ID: 1092254494

View in Genome Browser
Species Human (GRCh38)
Location 12:6918857-6918879
Sequence CTGTAATCACAGATACTAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4533
Summary {0: 1, 1: 1, 2: 39, 3: 488, 4: 4004}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092254486_1092254494 25 Left 1092254486 12:6918809-6918831 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1092254494 12:6918857-6918879 CTGTAATCACAGATACTAGCGGG 0: 1
1: 1
2: 39
3: 488
4: 4004
1092254491_1092254494 -3 Left 1092254491 12:6918837-6918859 CCGGGCATGGTGGCGTGTGCCTG 0: 703
1: 8541
2: 34708
3: 93166
4: 154651
Right 1092254494 12:6918857-6918879 CTGTAATCACAGATACTAGCGGG 0: 1
1: 1
2: 39
3: 488
4: 4004
1092254484_1092254494 27 Left 1092254484 12:6918807-6918829 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1092254494 12:6918857-6918879 CTGTAATCACAGATACTAGCGGG 0: 1
1: 1
2: 39
3: 488
4: 4004
1092254485_1092254494 26 Left 1092254485 12:6918808-6918830 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1092254494 12:6918857-6918879 CTGTAATCACAGATACTAGCGGG 0: 1
1: 1
2: 39
3: 488
4: 4004

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092254494 Original CRISPR CTGTAATCACAGATACTAGC GGG Intronic
Too many off-targets to display for this crispr