ID: 1092256260

View in Genome Browser
Species Human (GRCh38)
Location 12:6928120-6928142
Sequence GGGAGGCGGCGAGCCCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 1, 1: 0, 2: 6, 3: 89, 4: 714}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092256247_1092256260 1 Left 1092256247 12:6928096-6928118 CCCGGGGCATTCCGGGCGGCCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1092256260 12:6928120-6928142 GGGAGGCGGCGAGCCCGGGGAGG 0: 1
1: 0
2: 6
3: 89
4: 714
1092256248_1092256260 0 Left 1092256248 12:6928097-6928119 CCGGGGCATTCCGGGCGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1092256260 12:6928120-6928142 GGGAGGCGGCGAGCCCGGGGAGG 0: 1
1: 0
2: 6
3: 89
4: 714
1092256255_1092256260 -10 Left 1092256255 12:6928107-6928129 CCGGGCGGCCAGGGGGAGGCGGC 0: 1
1: 0
2: 5
3: 53
4: 465
Right 1092256260 12:6928120-6928142 GGGAGGCGGCGAGCCCGGGGAGG 0: 1
1: 0
2: 6
3: 89
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092256260 Original CRISPR GGGAGGCGGCGAGCCCGGGG AGG Intronic