ID: 1092252400

View in Genome Browser
Species Human (GRCh38)
Location 12:6907212-6907234
Sequence CATCCTACCATTCGCAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092252400_1092252406 21 Left 1092252400 12:6907212-6907234 CCTGCTTTGCGAATGGTAGGATG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1092252406 12:6907256-6907278 AGGCTCTAATGCTGAGCATTTGG 0: 1
1: 0
2: 0
3: 12
4: 103
1092252400_1092252407 26 Left 1092252400 12:6907212-6907234 CCTGCTTTGCGAATGGTAGGATG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1092252407 12:6907261-6907283 CTAATGCTGAGCATTTGGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 136
1092252400_1092252402 1 Left 1092252400 12:6907212-6907234 CCTGCTTTGCGAATGGTAGGATG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1092252402 12:6907236-6907258 TTTAGAGGCTCCCCAAATTCAGG 0: 1
1: 0
2: 0
3: 14
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092252400 Original CRISPR CATCCTACCATTCGCAAAGC AGG (reversed) Intronic
900709177 1:4101730-4101752 CCTCCCATCATTTGCAAAGCTGG - Intergenic
912448757 1:109757249-109757271 CATCCTACCATTGCAAAAGTGGG - Intronic
912667806 1:111598852-111598874 CTTCCTACCAGTCGCAAGTCTGG + Intronic
916025565 1:160830615-160830637 CATCATACCATGGACAAAGCTGG + Intronic
922603421 1:226873911-226873933 TATCCTACCAGTCCCACAGCAGG + Intronic
1064846173 10:19656708-19656730 CATCATACCACTCATAAAGCAGG - Intronic
1071911528 10:90240030-90240052 CATCCTACCATGTGTAAAGTAGG - Intergenic
1072590888 10:96827606-96827628 CATCCTACCAGTCAGAAAGGAGG - Intergenic
1073973606 10:109074117-109074139 CATCCTTCCTTGCACAAAGCTGG - Intergenic
1074929628 10:118111156-118111178 CAGCCTGCCATTAGCAGAGCTGG - Intergenic
1076693291 10:132234638-132234660 CATCCCACCACTCCCCAAGCAGG - Intronic
1078257577 11:9673170-9673192 CTTCCTACCAGTTGCAAATCTGG + Intronic
1092252400 12:6907212-6907234 CATCCTACCATTCGCAAAGCAGG - Intronic
1103899090 12:124294336-124294358 CATCCTTCCATTCTGCAAGCGGG - Intronic
1105436623 13:20384455-20384477 CATCCTACCATACACAAAACTGG - Intergenic
1107816688 13:44250793-44250815 AATCCCGCCATTCCCAAAGCTGG - Intergenic
1110403660 13:75123360-75123382 TATCCTGACATTAGCAAAGCAGG - Intergenic
1111797091 13:92935656-92935678 TATCCTACCATTAGACAAGCTGG - Intergenic
1117207753 14:53461955-53461977 CATCCTCCCTTTAGGAAAGCAGG - Intergenic
1127599900 15:60524836-60524858 CAACCTACAATTGGCAAAGTAGG + Intronic
1137455939 16:48617958-48617980 CATCCTACAATTCACAAGACAGG - Intronic
1140124814 16:72110403-72110425 CATCCTCCCATCAGCAAAGGTGG - Intronic
1141437001 16:84005549-84005571 CAGCCTACCATGCTCAGAGCAGG + Intergenic
1156241783 18:35261924-35261946 GATACTACCATTAGCCAAGCAGG - Intronic
943176289 2:184478749-184478771 CATCCTACATTGCACAAAGCAGG + Intergenic
947004256 2:225492435-225492457 CATCTTTCCATTTGCAAAACAGG + Intronic
1174447735 20:50602021-50602043 CATCATGCCATCAGCAAAGCAGG + Intronic
1175638918 20:60610391-60610413 CAGCCTACCAGTCGGAAAGTGGG - Intergenic
1178924681 21:36764887-36764909 CAGCCTACCCTTTGCACAGCTGG - Intronic
1179570611 21:42276525-42276547 CATCCTACCATTGTTAAAGCAGG + Intronic
954191181 3:48962666-48962688 CATCCTACAATTCACAGATCAGG - Intronic
962493378 3:135915590-135915612 CATATTACCATGCTCAAAGCAGG - Intergenic
962572943 3:136729372-136729394 CATGGTACCATTCACAAAGAGGG - Intronic
968061299 3:195727949-195727971 CATCATAACATATGCAAAGCTGG - Intronic
969087565 4:4667773-4667795 CATATTAGCATTCGAAAAGCTGG - Intergenic
971256804 4:25022012-25022034 CATCCATCCATTAGCAAATCAGG + Intronic
975588987 4:75981364-75981386 GGTCCTACCATTCGCAGATCTGG + Exonic
976013312 4:80518754-80518776 CATACTCCCATTCGCCAGGCAGG - Intronic
976185123 4:82435690-82435712 CATCCTACACTTCTCAATGCTGG - Intronic
988620097 5:32814560-32814582 CATCATACCATTCCCAAGGAGGG + Intergenic
995755136 5:115495113-115495135 CCTCCTCCCATTGGCAAAGGAGG + Intergenic
999144624 5:149384031-149384053 CATCCAGCCCTTAGCAAAGCGGG + Intronic
1000297834 5:159927530-159927552 CTTCAGAGCATTCGCAAAGCTGG - Intronic
1003745254 6:8993907-8993929 CATCCTACAATTTGCAAAACAGG - Intergenic
1003751972 6:9069147-9069169 CATCCTAACATTTTCAAAGCCGG + Intergenic
1030092416 7:105869181-105869203 CATCCTTCCATCCCAAAAGCTGG + Intronic
1032128540 7:129211617-129211639 CTTCCTTCCATTCCCACAGCGGG + Exonic
1039979344 8:42393508-42393530 CATATTACCAGTAGCAAAGCTGG + Intronic
1050111075 9:2216842-2216864 CATCATACCATGCACAAAGAAGG + Intergenic
1188357983 X:29215971-29215993 CCTCCTTCCATCCGCAAAGTTGG + Intronic
1190435114 X:50416651-50416673 CATCCTACCAATGGCCAACCTGG - Intronic
1200215914 X:154368209-154368231 CATCCTACCACTGGCCAAGAGGG - Intronic
1201938219 Y:19430766-19430788 CATCCTACCATTTGAAAGGAAGG - Intergenic