ID: 1092256198

View in Genome Browser
Species Human (GRCh38)
Location 12:6927970-6927992
Sequence CCGCGCGATCCCGGGCCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 83}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092256198_1092256205 -6 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256205 12:6927987-6928009 GCGCGGGTGCGGGCTGCGCTAGG 0: 1
1: 0
2: 3
3: 22
4: 254
1092256198_1092256214 18 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256214 12:6928011-6928033 GGGCGCGGGCGGCGGCGGGTCGG 0: 1
1: 1
2: 34
3: 212
4: 1313
1092256198_1092256213 14 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256213 12:6928007-6928029 AGGCGGGCGCGGGCGGCGGCGGG 0: 1
1: 0
2: 15
3: 137
4: 977
1092256198_1092256212 13 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256212 12:6928006-6928028 TAGGCGGGCGCGGGCGGCGGCGG 0: 1
1: 2
2: 11
3: 80
4: 734
1092256198_1092256209 4 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256209 12:6927997-6928019 GGGCTGCGCTAGGCGGGCGCGGG 0: 1
1: 0
2: 2
3: 35
4: 304
1092256198_1092256206 -3 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256206 12:6927990-6928012 CGGGTGCGGGCTGCGCTAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 145
1092256198_1092256207 -2 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256207 12:6927991-6928013 GGGTGCGGGCTGCGCTAGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 246
1092256198_1092256211 10 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256211 12:6928003-6928025 CGCTAGGCGGGCGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 52
4: 311
1092256198_1092256208 3 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256208 12:6927996-6928018 CGGGCTGCGCTAGGCGGGCGCGG 0: 1
1: 0
2: 1
3: 14
4: 164
1092256198_1092256210 7 Left 1092256198 12:6927970-6927992 CCGAGGGGCCCGGGATCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1092256210 12:6928000-6928022 CTGCGCTAGGCGGGCGCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092256198 Original CRISPR CCGCGCGATCCCGGGCCCCT CGG (reversed) Intronic
900333854 1:2151001-2151023 CAGCGCGTTCCCGGGCCCCCGGG - Intronic
903324856 1:22563828-22563850 CCGAGGGATCCCGGCCGCCTTGG - Intronic
904045222 1:27604404-27604426 CCGCTCGATCCAGAGCCCCCCGG - Intronic
904855083 1:33491652-33491674 CCCTGCAATCCTGGGCCCCTGGG - Exonic
907501908 1:54887214-54887236 GCGGGCGATCCCGGGCTCCCCGG - Exonic
921923074 1:220690261-220690283 CAACGCTATCCCGGGCCCCACGG + Exonic
923150921 1:231232462-231232484 CCCCGTCATCCCGGGTCCCTAGG + Intronic
1063458484 10:6201512-6201534 TTGCGCGTTCCGGGGCCCCTCGG + Intronic
1076905095 10:133357549-133357571 CCGCGCGTCCTCTGGCCCCTGGG - Intronic
1080384827 11:31805147-31805169 GCCCGCGACCCCGCGCCCCTCGG + Intronic
1083272784 11:61580629-61580651 CCGCTCGATCCCGCGCCCCCGGG + Intronic
1083681947 11:64355355-64355377 CAGCGCCATCCAGGCCCCCTGGG + Exonic
1087138117 11:94740513-94740535 CCGCGCGCCCTCGGGCCCCCGGG + Intronic
1090211030 11:124921232-124921254 CCGGGCGAGCTCGGGGCCCTGGG + Exonic
1092008352 12:5088265-5088287 CCATGCAATCCCGGGCCCCCAGG + Intergenic
1092256198 12:6927970-6927992 CCGCGCGATCCCGGGCCCCTCGG - Intronic
1094838740 12:34334269-34334291 CGGCGCAAACCCGGGACCCTAGG - Intergenic
1095949392 12:47773588-47773610 CCACGCGGGCCCGGGCTCCTGGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103325274 12:120116432-120116454 CGGCGCGGTCCGGAGCCCCTCGG + Intronic
1103775572 12:123364525-123364547 CCGCGCGCTCCGGGGCCCTCGGG - Intronic
1104602346 12:130162307-130162329 CCGCGGGCTCCCGGGCCCCGCGG - Intergenic
1104942065 12:132399822-132399844 CCGCGGGCTCCCGGACGCCTGGG + Intergenic
1104961664 12:132490923-132490945 TCGGGCGATCCCGGGACCCCTGG + Intronic
1113378947 13:109786162-109786184 CCGCCCGATCACGCGTCCCTCGG + Exonic
1113895102 13:113759276-113759298 CCGCCGGTGCCCGGGCCCCTGGG + Exonic
1118220927 14:63853668-63853690 CCGCGGGTTCCCGGGTCCCCGGG - Intronic
1122220805 14:100238439-100238461 CCGCGCGGCCCCGGGCACCACGG - Intronic
1123034719 14:105467235-105467257 CTGCGGGACCCCAGGCCCCTTGG + Intronic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1129791207 15:78341630-78341652 CCGCGCCCGCCCGGGTCCCTGGG + Intronic
1132552674 16:559928-559950 CCACCCGAGCCAGGGCCCCTGGG - Intergenic
1139465042 16:67149989-67150011 CCGCCCGAGCCTGCGCCCCTGGG + Exonic
1141665422 16:85463042-85463064 CCGCGGGACCCGGGGCCTCTAGG - Intergenic
1147183618 17:38702254-38702276 CAGGGCGATCCCGGGGCCCTAGG - Intergenic
1149657745 17:58319192-58319214 CCGCCTGCACCCGGGCCCCTTGG - Exonic
1151293179 17:73164985-73165007 CCCAGCCAGCCCGGGCCCCTCGG - Intergenic
1152049211 17:77959162-77959184 CCGCGCACTCCCGAGGCCCTCGG + Intergenic
1152360752 17:79832126-79832148 CCGCACAGACCCGGGCCCCTTGG + Intergenic
1152544089 17:80992104-80992126 CAGCGCGCAGCCGGGCCCCTCGG + Intronic
1152699029 17:81810225-81810247 CCGAGCCCTCCCAGGCCCCTGGG - Intronic
1161108521 19:2456091-2456113 CCCCGCGATCGCGCGCCCCGTGG + Intronic
1161108689 19:2456593-2456615 CCCCGCGATCGCGCGCCCCGCGG + Intronic
1161280954 19:3445521-3445543 CCGGGTGTTCCCGGGTCCCTGGG + Intronic
1163154508 19:15432569-15432591 CCCCCCGAGCCCGGGCCCCGCGG - Intronic
1167096064 19:47375678-47375700 CCACGCCATCACTGGCCCCTGGG - Exonic
1167474347 19:49691354-49691376 CCGCCGGAGCCCGAGCCCCTGGG - Intronic
930241223 2:48937601-48937623 CCGCACCATCACGGGGCCCTGGG + Intergenic
930711920 2:54557999-54558021 CCGCGCGGGCCCGGGACCCTTGG + Intronic
935301723 2:101698329-101698351 CCGCGCGACCCCCGGGCGCTGGG + Intronic
935631518 2:105216278-105216300 CTGAGCGAGACCGGGCCCCTGGG + Intergenic
937128024 2:119486672-119486694 CTGTGCGATCCTGGGCCCCTTGG + Intronic
949050332 2:241894516-241894538 CCACGAGATCCCAGGGCCCTGGG - Intronic
1169088418 20:2841174-2841196 CCGTGCGATCCCGCCCCCCTCGG - Intronic
1174346794 20:49936344-49936366 CCCCGCGAGCCCCGCCCCCTCGG + Intergenic
1180092542 21:45540399-45540421 CCCAGGGCTCCCGGGCCCCTGGG - Intronic
1181811383 22:25405522-25405544 CCGCGGGGACCCGGGCCGCTGGG - Intergenic
1184698057 22:46150648-46150670 CCGCCCGCCCCCGGGCACCTGGG - Intronic
1185227337 22:49660481-49660503 CCTCGCCATCCCAGCCCCCTCGG - Intergenic
951543745 3:23806380-23806402 ACCCCCGCTCCCGGGCCCCTCGG - Intronic
951543769 3:23806431-23806453 CCCCGCGAACCCCCGCCCCTGGG - Intronic
967054985 3:185823906-185823928 CAGCGCGCTCGCGGGCCCCCCGG + Intronic
969295889 4:6270387-6270409 CCCCGCGGTCCCGGGACCCACGG + Intronic
972960556 4:44447943-44447965 CCGTGCGCTCCCGGGCCCGAGGG + Exonic
982033626 4:151325247-151325269 CCGTGCGCTCTCGGGCCACTCGG - Intronic
984714930 4:182917054-182917076 CTGTGCGAGGCCGGGCCCCTTGG - Intronic
985544416 5:501935-501957 CCGAGCGAGGCCGGGCCCCCGGG + Intronic
985573070 5:660850-660872 CCACTCCATCCCGGGCCCCAGGG - Exonic
985651934 5:1111547-1111569 CGGAGGGAGCCCGGGCCCCTGGG - Intronic
994486913 5:100392324-100392346 CCGCCAGATCCCAGGCCTCTAGG + Intergenic
997467177 5:134096134-134096156 CCGCACAATCCCGGGCCCTGGGG - Intergenic
998151436 5:139759645-139759667 CCGCGCCACGCCGGGCCCTTTGG + Intergenic
998228844 5:140346536-140346558 CCGCCCGACCCCGCGCGCCTAGG + Exonic
1002590914 5:180291526-180291548 GGACGCGACCCCGGGCCCCTGGG + Intronic
1005549366 6:26898172-26898194 CCCCGTGATCCCAGGCCTCTAGG + Intergenic
1005549716 6:26899809-26899831 CCCCGTGATCCCAGGCCTCTAGG + Intergenic
1007591171 6:43021711-43021733 CCTCGCGGTCCCGGGCCCCGCGG - Exonic
1019404583 7:876922-876944 CCGGGCGACCCGCGGCCCCTGGG - Intronic
1023703134 7:42912032-42912054 CCGCGCGAGCCCCGCCGCCTCGG + Exonic
1027260554 7:76461881-76461903 CCGCGCCACCCCGCGCCCCTGGG - Intronic
1027311933 7:76959994-76960016 CCGCGCCCCCCCGCGCCCCTGGG - Intergenic
1032781952 7:135170729-135170751 CCGCGCGCTCCGGGGTCCCGCGG + Intronic
1034500688 7:151448653-151448675 CCCCGCCAGCCCGGGCCCCCTGG + Intergenic
1046770513 8:118112208-118112230 CCGCGCGGCCCCGGGCGCCCTGG + Intergenic
1049714343 8:144082834-144082856 CGGCGCGAGCCCAGGGCCCTCGG - Intronic
1052993493 9:34536750-34536772 CCACACGATCCCAGGCCCCTGGG - Intergenic
1057227955 9:93302358-93302380 CAGCGCGACCCCCGACCCCTCGG - Intronic
1060096216 9:120793160-120793182 GCGCGAGGTCCCGGGCCCCGGGG - Exonic
1060925252 9:127451399-127451421 CCGCGCGATTTCCGGCCTCTCGG - Exonic
1062025005 9:134336177-134336199 CCGCACCATCCCGGGCCCAGTGG + Intronic
1062094088 9:134694214-134694236 CCCCGTGATCCAGGGCCACTTGG - Intronic
1062560485 9:137139436-137139458 CGGCGCGAACGCGGGGCCCTCGG - Intronic
1185450775 X:280184-280206 CCCCGCGGCCCCGGGACCCTGGG + Intronic
1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG + Intergenic
1198310243 X:135422562-135422584 CTGCGCGATCCAGGGCCCCCGGG - Intergenic