ID: 1092254518

View in Genome Browser
Species Human (GRCh38)
Location 12:6919011-6919033
Sequence CTGGAGCCCTTGGGAATACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092254513_1092254518 13 Left 1092254513 12:6918975-6918997 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1092254518 12:6919011-6919033 CTGGAGCCCTTGGGAATACTGGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092254518 Original CRISPR CTGGAGCCCTTGGGAATACT GGG Intronic
901408314 1:9065212-9065234 CTGTAGCCCTGGGAAACACTGGG - Intronic
901896028 1:12312820-12312842 CTGGAAGCTTTGGCAATACTAGG + Intronic
904046279 1:27610839-27610861 CTGTGGCCCTTGGGAAGCCTTGG + Intergenic
904221447 1:28973301-28973323 CTGGTGTCCTTGGGGATATTGGG + Intronic
904384808 1:30134383-30134405 CTTGAGCCCTGGGGAGAACTGGG + Intergenic
905014431 1:34767612-34767634 CTGAAGCACTTGGAAAGACTAGG - Intronic
905733083 1:40309887-40309909 CAGGACCCCTGGGGAGTACTGGG - Intronic
905792186 1:40795786-40795808 CTGGAGACCTGGGGAACTCTAGG + Intronic
907865541 1:58396236-58396258 CTGGAGCCCCTGGGAATGGCTGG - Intronic
911161872 1:94689379-94689401 CTGGAGCCCTTTAGAAAAATGGG + Intergenic
912445940 1:109736738-109736760 CTGGAGTCCCTGTGAAGACTGGG - Exonic
915599815 1:156915009-156915031 CTGGAGGCCTTGGGAGCAGTGGG - Exonic
916995580 1:170295042-170295064 CTGGTTCCCTTGGGAATAGATGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917455124 1:175179562-175179584 CTTGATCCCTTGGGAATAGGGGG + Intronic
920268521 1:204745222-204745244 CTGGATCCCTGGGGAATAGAGGG - Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921303244 1:213770475-213770497 CTGGAGTGCATAGGAATACTTGG + Intergenic
921623171 1:217348901-217348923 CTTTACCCCTGGGGAATACTTGG - Intergenic
921749397 1:218775441-218775463 CTGGACACCTTTGGAACACTAGG + Intergenic
1062954902 10:1533625-1533647 ATGCTGCCCTTGGGAATACCAGG + Intronic
1063670429 10:8095589-8095611 GTGGAGCCCTTGGGTGGACTTGG + Intergenic
1066252285 10:33646354-33646376 GGGGAGCCCTTGGGAATAGAAGG - Intergenic
1066269330 10:33807098-33807120 CTGGGGGCCTGGGGAATACAAGG - Intergenic
1067938016 10:50627501-50627523 ATGGAGCCCGTGGCAACACTGGG + Intergenic
1069806819 10:71131540-71131562 CTGGAGTCCTTGGGAGATCTAGG - Intergenic
1074302671 10:112247097-112247119 CTGGAGCCCTTGGCATTTCTTGG - Intergenic
1076564267 10:131387339-131387361 CTGGAGCCCTGGGGACAGCTGGG - Intergenic
1076983979 11:222438-222460 CTGGGGTCCTTGGGAATCCACGG + Intronic
1078097917 11:8311794-8311816 CTGGAGCCCTTGGGGGTGTTGGG - Intergenic
1079887654 11:26007701-26007723 AAGAAGCCCTTGGGAAAACTGGG - Intergenic
1080889113 11:36393639-36393661 CTGGAGACTTTGGCAATTCTGGG + Intronic
1082236701 11:49826357-49826379 CTGGAACACTCGGGAACACTGGG - Intergenic
1082866665 11:57906371-57906393 CTGGAGCCCTTGGAAGAACAGGG + Intergenic
1083821389 11:65173178-65173200 CCGGAGGCTTTGGGAAGACTGGG - Exonic
1084374420 11:68766275-68766297 CTGGACCCCTTGGGCAGCCTAGG - Intronic
1084617194 11:70244412-70244434 CTTGAGCCCTTGGGAAAAGCAGG - Intergenic
1084914441 11:72417873-72417895 CTTGAGCCCTTGGGAATTCCGGG + Intronic
1085531290 11:77193734-77193756 CTGGAGCCCTGGGGAGCTCTAGG + Intronic
1086904156 11:92399851-92399873 CTGGATCCCTGGTGAATACACGG - Intronic
1087524831 11:99296649-99296671 GTGGAGCCCTTGGAAAAACAGGG + Intronic
1089277149 11:117345045-117345067 CTGTGTCCCTTGGGAACACTTGG + Intronic
1091339731 11:134800993-134801015 CTGAAGCCCTGGGGAATGGTTGG + Intergenic
1092169007 12:6361804-6361826 CAGGATGCCTTGGGAAGACTGGG - Intronic
1092254518 12:6919011-6919033 CTGGAGCCCTTGGGAATACTGGG + Intronic
1092888860 12:12950287-12950309 CTGGAGTCCCTGGCCATACTTGG - Exonic
1100519236 12:95357467-95357489 CTTGAAGCCTTGGGAAGACTGGG + Intergenic
1100557150 12:95706875-95706897 CTGGAGGGCTTGTGAAAACTCGG + Intronic
1100713809 12:97284888-97284910 CTGGAGCCCAGGGAAATACGGGG - Intergenic
1101133098 12:101709607-101709629 CCTGAGGCCTTGGGAAGACTGGG + Intronic
1102429267 12:112868908-112868930 CTGGAGCCTGGGAGAATACTCGG + Intronic
1102796823 12:115696124-115696146 CTGGAGCCCTAGGGAAACCAGGG + Intergenic
1109693245 13:65920721-65920743 CTGTAGCCCTTTGGTATCCTGGG - Intergenic
1113038544 13:106078688-106078710 CTGGCACCCTGGGGAATACCAGG + Intergenic
1113867077 13:113533385-113533407 CTGACGCCCTTGGGAATCATAGG + Intronic
1117613641 14:57509706-57509728 CTTGAGCTCTGGGGGATACTGGG - Intergenic
1118459239 14:65973752-65973774 CTGGTGCACTTGGGAACATTTGG + Intronic
1118461288 14:65989401-65989423 CTGGAGCACTTGTGAATTCAAGG + Intronic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1122542055 14:102504192-102504214 TCGGGGCCCTTGGGAACACTGGG + Exonic
1128233527 15:66051664-66051686 CTGGAGCCTTGGGGCATGCTCGG + Intronic
1129681807 15:77662375-77662397 CTGGAGCCCTTGGGGATGAGGGG + Intronic
1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG + Intronic
1132643830 16:989834-989856 CCCCAGCTCTTGGGAATACTGGG - Intergenic
1135540101 16:23323381-23323403 CTGGAGCCCTTGGGTACCCTGGG - Intronic
1139567985 16:67791607-67791629 CTGGAGCCCCTGGGAGGTCTAGG - Intronic
1141035778 16:80624142-80624164 CTTGAGTCCTTGTGAATACCAGG - Intronic
1142102650 16:88283831-88283853 CTGCAGACCTTGGGCACACTGGG - Intergenic
1143679603 17:8466734-8466756 ATTGAGCCTTTGGGAATCCTGGG - Intronic
1144246617 17:13372534-13372556 CTGGAGCCCCTGGATATCCTGGG + Intergenic
1144434710 17:15230328-15230350 CTGGAGCCCTTGCAAAAACACGG - Exonic
1144882874 17:18439620-18439642 CTGGAGCCCTTGGGGCCAGTGGG - Intergenic
1145149357 17:20504766-20504788 CTGGAGCCCTTGGGGCCAGTGGG + Intergenic
1148842423 17:50507864-50507886 CTGGAGCCCTGAGGCATTCTGGG - Intergenic
1151472186 17:74325449-74325471 CAGGAGGCCCTGGGAAAACTTGG - Intergenic
1152097495 17:78280413-78280435 CTGGACCCCTCTGGATTACTGGG - Intergenic
1153192617 18:2558991-2559013 CTGGAGCCCTTGGGTATTGCTGG + Intronic
1153305898 18:3630440-3630462 CTCGAGATCTTGGGAATTCTCGG + Intronic
1161299455 19:3535840-3535862 CTGGACCCCTTGGGTCTCCTTGG - Intronic
1162140649 19:8583731-8583753 CTGTAGTCCTTGGGGAGACTTGG + Intronic
1163618893 19:18346100-18346122 CGGGAGGGCTTGGGAGTACTTGG - Intronic
1163692747 19:18746153-18746175 CTGGAGCCTTTGGCCAGACTTGG + Intronic
1163857474 19:19716079-19716101 CTTGAGACTTTGGGAAGACTCGG + Intronic
1164386383 19:27774068-27774090 CCCGAGTCCTTGGGACTACTGGG + Intergenic
1164544882 19:29152095-29152117 ATGGAGCCCCTGGGAATTGTGGG + Intergenic
1165403191 19:35614761-35614783 CAGGAGGCCTTGGGACTTCTAGG + Intronic
1168571838 19:57477045-57477067 CTGGAGCATTTGGGAAAACTGGG - Intronic
926252976 2:11166292-11166314 CAGGAGCCCTTGGAAATTTTCGG - Intronic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
928428448 2:31198701-31198723 CTGGAGTACTTGGGAAGAGTTGG + Intronic
931424079 2:62154913-62154935 CTGGAGCCTTTGGGAAAGCATGG - Intergenic
933806071 2:85998690-85998712 TAGGAGCCCTTGGGGAAACTGGG + Intergenic
936528555 2:113258985-113259007 CTGGAGACCTTGGGAGCACAGGG + Intronic
948396704 2:237650090-237650112 CTGGAGCCCTTTCCAACACTTGG - Intronic
1169921266 20:10736451-10736473 CTGGAGCCCTCTGAAATTCTAGG + Intergenic
1174948774 20:55019901-55019923 GTGGAGCCCTTGAGAATTCAGGG + Intergenic
1175836875 20:62001620-62001642 CTGGAGCCCATAGGAGGACTGGG - Intronic
1176124183 20:63468128-63468150 CTGGACCCCTTGGGAGGTCTCGG - Intronic
1179709369 21:43204106-43204128 CTGGAGCCCTGGAGAACCCTGGG - Intergenic
1183197308 22:36362337-36362359 CTGGAGCTCCTGGGATTGCTTGG - Intronic
1183292069 22:37009046-37009068 CTGCAGCCCTGGCCAATACTTGG - Intergenic
949121297 3:387789-387811 CTGCAGACCTTGTTAATACTTGG - Intronic
949897411 3:8778516-8778538 CTCGATCCCTTGGGAATCCTGGG - Intronic
951520810 3:23609298-23609320 CTGGAGCCCTTGGAGTCACTGGG - Intergenic
952042117 3:29273534-29273556 CTGGAGACCTGGGGAAGAGTTGG + Intergenic
952160096 3:30684700-30684722 TTGTATCCCTTGGGAATATTAGG + Intronic
954289663 3:49642911-49642933 CTGGAGCCCTGCCGAAAACTGGG + Exonic
955542884 3:59996617-59996639 CTGGAGCCCTTTGGACTCTTTGG - Intronic
956591958 3:70924552-70924574 CTGGCCACCTTGGGCATACTTGG - Intergenic
956678806 3:71759129-71759151 CTGTAGGCCTTGGGAAAACAGGG - Intergenic
961492343 3:127264584-127264606 CTGGAGCCTCTGAGGATACTCGG - Intergenic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
966674074 3:182566057-182566079 CTGGATCCCCTGGAACTACTGGG + Intergenic
966735369 3:183182721-183182743 CAGGAGCCCTGGGGGATACCTGG - Intronic
966871059 3:184290890-184290912 CAGGAGCCACTGGGAATTCTAGG - Intronic
970324259 4:14906847-14906869 CTGGAACCCTTGGGACTATGGGG - Intergenic
971600032 4:28581051-28581073 CTGCAGCACATGGGAATTCTGGG - Intergenic
972332059 4:38073230-38073252 CTGGAGCCCTTGGGCACTGTTGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973290270 4:48464050-48464072 CTTGAGCCATTGGGAATTTTGGG + Intergenic
975855838 4:78623222-78623244 CTGGAGCCCCAGGGAAGAGTTGG - Intergenic
980017306 4:127665678-127665700 CCTAAGCCCTTGGGAATAATAGG - Intronic
983667848 4:170202183-170202205 CTGGAGTCCTTGGGCAGGCTGGG - Intergenic
984574915 4:181436852-181436874 CAAGAGCCCTTTGAAATACTTGG + Intergenic
987166065 5:15199953-15199975 GTGGAGCCCTTGGAAAAACAGGG + Intergenic
997219584 5:132149780-132149802 CTAGAGACCTTGGGACTAGTGGG - Intergenic
997565960 5:134886628-134886650 CTGCTGCCCTTGGGAGTGCTGGG - Intronic
997745381 5:136295526-136295548 CTGGGGCACTGGGGACTACTGGG - Intronic
1012611885 6:101228387-101228409 CTTGAACCCTTGGGAAAGCTGGG + Intergenic
1016550856 6:145278404-145278426 ATGGAGCCCTTGTGGACACTTGG + Intergenic
1016934164 6:149436499-149436521 CTGGAGCCACTTGGAATCCTGGG - Intergenic
1018465030 6:164036121-164036143 CAGGAGGCCTTGGGAATCCGTGG + Intergenic
1018987188 6:168646864-168646886 CTGGAGCACCTGAGGATACTTGG + Intronic
1019334478 7:476502-476524 CTGGGGCCCTTGAGAACACCTGG - Intergenic
1019784597 7:2967162-2967184 CAGGGTCCTTTGGGAATACTAGG - Intronic
1021500240 7:21324650-21324672 CTGGAGAACTTGGGGATACTTGG + Intergenic
1023390794 7:39709873-39709895 CTGCAGCCCTGGGGAAATCTCGG - Intergenic
1032547830 7:132758322-132758344 CTGGAGCCCTAGGGTTTCCTCGG + Intergenic
1033035941 7:137876455-137876477 CTGAGGCCCTAGGGAATATTGGG - Exonic
1033562305 7:142544315-142544337 ATTGAGGCCTTGGGAATTCTAGG - Intergenic
1035395194 7:158530397-158530419 CAGGAGCTCCTGGGAATGCTGGG + Intronic
1038328739 8:26591283-26591305 GTGGGGCCCATGGGAATGCTAGG + Intronic
1038653152 8:29423902-29423924 CTGGGGCCCTGGGGATTACTGGG + Intergenic
1046728812 8:117703432-117703454 CTGCAGCCCTTGTCAATACCAGG - Intergenic
1049427477 8:142543881-142543903 CTGGAGGCCATGGCCATACTGGG + Intronic
1052171482 9:25402996-25403018 CTGGAGCACTCATGAATACTAGG - Intergenic
1052991380 9:34521115-34521137 CTGGAACCCATGGCAATAATAGG - Exonic
1056140178 9:83670048-83670070 CTGTAGCCCTTGGCAATAAAAGG - Intronic
1057514760 9:95711751-95711773 CTGGAGGCCGTGGAAATACCAGG - Intergenic
1057680700 9:97180677-97180699 ATTGAGCTCTTGTGAATACTGGG + Intergenic
1057792039 9:98130871-98130893 CTGGGGCCATTGGGAACACAGGG - Intronic
1059515989 9:114895922-114895944 CTGTCTCCCTTGGGAATATTGGG - Intronic
1060375760 9:123114353-123114375 CTGTAGCCCATGGGAAGACGTGG - Intronic
1060759383 9:126235044-126235066 CGGGAACCCTTGGGACTATTTGG - Intergenic
1062066305 9:134528398-134528420 CATGAGCCCTTGGGACTCCTTGG + Intergenic
1062184488 9:135210595-135210617 CTGGTGCCATTAGGAAAACTCGG + Intergenic
1062189517 9:135240640-135240662 ATGAAGGCCTTGGGAATAGTCGG - Intergenic
1185909772 X:3970932-3970954 CTGGAACCCTTGGGGAAGCTGGG - Intergenic
1193726171 X:85041706-85041728 CTGGAGGCCTTGGGAATAGAGGG + Intronic
1195432005 X:104799386-104799408 CTGGAGGCCTTGTGAAAACCTGG + Intronic
1197722501 X:129754902-129754924 CTGGACCACTTGAGAATACCAGG + Intronic
1199977017 X:152900151-152900173 CAGGAGGCCTTGGGGACACTGGG - Intergenic
1200146589 X:153929523-153929545 CTGGAGCCCACGGGTATGCTGGG + Exonic