
1108619843 13:52171331-52171353 ACTTATTATCAGAAACTATTTGG + Intergenic
1108681941 13:52788020-52788042 ACTACTGAGCAGAGACAATGAGG + Intergenic
1108769027 13:53674441-53674463 ACAAAGTAGCAGAAATTATATGG + Intergenic
1109383953 13:61603070-61603092 ACTAATATCCAGAATCTATAAGG - Intergenic
1109858091 13:68159898-68159920 ACTAAAGGGCAGAAAGAATATGG + Intergenic
1110002827 13:70227792-70227814 TTTGATGGGCAGAAACTATATGG - Intergenic
1110157824 13:72340244-72340266 ACTAATAACCAGAATATATAAGG + Intergenic
1110336654 13:74340119-74340141 ACTAATATCCAGAATCTATAAGG - Intergenic
1110989600 13:82022704-82022726 AATACTGAGCAGAAAGTACAGGG - Intergenic
1111115452 13:83771166-83771188 ACAAATGACCAGCAACTATATGG + Intergenic
1111393740 13:87635041-87635063 TCTAATATGCAGAATCTATAAGG + Intergenic
1111780509 13:92717872-92717894 CTTAATAAGCAGAAAATATAAGG + Intronic
1111970754 13:94913253-94913275 TCTAATGTCCAGAATCTATAAGG + Intergenic
1112696574 13:101955658-101955680 AATACTGACCAGAAACTATGTGG + Intronic
1114052103 14:18929076-18929098 ACTAATAACCAGAATCTACAAGG - Intergenic
1114110456 14:19472848-19472870 ACTAATAACCAGAATCTACAAGG + Intergenic
1114132572 14:19809462-19809484 TCTAATATCCAGAAACTATAAGG + Intronic
1114147185 14:19991538-19991560 ACTAATATGTAGAATCTATAAGG + Intergenic
1114825032 14:26066851-26066873 ATTAATGAGCAAAAATTATAAGG - Intergenic
1114961344 14:27894121-27894143 ACTAATGTCCAGAATCTACAAGG - Intergenic
1116024859 14:39502632-39502654 ACTAGTGCCCAGAATCTATAAGG - Intergenic
1116031015 14:39571671-39571693 ATTAATAACCAGAAAATATAAGG - Intergenic
1116324816 14:43519314-43519336 ACTAATGTTCAGAATCTACAAGG + Intergenic
1116361722 14:44006757-44006779 ACTAATATCCAGAATCTATAGGG - Intergenic
1117105945 14:52397163-52397185 ACTAATATCCAGAATCTATAAGG - Intergenic
1117443804 14:55784020-55784042 TCTAATATCCAGAAACTATAAGG + Intergenic
1117917905 14:60697497-60697519 ACTAATATCCAGAATCTATAAGG - Intergenic
1118047342 14:61985252-61985274 ACAAATGAGGAGAGAATATAAGG + Intergenic
1118146801 14:63146090-63146112 ATTAATAATCAGAAAATATAAGG - Intergenic
1118422602 14:65623325-65623347 AGAAATTAGCAGAAAATATAAGG + Intronic
1118538565 14:66796702-66796724 ATTAATGACCAGAATATATAAGG - Intronic
1118965385 14:70578604-70578626 ACTAATATCCAGAATCTATAAGG + Intergenic
1119072419 14:71600232-71600254 ACATATGACCTGAAACTATAAGG - Intronic
1119489807 14:75021439-75021461 ACTAATATCCAGAATCTATAAGG + Intronic
1120373466 14:83668932-83668954 ACTAATATCCAGAATCTATAAGG + Intergenic
1121554676 14:94827419-94827441 ACTTATAGGCAGTAACTATAAGG + Intergenic
1123140768 14:106075562-106075584 ACTAATATCCAGAATCTATAGGG - Intergenic
1124080955 15:26495847-26495869 ATTAATGACCAGAATATATAAGG - Intergenic
1124858730 15:33416566-33416588 ACTAATATCCAGAATCTATAAGG - Intronic
1125247854 15:37661961-37661983 ACTAATATTCAGAATCTATAAGG - Intergenic
1125498713 15:40223079-40223101 ACAAATAAGCATAAAATATAAGG - Intergenic
1126674765 15:51151027-51151049 TCTAATGTCCAGAATCTATAAGG + Intergenic
1126718509 15:51549839-51549861 ACTAATATCCAGAATCTATAAGG - Intronic
1126736244 15:51734594-51734616 ACAGATGAGCAGAAACTCTCAGG - Intronic
1126997025 15:54455748-54455770 ACTAATATCCAGAATCTATAAGG - Intronic
1127014902 15:54673578-54673600 ACTAATGTCCAGAATCTACAAGG + Intergenic
1127740936 15:61904238-61904260 ATTAATAACCAGAAAATATAAGG + Intronic
1128917330 15:71575388-71575410 AGTGATGAGCAAAAACTAGAAGG + Intronic
1129495924 15:75980515-75980537 GCAAATCAGCAGAAAGTATAAGG + Intronic
1129534736 15:76303579-76303601 TCTAATAACCAGAATCTATAAGG + Intronic
1130139061 15:81208253-81208275 TCTAATATCCAGAAACTATAAGG - Intronic
1130290500 15:82595945-82595967 ACCAATTAACAGAAACTAGAGGG + Intronic
1130528794 15:84729781-84729803 ACTAATATCCAGAGACTATAAGG - Intergenic
1130804755 15:87308149-87308171 CCTAATGGGCATAAGCTATAAGG + Intergenic
1131574579 15:93573783-93573805 AATAATAAGAAGAAACTATTAGG + Intergenic
1131853971 15:96572485-96572507 ACTAATATCCAGAATCTATAAGG - Intergenic
1132412477 15:101593410-101593432 ACTAATATCCAGAATCTATAAGG - Intergenic
1133374848 16:5276294-5276316 ACTAATGTCCAGAATCTACAGGG + Intergenic
1135087849 16:19489115-19489137 AGGAATGAGCAGAAACTATAGGG - Intronic
1135487184 16:22876210-22876232 ACTAGTAACCAGAATCTATAAGG + Intronic
1136602586 16:31304344-31304366 ACTACTATCCAGAAACTATAAGG - Intronic
1136729576 16:32396568-32396590 ACTAATATCCAGAATCTATAAGG - Intergenic
1139332952 16:66207996-66208018 ACTCATGAGCCGAAACTTGAAGG - Intergenic
1139343007 16:66282729-66282751 TCTAATATGCAGAATCTATAAGG + Intergenic
1140408383 16:74725997-74726019 ACACATCAGCAGAAACTAAATGG - Intronic
1141037155 16:80637556-80637578 ACTAATAAGCAAATACTGTAAGG + Intronic
1202996820 16_KI270728v1_random:120725-120747 ACTAATATCCAGAATCTATAAGG + Intergenic
1203023507 16_KI270728v1_random:433067-433089 ACTAATATCCAGAATCTATAAGG + Intergenic
1142939257 17:3368113-3368135 ACTAATATCCAGAATCTATAAGG - Intergenic
1144243041 17:13332941-13332963 ACTAATATCCAGAATCTATAAGG - Intergenic
1146614110 17:34338122-34338144 TCTAATGTGCAGAATCTATAGGG - Intergenic
1146744679 17:35317346-35317368 ACTAATATGCAGAATCTACAAGG - Intergenic
1148040755 17:44704945-44704967 ACTAATATCCAGAATCTATAAGG - Intergenic
1149572911 17:57686335-57686357 ACAAATCAGCAAAAACTAGAAGG + Intergenic
1150046341 17:61916905-61916927 CCTAATGTGCAGAATCTATAAGG + Intronic
1150192053 17:63253320-63253342 ATTAATAAGCAGAATGTATAAGG - Intronic
1150669395 17:67177884-67177906 ACTAATGATAAGGAACCATAAGG + Intronic
1153108416 18:1555589-1555611 ACTAATATCCAGAATCTATAAGG - Intergenic
1153208867 18:2736518-2736540 TCTAATAACCAGAATCTATAAGG + Intronic
1153363766 18:4229899-4229921 ATTAATGACCAGAATATATAAGG + Intronic
1153397021 18:4634841-4634863 ATTAATGACCAGAATATATAAGG + Intergenic
1153485878 18:5597209-5597231 ACTAAGGAGCAAAAACCAAAAGG - Intronic
1153583861 18:6601681-6601703 TCTCAGGAGCAGAAACCATAAGG + Intergenic
1154051845 18:10967819-10967841 ACTAATAACCAGAATCTATAAGG - Intronic
1155676097 18:28430679-28430701 ACAAGTGAGCAGAAACCAAATGG + Intergenic
1155764922 18:29616673-29616695 ACTGATGAGCTGAAAATAAAAGG + Intergenic
1156018430 18:32572829-32572851 ACTAATAACCAGAATCTACAAGG + Intergenic
1156790187 18:40963182-40963204 ACTTTTGGGCAGAGACTATAAGG - Intergenic
1157003565 18:43555496-43555518 ACTTTTGAGCAGAAGCTATGGGG + Intergenic
1157065102 18:44340518-44340540 ACTAATTACCAGAATCTACAAGG - Intergenic
1157721427 18:49928003-49928025 ACTAATGTCCAGAATCTACAAGG + Intronic
1158093091 18:53738333-53738355 TCTAATATGCAGAATCTATAAGG - Intergenic
1158758400 18:60354050-60354072 ATTAATGAGCTAAAACTTTATGG - Intergenic
1159409368 18:68051577-68051599 ACTAATGTCCAGAATCTACAAGG + Intergenic
1159456683 18:68668328-68668350 TCTAATAACCAGAATCTATAGGG + Intergenic
1161760656 19:6168751-6168773 ACTAATATTCAGAATCTATAAGG - Intronic
925343467 2:3152544-3152566 ACCTAAGACCAGAAACTATAAGG + Intergenic
925741976 2:7013645-7013667 AGCAATGAGAAGAAACAATACGG - Intronic
927355732 2:22170946-22170968 ACTAATATTCAGAATCTATAAGG + Intergenic
927987631 2:27424189-27424211 ACTAAGTAGCTGGAACTATAGGG + Intergenic
928037304 2:27836759-27836781 TCTAATATGCAGAATCTATAAGG + Intronic
928188473 2:29137888-29137910 ACTAATATCCAGAATCTATAAGG - Intronic
928679357 2:33683602-33683624 ACTAATAACCAGAATATATAAGG - Intergenic
928845863 2:35671052-35671074 ATTAATAAGCAGAATATATAAGG - Intergenic
928988893 2:37209893-37209915 ACTAATGTCCAGAATCTATAAGG + Intronic
929109508 2:38394814-38394836 TCTAATAACCAGAATCTATAAGG + Intergenic
930153236 2:48079134-48079156 ACTAATAGTCAGAAACTATTAGG + Intergenic
930527141 2:52544266-52544288 ACTAATAACCAGAATATATAAGG - Intergenic
930658024 2:54026189-54026211 ACTAATGTCCAGAATCTACAAGG + Intronic
931259785 2:60607293-60607315 ACTAATGACCACAAACTAGGTGG + Intergenic
931863118 2:66378148-66378170 ACAAATGAGCAAAAACCACATGG - Intergenic
932226915 2:70048667-70048689 ACAAATTACCACAAACTATATGG + Intergenic
932321965 2:70828986-70829008 AGCAATGAGCAGAAGCTATGAGG - Intergenic
932542544 2:72671274-72671296 ACTAATAACCAGAACATATAAGG + Intronic
932653543 2:73586152-73586174 ACTAATATGCAGAATCTACAAGG - Intronic
932913244 2:75827592-75827614 TCTAATGTGCAGCATCTATAAGG + Intergenic
933076109 2:77928560-77928582 TCTAATGTCCAGAATCTATAAGG - Intergenic
933364650 2:81335234-81335256 ACTAAAAAGCAGAGACAATAAGG + Intergenic
933523302 2:83403131-83403153 ACTAATATCCAGAATCTATAAGG + Intergenic
933907117 2:86905882-86905904 ACTTATGTGCATAAACTATGGGG - Intergenic
933908363 2:86915544-86915566 ACTTATGTGCATAAACTATGGGG - Intronic
934024360 2:87987836-87987858 ACTTATGTGCATAAACTATGGGG + Intergenic
934185706 2:89672429-89672451 ACTAATATCCAGAATCTATAAGG - Intergenic
934185880 2:89674609-89674631 ACTAATATCCAGAATCTATAAGG - Intergenic
935477202 2:103537151-103537173 TCTAATGTCCAGAAACTACAAGG - Intergenic
935483706 2:103626104-103626126 TCTAATGTCCAGAATCTATAAGG + Intergenic
935816597 2:106852130-106852152 AAGAATGGGCAGAAACTAGAGGG - Intronic
936365001 2:111845531-111845553 ACTTATGTGCATAAACTATGGGG + Intronic
936898598 2:117458144-117458166 ACTAATAACCAGAATCTACAAGG - Intergenic
937508674 2:122568273-122568295 ACTAATATCCAGAATCTATAAGG + Intergenic
937745335 2:125405527-125405549 ATTAATAAGCAGAATGTATACGG - Intergenic
938177462 2:129147395-129147417 ATTAATGACCAGAATATATAAGG - Intergenic
938242112 2:129750983-129751005 ACTAATCTCCAGAATCTATAAGG + Intergenic
938549865 2:132370171-132370193 ATTAATGAGAAGAAAAGATAAGG + Intergenic
938689638 2:133775803-133775825 ACTAATGAACAGAAAAGTTACGG + Intergenic
938816781 2:134912820-134912842 ATTAATAACCAGAATCTATAAGG - Intergenic
939076915 2:137614141-137614163 TCTAATTATCCGAAACTATATGG + Intronic
939090484 2:137774724-137774746 ACTAATGTCCAGAACCTACAAGG - Intergenic
939133395 2:138265090-138265112 ACTAATAACCAGAATATATAAGG + Intergenic
940343040 2:152601235-152601257 ATAAAGGAGAAGAAACTATATGG - Intronic
940806145 2:158188852-158188874 ACTAATATCCAGAATCTATAAGG + Intronic
941050543 2:160728065-160728087 ACTAATACCCAGAATCTATAAGG + Intergenic
942159220 2:173164432-173164454 TCTAATGTCCAGAATCTATAAGG - Intronic
942200397 2:173565159-173565181 ACTAATATGCAGAATCTACAAGG + Intergenic
942394418 2:175532225-175532247 GCTAATACGCAGAATCTATAAGG + Intergenic
942536018 2:176965033-176965055 ACCAATGAACAGAAACTACAGGG + Intergenic
942838097 2:180325569-180325591 ATTAATGAGCAAGAACCATATGG + Intergenic
942978606 2:182050228-182050250 AAAACTGAGTAGAAACTATAGGG - Intronic
943057407 2:182999258-182999280 ACTAATATCCAGAATCTATACGG + Intronic
943391153 2:187269770-187269792 ACTAATATCCAGAATCTATAAGG - Intergenic
944102503 2:196043673-196043695 ACTAATACCCAGAATCTATAAGG + Intronic
944370612 2:198978620-198978642 ACTAATATCCAGAATCTATAAGG + Intergenic
944848120 2:203689365-203689387 TCTAATGCCCAGAATCTATAAGG + Intergenic
945286158 2:208084391-208084413 ACTAATATCCAGAATCTATAAGG + Intergenic
945378424 2:209108698-209108720 ATTAATAAGCAGAATATATAAGG + Intergenic
945973135 2:216249857-216249879 ACTAATAACCAGAATATATAAGG + Intergenic
945981212 2:216312759-216312781 ACTAATGTCCAGAACCTACAGGG - Intronic
946544485 2:220722799-220722821 ACTAATATGCAGAATCTACAAGG - Intergenic
946633623 2:221699681-221699703 ACTAATGAGGAGAATTTCTAGGG - Intergenic
946770546 2:223084439-223084461 GCTGATGAGCAGAAACCATGAGG - Intronic
946788893 2:223278522-223278544 ACCAATGACCAGAAAATACAAGG - Intergenic
946798281 2:223380224-223380246 ACTAAGGAACAACAACTATACGG + Intergenic
1169606653 20:7328408-7328430 TCTTTAGAGCAGAAACTATAGGG - Intergenic
1169840789 20:9934816-9934838 ACTAATATACAGAATCTATAAGG - Intergenic
1170008268 20:11692769-11692791 ACAAATTAGCAGAAACTAGGTGG + Intergenic
1170070898 20:12365836-12365858 ACTAATATCCAGAATCTATAAGG + Intergenic
1170350376 20:15434289-15434311 ACTAATACCCAGAATCTATAAGG + Intronic
1171725448 20:28616123-28616145 ACTTCTCAGCAGAAACAATATGG - Intergenic
1171752618 20:29066961-29066983 ACTTCTCAGCAGAAACAATATGG + Intergenic
1171938375 20:31298944-31298966 ATTAATAAGCAGAATATATAAGG + Intergenic
1172036155 20:32012090-32012112 AGGAATGAGAAGAAACTATCTGG - Intronic
1173344438 20:42185826-42185848 AGTAATAAGCAGAAAATAAATGG + Intronic
1173574363 20:44101532-44101554 TCTAATATCCAGAAACTATACGG + Intergenic
1174653585 20:52151311-52151333 GCTAATGAGCAGAAAATGAATGG - Exonic
1176741600 21:10608742-10608764 TCTAATATCCAGAAACTATAAGG - Intergenic
1176930104 21:14799626-14799648 ATTAATAACCAGAATCTATAAGG - Intergenic
1177036491 21:16049988-16050010 ACTAATGACCAGAACATATAAGG + Intergenic
1177334389 21:19704464-19704486 ACAAACGAACAGAAACTACAGGG - Intergenic
1177401357 21:20609725-20609747 ATTAATAAGCAGAATATATAAGG + Intergenic
1177548726 21:22593765-22593787 ACTAATATCCAGAATCTATAAGG + Intergenic
1177672871 21:24256230-24256252 ACTAATATGCAGAATCTACAAGG + Intergenic
1177933137 21:27310588-27310610 ACTAATAATCAGAATCTATGAGG - Intergenic
1178372702 21:32039517-32039539 TCTAATGTGCAGAATCTACAAGG - Intronic
1179400996 21:41083308-41083330 ACTAATATCCAGAATCTATAAGG - Intergenic
1180409402 22:12589028-12589050 ACTTCTCAGCAGAAACAATATGG + Intergenic
1180470575 22:15651449-15651471 ACTAATAACCAGAATCTACAAGG - Intergenic
1180542893 22:16468482-16468504 ACTAATATCCAGAATCTATAAGG + Intergenic
1180543070 22:16470668-16470690 ACTAATATCCAGAATCTATAAGG + Intergenic
1182970778 22:34574236-34574258 ACTAATATCCAGAATCTATAAGG + Intergenic
1183047894 22:35235261-35235283 TCTAATAACCAGAATCTATAAGG - Intergenic
1184481371 22:44749766-44749788 ACTAATATACAGAAACAATAAGG + Intronic
1184763599 22:46560105-46560127 ACTAATACGCAGAATCTACAAGG + Intergenic
1184908300 22:47507402-47507424 ACTAATGTCCAGAATCTACAGGG - Intergenic
949183108 3:1158412-1158434 ACTAATAACCAGAATATATAAGG - Intronic
949650534 3:6153754-6153776 CCTTATCTGCAGAAACTATAAGG + Intergenic
950910568 3:16585546-16585568 AATAAGGAGCAGCAACTATAAGG - Intergenic
951260255 3:20499136-20499158 ACTAATATGCAGAATCTATAAGG - Intergenic
951268079 3:20593130-20593152 ACTAATATCCAGAATCTATAAGG - Intergenic
951958371 3:28284624-28284646 ACAAATGAGCAAAATCTATATGG - Intronic
951965155 3:28373877-28373899 ATTAATAACCAGAATCTATAGGG - Intronic
952024364 3:29060871-29060893 ACTAATATACAGAATCTATAAGG + Intergenic
952224026 3:31355740-31355762 ACTAATAACCAGAATATATAGGG + Intergenic
953087756 3:39688491-39688513 ATTAATGACCAGAATATATAAGG + Intergenic
954478346 3:50771209-50771231 ATTAATGACCAGAATATATAAGG + Intronic
954483193 3:50821024-50821046 ACTAATATCCAGAATCTATAAGG - Intronic
956317907 3:67959952-67959974 ACTAATAACCAGAATATATAAGG + Intergenic
956497906 3:69848864-69848886 ATTAATGAGAATAAATTATATGG + Intronic
957067275 3:75535286-75535308 ACTAATGTTCAGAATCTACAGGG - Intergenic
957400123 3:79700749-79700771 TCTAATGTCCAGAATCTATAAGG - Intronic
957645661 3:82921466-82921488 ACTAATCAGCAGAATATACAAGG - Intergenic
958066796 3:88554047-88554069 ACTAATGTTCAGAATCTATAAGG + Intergenic
958594800 3:96208955-96208977 ACCAAGGAACAGAAATTATAGGG - Intergenic
959252302 3:103964429-103964451 ACTAATGAACAGAATATACAAGG + Intergenic
959532335 3:107447802-107447824 ACAAATGACCACAAACTATGTGG - Intergenic
960221369 3:115113172-115113194 ACTAATAACCAGAATATATAAGG - Intronic
960578516 3:119251904-119251926 ACTAATATCCAGAATCTATAAGG + Intergenic
960617641 3:119610690-119610712 ACTAATATCCAGAATCTATAAGG - Intronic
960757285 3:121029793-121029815 ACTAATATGCAGAATCTACAAGG + Intronic
961265509 3:125638758-125638780 ACTAATATCCAGAATCTATAAGG + Intergenic
961285874 3:125802680-125802702 ACTAATGTCCAGAATCTACAGGG + Intergenic
961900865 3:130210222-130210244 ACTAATGTCCAGAATCTACAGGG - Intergenic
962472685 3:135726581-135726603 TCTAATGTCCAGAATCTATAAGG - Intergenic
962906398 3:139807185-139807207 ACTAACATGCAGAAAGTATAAGG + Intergenic
963279815 3:143372720-143372742 ACTAGTGTCCAGAATCTATAAGG + Intronic
963387350 3:144614289-144614311 TCTAATCTGCAGAATCTATAAGG - Intergenic
963406490 3:144870184-144870206 GCAAATGAGCCGAAACTATGGGG + Intergenic
964043121 3:152287964-152287986 CATATTGAACAGAAACTATAAGG - Intronic
964762565 3:160148260-160148282 ACTAATATCCAGAACCTATAAGG - Intergenic
965121517 3:164564452-164564474 ACAAATTAGCTGAAACTTTAGGG + Intergenic
965152805 3:165004059-165004081 ATTAATGACCAGAATATATAAGG + Intronic
965201277 3:165660887-165660909 TCTAATAATCAGAACCTATAAGG - Intergenic
965416696 3:168403775-168403797 ACTAAAGATCAGAAAGTATAAGG + Intergenic
966369390 3:179231990-179232012 ACTAATATCCAGAATCTATAAGG - Intronic
967618833 3:191606888-191606910 GCTAATAACCAGAACCTATAAGG + Intergenic
967738368 3:192978464-192978486 ATTAATAACCAGAAAATATAAGG + Intergenic
967790485 3:193543393-193543415 TCTAATATCCAGAAACTATAAGG + Intronic
969011866 4:4071848-4071870 ACTAATGTCCAGAATCTACAGGG - Intergenic
969164240 4:5292519-5292541 ACTAATATTCAGAATCTATAAGG - Intronic
969742219 4:9037872-9037894 ACTAATGTCCAGAATCTACAGGG + Intergenic
969801601 4:9570751-9570773 ACTAATGTCCAGAATCTACAGGG + Intergenic
971276326 4:25201018-25201040 ACTAATATCCAGAATCTATAAGG + Intronic
971573617 4:28245964-28245986 ACTGATGATCAAAAACTACAGGG - Intergenic
972074040 4:35061102-35061124 TCTAATATCCAGAAACTATAAGG - Intergenic
972952985 4:44352089-44352111 AGAAATGAGCAGAAGCTTTAGGG - Intronic
973668653 4:53190991-53191013 ACCAATAACCAGAAAGTATAAGG + Intronic
974031940 4:56784213-56784235 CCTCAGGAGCAGAAACCATAAGG - Intergenic
974470068 4:62308032-62308054 ATTAATGATCAGAATATATAAGG + Intergenic
974580445 4:63793142-63793164 ACTAATGAGCAGAAACATTTTGG - Intergenic
974801434 4:66823914-66823936 ACTAATATCCAGAATCTATAAGG - Intergenic
974874461 4:67686173-67686195 ACTAGTGGGTAAAAACTATAGGG - Intronic
974889782 4:67867590-67867612 ACTAATGTCTAGAATCTATAAGG + Intronic
975036547 4:69691244-69691266 ATTGATAAGCAGAATCTATAAGG - Intergenic
975099801 4:70499942-70499964 ACTAATGTACAGAATCTACAAGG + Intergenic
975708073 4:77130339-77130361 ACTAATAACCAGAATGTATAAGG - Intergenic
975901544 4:79159199-79159221 ACTAATATGCAGAATCTACAAGG + Intergenic
976346069 4:84003140-84003162 ACAAAAGAGCAGAATATATATGG + Intergenic
976701372 4:87972349-87972371 ATTCATAAGCAAAAACTATAAGG + Intergenic
977329375 4:95618313-95618335 TCTAATACCCAGAAACTATAAGG + Intergenic
977509639 4:97946274-97946296 ACTAATATGCAGAATCTACAAGG - Intronic
977655285 4:99514366-99514388 ACTAATATCCAGAATCTATAAGG + Intronic
977873158 4:102117728-102117750 ATTAATGAGCAGAATATAGAAGG - Intergenic
977948393 4:102940741-102940763 ACTAATATCCAGAATCTATAAGG + Intronic
977948577 4:102942939-102942961 ACTAATATCCAGAATCTATAAGG + Intronic
978087491 4:104671499-104671521 ACTAATGTCCAGAATCTACAAGG - Intergenic
978204630 4:106066426-106066448 ACTACTGATCAGAAAGTGTAGGG + Intronic
978315864 4:107436420-107436442 ACTAATATCCAGAATCTATAAGG + Intergenic
979012768 4:115392434-115392456 GCTAATGTGCAGAATCTACAAGG + Intergenic
979428484 4:120597490-120597512 GCTCTTGCGCAGAAACTATAGGG - Intergenic
979976675 4:127205440-127205462 AGTAATGAACTGACACTATAAGG + Intergenic
980255686 4:130378066-130378088 TCTAATGTACAGAATCTATAAGG - Intergenic
980460188 4:133100063-133100085 TCTAATAACCAGAATCTATAAGG - Intergenic
981402312 4:144327727-144327749 TCTAATATCCAGAAACTATAAGG + Intergenic
981466563 4:145079146-145079168 TCTAATATCCAGAAACTATAAGG + Intronic
981738606 4:147978937-147978959 ACTAATTTCCAGAATCTATAAGG - Intronic
981926308 4:150143920-150143942 ACTAATATCCAGAATCTATAAGG - Intronic
982368362 4:154605671-154605693 CATAATGAGAAGAAACTCTAAGG - Intronic
982669981 4:158308775-158308797 CCTAATATCCAGAAACTATAGGG - Intergenic
982950990 4:161695838-161695860 ACTAATATTCAGAATCTATAAGG - Intronic
982963551 4:161872797-161872819 ACTGAGGAACAAAAACTATAAGG + Intronic
983018792 4:162648466-162648488 ACTAATATCCAGAATCTATAAGG - Intergenic
983571661 4:169215210-169215232 ACTAAAGAAGAAAAACTATATGG - Intronic
983842820 4:172478766-172478788 ACTAATATCCAGAACCTATAAGG + Intronic
983962605 4:173772851-173772873 ACTAATATCCAGAAACTACAAGG - Intergenic
984161210 4:176254665-176254687 TCTAATGTCCAGAATCTATAAGG + Intronic
984178951 4:176456741-176456763 ACTAATACCCAGAATCTATAAGG + Intergenic
984332102 4:178336835-178336857 ACTAATGTCCAGAATCTATAAGG + Intergenic
984338933 4:178428946-178428968 ATTAATAACCAGAAAATATAAGG + Intergenic
984851831 4:184161156-184161178 ACTGATGACCAGAATCTACAAGG + Intronic
984949436 4:184995950-184995972 TCTTAGGAGCAGAAACTAAATGG + Intergenic
985335834 4:188892891-188892913 ATTAATGACCAGAATATATAAGG - Intergenic
986487735 5:8256601-8256623 ACTAATAACCAGAATCTACAAGG - Intergenic
986620838 5:9672395-9672417 TCTAATGTCCAGAATCTATACGG + Intronic
986915760 5:12617891-12617913 ACTAATATGTAGAATCTATAAGG - Intergenic
987849333 5:23329133-23329155 CCTAATGCCCAGAATCTATAAGG + Intergenic
988362214 5:30251222-30251244 TCTAATGTCCAGAATCTATAAGG - Intergenic
988852165 5:35190880-35190902 GGTAATGAGCAAATACTATAAGG + Intronic
988934997 5:36072914-36072936 ACTAATATTCAGAAGCTATAAGG - Intergenic
989191513 5:38674086-38674108 ACTATTGAGAATAAACTATGAGG + Intergenic
990247707 5:53879620-53879642 ACTGGTGAGCAGGAACAATATGG + Intergenic
990553405 5:56907094-56907116 ATAAATGAATAGAAACTATATGG + Intergenic
991238216 5:64424143-64424165 TCTAATACGCAGAATCTATATGG + Intergenic
991415765 5:66391316-66391338 ACTAATATTCAGAATCTATAAGG + Intergenic
991418844 5:66419852-66419874 ACTAATGTCCAGAATCTACAAGG - Intergenic
992007372 5:72491090-72491112 AGAAATAAGGAGAAACTATATGG + Intronic
993185096 5:84607444-84607466 AAAAATGAGCAGAAAATACAAGG - Intergenic
993277194 5:85875557-85875579 AATAATGAGCAGAATTTGTAAGG + Intergenic
993433404 5:87860728-87860750 ACTAATATCCAGAATCTATAAGG - Intergenic
993931896 5:93951211-93951233 ACTAATAACCAGAATATATAAGG - Intronic
994021771 5:95034832-95034854 ACTAATATCCAGAATCTATAAGG + Intronic
994222517 5:97212207-97212229 TCTAATAACCAGAATCTATAAGG - Intergenic
994362481 5:98868467-98868489 ACTAATAATCAGAAAGTCTAAGG + Intronic
994559773 5:101352826-101352848 ACTAATATCCAGAAACTACAAGG + Intergenic
994823631 5:104684111-104684133 ACTAATAACCAGAATCTACAAGG + Intergenic
994993465 5:107028978-107029000 ACTATTGAGCAGAAACTCACAGG + Intergenic
995116783 5:108490002-108490024 ATTAATAAGCAGAATATATAGGG + Intergenic
995155776 5:108911347-108911369 ACTAATATCCAGAATCTATAGGG - Intronic
995212706 5:109558630-109558652 AAGAATGAGCAGAAGCTAAATGG - Intergenic
995279240 5:110314667-110314689 ACTAATAACCAGAATATATAAGG + Intronic
995352563 5:111197511-111197533 ACTAATAAACAGAAAGTATCAGG - Intergenic
995848022 5:116514889-116514911 AATAATGAGCAAAAGCTATGGGG - Intronic
996258665 5:121438408-121438430 ATTAATCAGCAGAATATATAAGG - Intergenic
996259007 5:121442502-121442524 ATTAATAACCAGAAAATATAAGG + Intergenic
997002523 5:129779021-129779043 ATTAATAAGCAGAATATATAAGG + Intergenic
997007124 5:129831197-129831219 ACAAATGACCACAAACTAAATGG - Intergenic
997898196 5:137738948-137738970 TCTAATATGCAGAATCTATAAGG + Intergenic
998047036 5:138996402-138996424 ATTAATAAACAGAAAATATAAGG - Intronic
999010008 5:148026043-148026065 ACTCATGAACAGAAGTTATATGG - Intronic
999350668 5:150867863-150867885 ACTAATGTCCAGAATCTACAAGG - Intronic
999518572 5:152325686-152325708 ACTAATATCCAGAAACTATACGG - Intergenic
1000271949 5:159694341-159694363 ACTAATATCCAGAATCTATAAGG + Intergenic
1000709711 5:164557063-164557085 ACTAATATTCAGAATCTATAAGG - Intergenic
1001166214 5:169371064-169371086 ACTAATATCCAGAATCTATAAGG + Intergenic
1002945321 6:1756022-1756044 GCTAATATGCAGAATCTATAAGG + Intronic
1003439876 6:6130428-6130450 ACTAATAACCAGAATATATAAGG - Intergenic
1004091040 6:12502009-12502031 TCTAATAACCAGAATCTATAAGG + Intergenic
1004440542 6:15647114-15647136 ACTAATATCCAGAATCTATAAGG + Intronic
1004671147 6:17798099-17798121 ACTAAAAAGCAGATACTATATGG - Intronic
1005691113 6:28306675-28306697 ACTAATGTCCAGAATCTACAAGG - Intergenic
1005769604 6:29053942-29053964 ACTAATATCCAGAATCTATAAGG + Intergenic
1007151357 6:39695419-39695441 ACTAATATCCAGAATCTATAAGG + Intronic
1007197180 6:40072549-40072571 ACTAATGTCCAGAATCTACAAGG - Intergenic
1008155706 6:48011451-48011473 ACTAATATCCAGAATCTATAAGG - Intronic
1008264933 6:49413320-49413342 TCTAATGTCCAGAATCTATAAGG - Intergenic
1008417760 6:51263065-51263087 ACAAATTTACAGAAACTATAAGG - Intergenic
1008906679 6:56685254-56685276 ACTAATACCCAGAATCTATAAGG + Intronic
1009448178 6:63768336-63768358 TCTAATGTCCAGAATCTATAAGG + Intronic
1009540881 6:64956695-64956717 ACTAATAACCAGAATATATAAGG + Intronic
1009543398 6:64995019-64995041 TCTAATTAGCATAAACTATTTGG - Intronic
1009668874 6:66719350-66719372 ATTACTCAGCAGAAACTGTAAGG - Intergenic
1009781587 6:68278551-68278573 CCTAATATCCAGAAACTATAAGG - Intergenic
1009861252 6:69335920-69335942 TTTATTGAGCACAAACTATATGG - Intronic
1010015124 6:71096137-71096159 ACTAATGTCCAGAATCTACAAGG - Intergenic
1010840664 6:80646233-80646255 ACTAATATGCAGAATCTACAAGG + Intergenic
1011092833 6:83625755-83625777 ACTAATGTCCAGAATCTATAAGG - Intronic
1011106996 6:83793192-83793214 ACTAATATCCAGAATCTATAGGG + Intergenic
1011322375 6:86110190-86110212 ATTAATAAGCAGAATTTATAAGG - Intergenic
1012169994 6:96004743-96004765 ACTAATATCCAGAATCTATAAGG + Intergenic
1012365662 6:98436663-98436685 ACTAATGACCAGAATATATAAGG + Intergenic
1012502766 6:99907777-99907799 ATTAATGATCAGAATATATAAGG + Intergenic
1013742944 6:113309920-113309942 ACTAAGGCCCAGAAACTTTAGGG + Intergenic
1013799726 6:113929020-113929042 AATAATAAGCAGAATGTATAAGG - Intergenic
1014088506 6:117374734-117374756 ACTAATATCCAGAAACTACAAGG + Intronic
1014306543 6:119749682-119749704 ACTAATATCCAGAATCTATAAGG - Intergenic
1014374073 6:120650319-120650341 CCTAATAACCAGAATCTATAGGG + Intergenic
1014902331 6:126983135-126983157 ACTAATATTCAGAATCTATAAGG + Intergenic
1015004855 6:128267075-128267097 ACAAATAAGCAGAAACAAAAAGG + Intronic
1015048532 6:128810146-128810168 ACTAATATCCAGAATCTATAAGG - Intergenic
1015175432 6:130302209-130302231 ACTAATATCCAGAATCTATATGG + Intronic
1015538860 6:134294899-134294921 AATGATGAGCATAAACGATATGG + Intronic
1016103344 6:140130197-140130219 ACTTATGAGCAAAAACCTTAAGG + Intergenic
1016251969 6:142054248-142054270 ACTAATGACCAAAATATATAAGG + Intergenic
1016253356 6:142073008-142073030 ACTAATATGCAGAATCTATAAGG + Intronic
1017255861 6:152332490-152332512 TCAACTGAGCAGAATCTATATGG + Intronic
1017272372 6:152522932-152522954 ACTAATGTTCAGAATCTACAAGG - Intronic
1017357876 6:153531215-153531237 TCTAATATGCAGAACCTATAAGG - Intergenic
1017812414 6:157993413-157993435 ACTAATAACCAGAATATATAAGG - Intronic
1019622200 7:1998050-1998072 AATAAGGAACAGAAATTATATGG + Intronic
1020423633 7:8038872-8038894 ACTAATGCACAGAATCTACAAGG + Intronic
1020490257 7:8773789-8773811 CCTAATGTCCAGAATCTATATGG - Intergenic
1020772848 7:12417148-12417170 ATTAATAACCAGAAAATATAAGG - Intergenic
1020998421 7:15295310-15295332 TTTATTGAGCACAAACTATAAGG + Intronic
1021003994 7:15370768-15370790 ACTAATATGCAAAATCTATAAGG - Intronic
1021016202 7:15538029-15538051 AGTAATGATAAGAAACTAAAAGG + Intronic
1022740605 7:33116909-33116931 ATTAATAAGCAGAATATATAAGG - Intergenic
1023716622 7:43051298-43051320 ATTAATGAACAGAATATATAAGG + Intergenic
1023777652 7:43623477-43623499 ACTAAGCATTAGAAACTATAAGG - Intronic
1024498850 7:50078823-50078845 TCTAATAACCAGAATCTATAAGG + Intronic
1026133485 7:67639501-67639523 ACTAATGTCCAGAATCTATAAGG + Intergenic
1026663039 7:72318940-72318962 ACAAATGAGCACAACCTCTATGG + Intronic
1027527269 7:79286015-79286037 TCAATTAAGCAGAAACTATAAGG + Intronic
1027538404 7:79436464-79436486 ACTAATATCCAGAACCTATAAGG + Intronic
1028172228 7:87612140-87612162 ACTAATATCCAGAATCTATAAGG - Intronic
1028176206 7:87662130-87662152 ATTAATAAGCAGAATATATAAGG - Intronic
1028255814 7:88596500-88596522 GCTAATATGCAGAATCTATAGGG + Intergenic
1028329352 7:89569711-89569733 TCTAATAACCAGAATCTATAAGG + Intergenic
1028777224 7:94691842-94691864 ACTAATGCCCAGAAAATACACGG - Intergenic
1030727971 7:112948657-112948679 ACTAATATCCAGAATCTATAAGG - Intergenic
1030896852 7:115071288-115071310 ACTAATGAACAGAATATATAAGG + Intergenic
1031175237 7:118340616-118340638 ACTAATAACCAGAATATATAAGG - Intergenic
1031705343 7:124974428-124974450 ACATATGAGCAGAATCCATAAGG + Intergenic
1032895377 7:136245013-136245035 TCTAATAACCAGAATCTATAAGG + Intergenic
1033396662 7:140980594-140980616 ACTAATGTCTAGAATCTATAAGG - Intergenic
1033797713 7:144867496-144867518 ACTAATATCCAGAATCTATAAGG - Intergenic
1033970716 7:147035236-147035258 ACTAATGAGCAGAGACTCCAGGG + Intronic
1034389527 7:150774255-150774277 TCTAATAACCAGAACCTATAAGG + Intergenic
1034406465 7:150906297-150906319 CCTAAAAAGCACAAACTATAAGG + Intergenic
1034708113 7:153164967-153164989 ACTAATAGCCAGAATCTATAAGG - Intergenic
1035121803 7:156574843-156574865 ACTAATATCCAGAATCTATAAGG + Intergenic
1035142192 7:156773978-156774000 TCTAATGTCCAGAATCTATAAGG + Intronic
1035819786 8:2579028-2579050 ACTCATGAGCAGAAGCTGAATGG - Intergenic
1036247420 8:7130424-7130446 ACTAATGTCCAGAATCTACAGGG + Intergenic
1036253380 8:7183939-7183961 GCTAATGTGCAGAATCTACAGGG - Intergenic
1036858419 8:12321113-12321135 TCTAATATGCAGAATCTATAAGG - Intergenic
1036894440 8:12621655-12621677 ACTAATGTCCAGAATCTACAGGG - Intergenic
1036954690 8:13174740-13174762 TCTAATATGCAGAATCTATAAGG - Intronic
1037154198 8:15679476-15679498 ACTAATATCCAGAATCTATAAGG - Intronic
1038872165 8:31506587-31506609 TCTAATGTCCAGAATCTATAAGG - Intergenic
1039015489 8:33144155-33144177 TCTAATATGCAGAATCTATAAGG + Intergenic
1039643735 8:39255605-39255627 ACTAATATCCAGAATCTATAAGG - Intronic
1039763460 8:40602789-40602811 ACTAATGTCCAGAATCTACAAGG - Intronic
1039933725 8:42020232-42020254 AGTAATCAGCAGAGACTGTATGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040930661 8:52731889-52731911 ACTAATACCCAGAATCTATAAGG + Intronic
1041665070 8:60435928-60435950 TCTAATATCCAGAAACTATAAGG + Intergenic
1041745048 8:61199369-61199391 ACTAATATCCAGAATCTATAAGG + Intronic
1042313779 8:67404369-67404391 ACTAATAACCAGAATCTACAAGG - Intergenic
1042888192 8:73575866-73575888 ACTAATGAGGACAAAAAATACGG + Intronic
1043296851 8:78674912-78674934 AATATTCAGCAGAAACTATGGGG + Intronic
1043721618 8:83551871-83551893 ACTAATATCCAGAAGCTATAGGG + Intergenic
1044596454 8:93963589-93963611 ACTAATATGCAGAATCTAAAAGG - Intergenic
1045613548 8:103877428-103877450 ACTAATAACCAGAATCTACAAGG - Intronic
1045731950 8:105252473-105252495 ACTAATAACCAGAATGTATAAGG - Intronic
1046143441 8:110124798-110124820 ACTAATAACCAGAATTTATAAGG - Intergenic
1046318586 8:112540011-112540033 ACTAATAACCAGAATATATAAGG + Intronic
1046557558 8:115793647-115793669 ACTAATAACCAGAATATATAAGG + Intronic
1047341723 8:123987401-123987423 ATTAATAACCAGAAGCTATAAGG - Intronic
1047936373 8:129784354-129784376 AATAATAACCAGAAAATATAAGG + Intronic
1047981684 8:130190024-130190046 ACTAATAACCAGAATATATAAGG - Intronic
1048174462 8:132139670-132139692 ACTAATTAAAACAAACTATATGG + Intronic
1048515514 8:135106025-135106047 ATTAATAAGCAGAATATATAAGG - Intergenic
1048984211 8:139724494-139724516 CCTAATGAAAAGAAATTATAAGG - Intergenic
1049868240 8:144953382-144953404 ACTAATATGCAGAATCTACAAGG - Intergenic
1051454585 9:17240637-17240659 ACTAATAACCAGAATATATAAGG - Intronic
1051498483 9:17751379-17751401 ATTAATGAGTAGAAACCATGGGG + Intronic
1051549209 9:18310470-18310492 ACTAATATCCAGAATCTATAAGG + Intergenic
1051600950 9:18873178-18873200 ACTAATATCCAGAATCTATAAGG - Intronic
1051832076 9:21290840-21290862 AGTAATGGCCAGAATCTATAAGG + Intergenic
1052529681 9:29665775-29665797 ACTAATATCCAGAATCTATAAGG + Intergenic
1052651103 9:31302376-31302398 TCTAATATCCAGAAACTATAAGG + Intergenic
1052694516 9:31859110-31859132 TCTAATGTCCAGAATCTATAAGG + Intergenic
1052871360 9:33510800-33510822 ACTTATGATCAGAAACTACTTGG + Intergenic
1055740660 9:79384871-79384893 ACTAATATCCAGAATCTATAAGG - Intergenic
1056113372 9:83418387-83418409 ACTAGTGTCCAGAATCTATAAGG + Intronic
1056230872 9:84541742-84541764 ACTAATATCCAGAATCTATAAGG - Intergenic
1056312531 9:85354741-85354763 ACTAATATCCAGAATCTATAAGG - Intergenic
1056815975 9:89801186-89801208 CCTGATGAGTAGCAACTATATGG - Intergenic
1056877859 9:90352480-90352502 TCTAATATTCAGAAACTATAAGG + Intergenic
1056959442 9:91109644-91109666 TCTAATAACCAGAATCTATAAGG + Intergenic
1057687245 9:97245989-97246011 ACTTATTATCAGAAACTATTTGG - Intergenic
1058303299 9:103404635-103404657 ACTAATGATCAGAGAATGTATGG + Intergenic
1058587365 9:106524578-106524600 ACTAATAACCAGAATCTACAAGG + Intergenic
1059151563 9:111954018-111954040 ATGAGTGAGCAGACACTATAGGG + Intergenic
1059920272 9:119152520-119152542 ACTTATTAGCAGAAGCTATCTGG + Intergenic
1060319914 9:122548847-122548869 ACTAATGTTCAGAATCTACAAGG - Intergenic
1060525601 9:124319332-124319354 ACTAATGTCCAGAATCTATAAGG - Intronic
1060707517 9:125818246-125818268 ACTTATGAGCAGGAACTCTCTGG - Intronic
1060935366 9:127511678-127511700 ATTAATAATCAGAAAATATAAGG + Intronic
1061356094 9:130106200-130106222 ACTAATGAGCAGATTCCAAATGG + Intronic
1061525207 9:131155369-131155391 ACTAATATCCAGAATCTATAAGG - Intronic
1203450972 Un_GL000219v1:116021-116043 ACTTCTCAGCAGAAACAATATGG - Intergenic
1186194976 X:7100799-7100821 AATATTGAGCAGAAACCCTAAGG + Intronic
1186523902 X:10230137-10230159 ATTAATAAGCAGAATATATAAGG - Intronic
1186899274 X:14036188-14036210 ATTAATCAGCAGAATATATAAGG + Intergenic
1187108812 X:16274135-16274157 ACTAATATTCAGAATCTATAAGG - Intergenic
1187637281 X:21243684-21243706 ACTAATATCCAGAATCTATAAGG - Intergenic
1187804102 X:23099312-23099334 TCTAATATGCAGAATCTATAAGG + Intergenic
1187991900 X:24883225-24883247 TCTAATGTCCAGAATCTATAAGG - Intronic
1188122253 X:26322077-26322099 AAGAATCACCAGAAACTATAAGG + Intergenic
1188298076 X:28474338-28474360 ACTAATATCCAGAACCTATAAGG + Intergenic
1188862907 X:35278514-35278536 ATCAAAGAGCAGAAAATATATGG - Intergenic
1188865461 X:35307930-35307952 ACTAATAACCAGAACATATAGGG + Intergenic
1188932516 X:36130183-36130205 ATTAATGACCAGAATATATAAGG + Intronic
1188942971 X:36263090-36263112 ATTAATGACCAGAATATATAAGG - Intronic
1189596261 X:42569004-42569026 TCTAATGTCCAGAATCTATAAGG - Intergenic
1189769039 X:44404128-44404150 ACTGATGACCAGAATATATAAGG - Intergenic
1189878142 X:45458342-45458364 ACTAATATCCAGAATCTATAAGG - Intergenic
1190554604 X:51620779-51620801 ACTAATATCCAGAATCTATAAGG - Intergenic
1191083895 X:56544363-56544385 ATTAATAAGCAGAATATATAAGG + Intergenic
1191199317 X:57762346-57762368 ACTTTTGAGTAGAAACTACATGG - Intergenic
1191646322 X:63485370-63485392 TCTAATATGCAGAATCTATAAGG + Intergenic
1191732604 X:64353355-64353377 ATTAATAACCAGAAAATATAAGG + Intronic
1191801358 X:65084368-65084390 ATTAATAAGCAGAATATATAAGG + Intergenic
1191947315 X:66549595-66549617 ACTAATATCCAGAATCTATAAGG + Intergenic
1191965678 X:66754840-66754862 ACTAATAACCAGAATCTACAAGG - Intergenic
1192726277 X:73756328-73756350 ACTAATGTGCAGAATCTACAAGG - Intergenic
1192838325 X:74826394-74826416 TCTAATGTCCAGAATCTATAAGG - Intronic
1192957071 X:76083210-76083232 ACTAATAAGCAGAATATATAAGG - Intergenic
1192967334 X:76192802-76192824 ATTAATAAGCAGAATATATAGGG - Intergenic
1193020741 X:76790372-76790394 ACTAATAACCAGAAAATACAAGG + Intergenic
1193090431 X:77488311-77488333 TCTAATGTCCAGAATCTATAAGG + Intergenic
1193203547 X:78720941-78720963 ACTAATATCCAGAATCTATAAGG + Intergenic
1193321398 X:80126132-80126154 ACTAATATTCAGAATCTATAAGG - Intergenic
1193428819 X:81374671-81374693 TCTAATATCCAGAAACTATAAGG - Intergenic
1193611259 X:83634002-83634024 TCTAATATGCAGAATCTATAAGG - Intergenic
1193617225 X:83704212-83704234 ACTAATATCCAGAATCTATAAGG - Intergenic
1193665852 X:84315600-84315622 ATTAATCACCAGAAAATATAAGG + Intergenic
1193761291 X:85469602-85469624 ATTAATAAGCAGAATATATAAGG - Intergenic
1193899355 X:87157955-87157977 ACTAATAACCAGAATATATAAGG - Intergenic
1193908403 X:87270951-87270973 ACTAATAATCAGAATATATAAGG + Intergenic
1193996929 X:88376695-88376717 ACGAATGAGAAGAAACACTAGGG - Intergenic
1193997915 X:88389734-88389756 ACTAATATGCAGAATCTATAAGG + Intergenic
1194032477 X:88833721-88833743 ACTAATATCCAGAATCTATAAGG + Intergenic
1194319277 X:92423368-92423390 ACTAATGTCCAGAATCTACAAGG - Intronic
1194787469 X:98105254-98105276 ATTAATAACCAGAAAATATAAGG - Intergenic
1194880394 X:99243673-99243695 ACTAATATCCAGAATCTATAGGG - Intergenic
1195125460 X:101804849-101804871 AATAATGAGCAGACACTTTATGG + Intergenic
1196232047 X:113235031-113235053 ATTAATAAGCAGAATATATAAGG - Intergenic
1196305113 X:114092973-114092995 ACTAATAACCAGAATATATAAGG + Intergenic
1196357174 X:114808845-114808867 ATTAATAAGCAGAATGTATAAGG - Intronic
1196361587 X:114867385-114867407 ATTAATAAGCAGAATATATAAGG - Intronic
1196590013 X:117476139-117476161 ATTAATGACCAGAATATATAAGG - Intergenic
1196935045 X:120721485-120721507 ACTAATGCTCAGAATCTACAAGG - Intergenic
1196979896 X:121200819-121200841 ACTAATGTCCAGAATCTACAAGG - Intergenic
1197126292 X:122950038-122950060 ATTAATGACCAGAATATATAAGG - Intergenic
1197368616 X:125598903-125598925 ACTAATACCCAGAATCTATAAGG - Intergenic
1197466419 X:126809102-126809124 ATTAATAAGCAGAATATATAAGG - Intergenic
1197519627 X:127481343-127481365 ACTAATAACCAGAATATATAAGG - Intergenic
1197545713 X:127821491-127821513 ACTAATACCCAGAAACTACAAGG + Intergenic
1197646015 X:129017416-129017438 ACTAATATGCAGAATCTACAAGG - Intergenic
1197993665 X:132347875-132347897 TCTAATATGCAGAATCTATAAGG + Intergenic
1198580081 X:138053916-138053938 TCTAGTGTGCAGAATCTATAAGG + Intergenic
1198739294 X:139823923-139823945 ACTAATATCCAGAATCTATAAGG + Intronic
1198780829 X:140233739-140233761 ATTAATAACCAGAAAATATAAGG - Intergenic
1199040304 X:143107214-143107236 ATTAATCACCAGAATCTATAAGG + Intergenic
1199043723 X:143144433-143144455 ACTAATAACCAGAATATATAAGG + Intergenic
1199111266 X:143937549-143937571 ATTAATAACCAGAAAATATAAGG + Intergenic
1199162625 X:144631763-144631785 GCTGATAAGCAGAAATTATAAGG + Intergenic
1199195365 X:145023101-145023123 ACTAATAACCAGAATATATAAGG + Intergenic
1199218206 X:145285557-145285579 AATAATTTTCAGAAACTATAGGG + Intergenic
1199261205 X:145777885-145777907 TCTAATAAGCAGAAACTTTAGGG + Intergenic
1199378482 X:147140201-147140223 ATTAATAAGCAGAATATATAAGG - Intergenic
1199425451 X:147695783-147695805 ACTAATATTCAGAACCTATAAGG + Intergenic
1199466128 X:148139566-148139588 ACTAATGTCCAGAATCTACAAGG - Intergenic
1200013068 X:153134823-153134845 ACTAATATGCAGAATCTACAAGG - Intergenic
1200026533 X:153265100-153265122 ACTAATATGCAGAATCTACAAGG + Intergenic
1200287186 X:154834562-154834584 ACTAACCTACAGAAACTATAAGG - Intronic
1200627408 Y:5536443-5536465 ACTAATGTCCAGAATCTACAAGG - Intronic
1201183785 Y:11377418-11377440 ACTAATATCCAGAATCTATAAGG + Intergenic
1201567085 Y:15376460-15376482 AATATTGAGCAGAAACCCTAAGG + Intergenic